Dexamethasone Sensitizes the Neonatal Intestine to Fructose Induction of Intestinal Fructose Transporter (Slc2A5) Function

Abstract

The recent dramatic increase in fructose consumption is tightly correlated with an equally dramatic surge in the incidence of type 2 diabetes and obesity in children, but little is known about dietary fructose metabolism and absorption in neonates. The expression of the rat intestinal fructose transporter GLUT5 [Slc2A5, a member of the glucose transporter family (GLUT)] can be specifically induced by its substrate fructose, but only after weaning begins at 14 d of age. In suckling rats younger than 14 d old, dietary fructose cannot enhance GLUT5 expression. The aim of this study was to identify the mechanisms allowing fructose to stimulate GLUT5 during weaning. After intestines were perfused with fructose or glucose (control), using microarray hybridization we showed that of 5K genes analyzed in 10-d-old pups, only 13 were fructose responsive. Previous work found approximately 50 fructose-responsive genes in 20-d-old pups. To identify fructose-responsive genes whose expression also changed with age, intestines of 10- and 20-d-old littermate pups perfused with fructose were compared by microarray. Intestines of 10- and 20-d-old pups perfused with glucose were used to segregate age- but not fructose-responsive genes. About 28 genes were up- and 22 down-regulated in 20- relative to 10-d-old pups, under conditions of fructose perfusion, and many were found, by cluster analysis, to be regulated by corticosterone. When dexamethasone was injected into suckling pups before fructose perfusion, the expression of GLUT5 but not that of the sodium glucose cotransporter (SGLT) 1 and of GLUT2, as well as the uptake of fructose but not of glucose increased dramatically. Thus, dexamethasone, which allows dietary fructose to precociously stimulate intestinal fructose absorption, can mimic the effect of age and modify developmental timing mechanisms regulating GLUT5.

THROUGHOUT THE WORLD and especially in the United States, the per capita consumption of corn syrup containing mostly fructose has increased by approximately 2100% in the last century (1), and has been tightly correlated with an increased incidence of type 2 diabetes and childhood obesity (2). Infants generally malabsorb fructose (3), but perinatal fructose transport by the small intestine of mammals is a neglected subject area of research because fructose has long been considered to be a minor contributor to metabolic diseases. The signaling mechanisms underlying dietary regulation of the intestinal fructose transporter GLUT5 [Slc2A5, a member of the glucose transporter family (GLUT)] are virtually unknown. In normal adult rats and mice, fructose transport and GLUT5 expression level are increased 2- to 3-fold by dietary fructose or fructose perfusion (4). However, in the neonates of many mammals, the regulation of GLUT5 appears to be more complicated. During the suckling period when neonatal rats, rabbits, and humans do not consume fructose, GLUT5 expression and activity are low and increase only when weaning has been completed (5). In rats, which like humans are omnivores and therefore undergo during weaning a switch to a diet likely containing fructose, GLUT5 becomes fructose responsive at more than or equal to 14 d of age, and can be stimulated by introducing fructose into the intestinal lumen (6); other transporters are not affected by fructose, and other sugars and solutes have no effect on GLUT5 (7,8). Incredibly, the rat intestine is fructose insensitive before approximately 14 d of age, when GLUT5 and fructose uptake are not inducible by luminal fructose (6). Thus, the ontogenetic development of the intestine determines when substrate regulation of GLUT5 can occur. However, the mechanisms underlying the interaction between substrate regulation of GLUT5 and small intestinal maturation have never been studied. Unraveling these mechanisms may yield information that will increase our understanding not only of neonatal fructose metabolism but also of developmental processes that control maturation of intestinal transport.

GLUT5 is localized in the apical membrane of intestinal cells (9), and cytosolic fructose is transported to the blood by the basolateral glucose/fructose transporter GLUT2 (Slc2A2), which has also been hypothesized to participate in the apical transport of sugars (10). The third major sugar transporter is the sodium-glucose cotransporter 1 (SGLT1) (Slc5A1), located in the apical membrane. Recently, another glucose/fructose transporter, GLUT7 (Slc2A7), had been identified (11) in the apical membrane. However, only GLUT5 is specifically and markedly regulated by fructose (12); in fact, its response is directly proportional to luminal concentrations of fructose. In contrast, GLUT5 expression in intestines perfused with glucose is always low and the same as those in intestines perfused with nonmetabolizable glucose or fructose analogs (6). In weaning, 20-d-old rat intestines characterized by fructose sensitivity, we have already identified by microarray analysis 50 other fructose-responsive genes, paralleling the changes in GLUT5 expression (13).

In this study we first tested, using microarray hybridization, the hypothesis that the population of fructose-responsive genes at 20 d of age is different from the population of fructose-responsive genes in the 10-d-old pups when GLUT5 is fructose insensitive. For this hypothesis, intestines of same-age (10 d old) pups were compared after either fructose or glucose perfusion. Having proven this hypothesis, we then tried to identify regulatory genes that modulate fructose sensitivity by tracking changes in expression as a function of age. For this, the intestines of 10- and 20-d-old pups perfused with fructose were compared by microarray analysis (same perfusion solution, different age groups). Intestines of 10- and 20-d-old pups perfused with glucose were used to segregate age- but not fructose-responsive genes. When the microarray results revealed that a significant number of age- and fructose-responsive genes was modulated by glucocorticoids, we then tested the hypothesis that corticosteroids play a major role in regulating intestinal GLUT5 development by injecting pups with a synthetic glucocorticoid, dexamethasone (dex).

Materials and Methods

Experimental design

Experiment 1: microarray studies.

Ten- and 20-d-old rat pups from five litters were divided into four perfusion groups. Five 10-d-old pups were perfused with high glucose solution (10G) and five with high fructose solution (10F) (Fig. 1). At 20 d old, five pups were perfused with the glucose (20G) and five with the fructose solution (20F). Glucose and fructose solutions were continuously perfused for 4 h; we have previously shown that 4-h perfusion is sufficient time to detect fructose-induced changes in GLUT5 mRNA abundance, GLUT5 protein abundance in the apical membrane, and in fructose transport rate (7). The sugar concentration (100 mm in Ringer solution) was also based on previous work indicating that peak luminal sugar concentration in rats fed high carbohydrate (14) exceeded 100 mm.

Figure 1.

Experimental design. Five 10-d-old pups were perfused with glucose solution (10G), five with fructose solution (10F), five 20-d-old pups were perfused with glucose (20G) and five with fructose solution (20F). With the first set of microarray, 10G and 10F littermates were compared with identify fructose-responsive genes in the suckling stage. With a second set of microarray, we compared the expression of genes in the intestines of 10- and 20-d-old pups perfused with fructose (10 vs. 20F) and the expression of genes in the intestines of 10- and 20-d-old pups perfused with glucose (10 vs. 20G). To segregate specific fructose- and age-responsive genes, the 10 and 20G groups were used as control to identify genes that change with age in intestines not perfused with fructose.

The intestinal transcriptome of the perfused pups was analyzed by microarrays in two different sets of experiments (Fig. 1). In the first set, the intestinal gene expression levels from 10-d-old rats perfused with glucose were compared with those perfused with fructose (10G vs. 10F, respectively) by microarray to determine fructose-responsive genes in the suckling stage. These genes are fructose responsive but age independent. With a second set of microarrays, we identified fructose-responsive genes whose expression also changes with age. For this, we compared the expression of the genes in the intestines of 10 and 20-d-old pups perfused with fructose (10 vs. 20F, respectively), to yield a list of genes that change with age under fructose perfusion. We also compared the expression of genes in the intestines of 10- and 20-d-old pups perfused with glucose. This comparison between 10- and 20-d-old pups perfused with glucose was used as control to identify genes that are not fructose responsive but whose expression changes with age.

Experiment 2: dex study.

To determine the role of glucocorticoids in GLUT5 development, we examined the effect of dex on fructose induction of GLUT5 in the 10-d-old pups. Pups received daily injections for 2-d dex (ip 50 ng/kg body weight) or vehicle (the same volume of 5% dimethyl sulfoxide, the solvent for dex, in saline solution) beginning at 8 d of age. dex and vehicle-treated animals were perfused at 10 d of age with glucose or fructose solution as described previously. The dose and time course of dex injection were chosen because preliminary work showed that a daily injection of dex for 2 d, from 40–400 ng/kg body weight (the dose for humans), is effective in inducing GLUT5 expression in the small intestine of 10-d-old fructose-perfused pups.

Animals

All the procedures conducted in this study were approved by the Institutional Animal Care and Use Committee, University of Medicine and Dentistry of New Jersey, New Jersey Medical School. Pregnant female Sprague Dawley rats purchased from Taconic (Germantown, NY) were housed in the research animal facility under a 12-h light, 12-h dark photoperiod in a temperature-controlled room (22–24 C). Dams were fed ad libitum a commercial diet (Purina Mills, Richmond, IN). After birth, rat pups were kept with their dams; age at birth was considered d 0. At 10 or 20 d old, rat pups were removed randomly from their dams and used for perfusion. The pups used for the dex study were injected once daily for 2 d beginning at 8 d of age with dex or vehicle and then removed from the dam at 10 d of age for perfusion experiments.

Intestinal perfusion

The rat intestinal perfusion procedure was conducted following the method previously described (7). Rat pups (10 and 20 d old, not starved) were initially anesthetized (0.2–0.4 ml/100 g body weight, ip, of ketamine 20 mg/ml and xylazine 2.5 mg/ml) and kept under continuous anesthesia for 4-h perfusion. Then after opening the abdominal cavity, the intestine was exposed, and a small incision was made 5-cm distal to the ligament of Treitz and 10-cm proximal from the ileocecal valve, and a catheter was inserted into the lumen. After the contents were flushed, the small intestine was continuously perfused with sugar solution (100 mm fructose or glucose in Ringer) at a rate of 30 ml/h at 37 C using a peristaltic pump. Composition of the perfusion solution was as follows (in mm): 78 NaCl, 4.7 KCl, 2.5 CaCl₂ · 5H₂O, 1.2 MgSO₄, 19 NaHCO₃, 2.2 KH₂PO₄, and 100 glucose or fructose (pH 7.4) (300 mOsm). After perfusion, sugar uptakes were measured in vitro, and tissues for mRNA analysis were frozen.

Glucose and fructose uptakes

Briefly, four 1-cm segments were everted and mounted on grooved steel rods and preincubated at 37 C for 5 min in Krebs ringer bicarbonate buffer [in mm: NaCl 128, KCl 4.7, NaHCO₃ 19, CaCl₂ 2.5, MgSO₄ 1.2, KH₂PO₄ 1.2 (pH 7.4)] bubbled with 95% O₂-5% CO₂ (15). Two sleeves were then incubated under agitation (1200 rpm) at 37 C in an oxygenated solution containing either d-[¹⁴C]glucose for 1 min or d-[¹⁴C]fructose for 2 min. l-[³H]glucose was used to correct for adherent fluid and passive diffusion of glucose or fructose. The tissues were quickly rinsed (20 sec) and processed for radioactivity as previously described. The uptake rates of both d-glucose and d-fructose were determined at 50 mm and expressed as nanomoles per milligram wet weight of small intestine.

mRNA extraction, DNase treatment, and RT reaction

Total RNA was extracted from 100 mg scraped mucosa using 1 ml TRIzol reagent (Invitrogen, Carlsbad, CA). The total RNA concentration was determined by spectrophotometry (Beckman DU^R640; Beckman Coulter, Inc., Fullerton, CA) and the quality analyzed by 1% agarose gel electrophoresis with ethidium bromide staining. To hydrolyze contaminating DNA in the RNA preparations, 20 μg RNA was combined with 1 μl RQ1 Rnase free DNase I (Promega, Madison, WI) and 10 μl 10×DNase buffer in a final volume of 100 μl. After Dnase treatment, RNA concentration and quality were analyzed as described previously. The cDNA was generated from 2.5 μg DNase-treated RNA using SuperScript III RNase H ⁻ Reverse Transcriptase and oligo (dT)20 (Invitrogen) in a total volume of 20 μl.

Microarray analysis

The design, analysis, and interpretation of this microarray experiment followed the same protocol used previously by us (13). We used a rat 5000-oligonucleotide array built from 4854 oligonucleotides representing 4803 independent genes, and all oligonucleotides were 60–70 nucleotides in length [Rat 5K Oligo Array (NGEL 2.0.1); Center for Applied Genomics, Public Health Research Institute, Newark, NJ]. A detailed description of array design elements is available from the following web site: http://www.cag.icph.org. The cDNA was synthesized with the 3DNA Submicro Oligo Expression Array Detection Kit (Genisphere, Hatfield, PA) and labeled with fluorescent dyes Cy3 or Cy5 following the manufacturer’s instructions (13). In the microarray experiments, 10 slides were used to compare the 10-d-old rat intestines perfused with fructose (10F) (n = 5) against those perfused with glucose (10G) (n = 5), with each pair being littermates. cDNA from 10F was then labeled with Cy5, and cDNA from 10G with Cy3. To eliminate dye bias, 10F cDNA from pups in the next experiment was labeled with Cy3, whereas 10G cDNA was labeled with Cy5. Data from this dye flip were used to correct results as described later in Data processing. Moreover, two pools of the same amount of total RNA from each of five 10F and 10G pups were made. The 10F and 10G pools were self-against-self-hybridized on two additional slides to identify potentially false-positive genes.

In the second set, 10 microarray slides were used to compare the 10-d-old rat intestines perfused with fructose for 4 h (10F) (n = 5) against 20-d-old rat intestines also perfused with fructose (20F) (n = 5). cDNA from 10F intestines was labeled alternatively with Cy5 or Cy3, whereas the paired 20F cDNAs were labeled correspondingly with Cy3 or Cy5. This random Cy3 and Cy5 labeling switch between 10 and 20F, as well as pooled self-against self-hybridizations were used to eliminate dye bias. The same procedure was used for 10- and 20-d-old rats whose intestines were perfused with glucose (10 vs. 20G comparisons).

Data processing

The data processing, normalization, and statistical analyses were done as described by previous work (13). The results (median pixel intensity of each array spot) were normalized by the locally weighed scatter smoother method (16). To eliminate genes that were considered false positives and to choose genes that might change significantly with fructose perfusion or/and age, we followed the following criteria. First, genes whose expression was so low that their average median intensity was less than 2-fold that of background intensity were eliminated. Moreover, genes whose expression changed by more than 50% in self-self hybridization experiments were also eliminated. Then, sugar-induced changes in gene expression should not be altered when a different dye was used to label the same sample, so any gene whose expression changed from a positive value to a negative value when the dye was switched was eliminated. Finally, only genes that changed by more than or equal to 50% in at least four of five comparisons in the experiment involving 10 and 20-d-old pups, and in three of five comparisons in the experiment comparing 10-d-old pups perfused in fructose and glucose, were considered. We then performed a one-sample t test to determine significance of changes in gene expression in the microarray results, following earlier work (13). Gene expression was further analyzed using Pathway Assist (Stratagene, La Jolla, CA) and Bibliosphere (Genomatix Software Inc., Ann Arbor, MI), software applications that can build and examine biological association networks, including traditional pathways, among genes selected as nodes (see Fig. 3) to reveal gene regulatory networks.

Figure 3.

Effect of development (20 and 10 d old) on small intestines perfused with glucose (HG) or fructose (HF) solutions. Only the genes that were differentially regulated (P < 0.05) with age are shown. The intersections in the middle represent the number of genes showing similar regulation under both perfusion conditions. Pathway analysis indicates a significant number of fructose- and age-responsive genes that are affected by dex.

Real-time PCR

There were 21 primers designed using primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) (Table 1), and were purchased from Integrated DNA Technologies (IDT, Coralville, IA). Quantitative PCR analyses (MX 3000P; Stratagene) for candidate responsive genes were performed using the iTaq SYBR Green Supermix with Rox (Bio-Rad Laboratories, Hercules, CA) as described by Kirchner et al. (17). For each primer set (Table 1), the efficiency of the PCR reaction (linear equation: y = slope + intercept) was measured in triplicate on serial dilutions of the same cDNA sample (pool of reverse-transcribed RNA samples). Real-time PCR efficiencies (E) for each reaction were then calculated using the following equation: E = [10^(1/slope)] − 1. Melting-curve analysis also was performed for each gene to check the specificity and identity of the RT-PCR products. The relative expression ratio of a target gene was calculated as follows:

This calculation is based on real-time PCR efficiencies (E) of target genes and the cycle threshold (Ct) difference (Δ) of an unknown sample vs. a control (ΔCt_{control − sample}). In our experiment the control is the 10-d-old pups perfused with glucose solution. Because the expression level of elongation factor 1α (EF1α) is not affected by F and G perfusion, or by age of pups (data not shown), the target gene expression has been normalized to EF1α.

Table 1.

Primer sequences of genes whose expression level had been measured by real-time PCR

Gene name	Symbol	Accession no.	Direction	Primer sequence (5′→3′)	Probe size (bp)	T
CCAAT/enhancer binding protein (C/EBP), δ	Cebpd	NM_013154	Forward	AGCCCACACCACCCACTTC	257	60
			Reverse	CTGCTCCACACGCTGATGC
Insulin-like growth factor-II	Igf2	X14834	Forward	CATCGTGGAAGAGTGCTGCT	133	58
			Reverse	GGGGTATCTGGGGAAGTCGT
Murine leukemia viral (v-raf-1) oncogene homolog 1	Raf1	NM_012639	Forward	CCCTACTCCCACATCAACAACC	123	57
			Reverse	GTCAGCCACCAACCTCTTCA
Myogenin	Myog	NM017115	Forward	CTGGGCGTGTAAGGTGTGT	600	57
			Reverse	CTGGGCTGGGTGTTAGTCTT
Cyclic nucleotide-gated channel	Cnga3	AB002801	Forward	GGGAAAGGCAGGAAGAAGGA	325	57
			Reverse	TGGGGATGAGAGACAGGATG
Nucleobinding	Nucb	Z36277	Forward	TTGGTTCCGTGCGTGCTC	216	59
			Reverse	GCTCCTTATCTCCTCTATGTCTGCTTT
Nuclear receptor subfamily 1, group H, member 4	Nr1h4	U18374	Forward	GCAGAGAGATGGGAATGTTGG	153	56
			Reverse	GCTTGGTCGTGGAGGTCA
Karyopherin	Kpna2	NM_053483	Forward	TGTGGTGGATGGAGGTGCTA	257	57
			Reverse	CGGGATTCTTGTTCCGACAG
Bleomycin hydrolase	Blmh	D87336	Forward	AGAAATGCTTCCCTGAATCG	128	54
			Reverse	CTCTCCTTTGGTTGCTCCAC
Arginase 2	Arg2	NM_019168	Forward	CGTCTCCCGTCTCCTCCAC	291	59
			Reverse	ACCACCTCAGCCAGTTCCTG
Sialyltransferase 1	Siat1	M18769	Forward	TGGGAACTGTGGGACATCATT	219	56
			Reverse	GAAGAGGAGCGGGTCGTAGG
Glucose-6-phosphatase catalytic	G6Pc	NM_013098	Forward	GGCTCACTTTCCCCATCAGG	146	59
			Reverse	ATCCAAGTGCGAAACCAAACAG
Glutaminase	Gls	NM_012569	Forward	AACGAGAAAGTGGAGACCGAAA	233	56
			Reverse	GCAGAAACCGCCATTAGCC
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	Pfkfb4	NM_019333	Forward	TGGATGAAGAACAGGACAGG	154	55
			Reverse	CGGCAGAGGTAGATGGAG
Phospholipase A2, group IIA	Pla2g2a	NM_031598	Forward	ACGGTTGCCATTGTGGTGTG	353	59
			Reverse	GGAGAGGTGTTAGAGGATGTCTGGA
Sucrase isomaltase	SI	L25926	Forward	GCCTTACCCTGCCTTTGA	216	55
			Reverse	ATTTCTCTTGCCCACCACTC
Facilitated glucose transporter	GLUT2	NM_012879	Forward	GTCCAGAAAGCCCCAGATACC	279	57
			Reverse	TGCCCCTTAGTCTTTTCAAGCT
Facilitated glucose transporter	GLUT5	NM_031741	Forward	TGCAGAGCAACGATGGAGAAA	220	59
			Reverse	ACAGCAGCGTCAGGGTGAAG
Sodium-glucose cotransporter	SGLT1	NM_013033	Forward	GACTGGGTTTGCTTTCCGAGA	451	59
			Reverse	TGTTGGGTAGGCGATGTTGG
α-Fetoprotein	Afp	NM_012493	Forward	AAATGAGTAGCGATGCGTTGG	219	57
			Reverse	GAAAGTGGAAGGGTGGGACA
Membrane metallo endopeptidase	Mmed	NM_012608	Forward	CACTTGGATGGATGCTGA	192	52
			Reverse	TGCTTGCTTTGGCTGAAT
Hydroxysteroid 11-β dehydrogenase 2	Hsd11b2	NM_017081	Forward	TCAAGGTCAGCATCATCCAG	196	56
			Reverse	GGGCTAAGGTCAGGCAATG
Elongation factor 1α	EF1α	NM_1758378	Forward	CTCCACTTGGTCGTTTTGCTGT	165	59
			Reverse	AGACTGGGGTGGCAGGTGTT
17-β Hydroxysteroid dehydrogenase type 2	Hsd17b2	NM_024391	Forward	TCGGTGTCCTGCTTCTTCCT	258	57
			Reverse	TTTATCTGCTCTGGCTTGGTGA
17-β Hydroxysteroid dehydrogenase type 6	Hsd17b6	U89280	Forward	GGAAAGAACAAACAGGGCAGAA	317	56
			Reverse	CACGATACCAACGCAGAAGG
Steroid sulfatase	Sts	NM_012661	Forward	CTTCACCATCACCCAACAGC	203	57
			Reverse	TCTCCTCCACAGCATCTCCA
Steroid 5-α-reductase 2	Srd5a2	NM_022711	Forward	TACGGGAAACACACAGAGAG	385	54
			Reverse	TGAAAAAGGCGAAAGCGAAG

The symbol of each gene is based on the nomenclature by the Human Gene Organisation Gene Nomenclature Committee. 

Statistical analyses

Data are presented as means ± sem. A one-way ANOVA was first used to determine the difference of relative mRNA abundance and sugar uptakes among groups with different treatments. If there was a significant difference, Fisher’s paired least significant difference test was used to determine the particular effect that caused that difference (StatView, Abacus Concepts; SAS Institute Inc., Cary, NC). Differences were considered significant at P < 0.05.

Results

Effect of age on sugar transporter expression and activity

Fructose perfusion increased GLUT5 expression in the intestine of 20-d-old pups by 8-fold when compared with that in the glucose-perfused intestine of same-age pups (Fig. 2A), and by 20- to 50-fold when compared with those in the intestines of 10-d-old pups. Fructose perfusion had no effect on the GLUT5 mRNA abundance in the intestine of the 10-d-olds pups. Compared with those in GLUT5, age-related increases in SGLT1 expression were very modest (approximately two times, Fig. 2B), and were significant only for glucose-perfused intestine. Larger glucose-induced increases in SGLT1 expression are usually observed in adult intestines (18). Intestinal GLUT2 mRNA abundance was independent of age and sugar perfusion (Fig. 2C).

Figure 2.

The effects of glucose and fructose perfusion on sugar transporters mRNA levels and sugar uptakes in the small intestine of the 10-d- (10G or 10F) and 20-d- (20G or 20F) old pups. The mRNA abundance was measured by real-time PCR using EF1α as a reference gene. Bars are means ± sem (n = 5). mRNA abundance and activities in 10-d-old glucose-perfused pups were designated as 100%, to normalize other groups to this value. Letters indicate significant differences (P < 0.05). Relative mRNA abundance of GLUT5 (A), SGLT1 (B), and GLUT2 (C). Relative uptake rates of fructose (D) and glucose (E). Please note that the ordinate of A differs markedly from B and C. It is clear that only older pups allow fructose to simulate GLUT5 expression and activity (compare with Fig. 2).

The effects of age and perfusion solution on fructose uptake rate paralleled their effects on GLUT5 expression level (Fig. 2D). Fructose perfusion in 20-d-old pups increased fructose uptake by 2.5 times compared with intestines of same-age pups whose intestines were perfused with glucose. In contrast, there was no effect of fructose perfusion on fructose uptake in the intestine of 10-d-old pups, whose fructose uptakes were similar to that in 20-d-old pups perfused with glucose. Glucose uptake rate increased modestly with glucose perfusion in 20-d-old pups (Fig. 2E).

Microarray results

Fructose-responsive genes in 10-d-old pups.

Using glucose-perfused intestines as control, we identified seven genes whose expression changes in the intestine of 10-d-old pups perfused with fructose for 4 h (Table 2). We found five genes that were significantly up-regulated between 1.5 and four times, and two down-regulated approximately 1.6 times with fructose perfusion. The up-regulation of glucose-6-phosphatase (G6Pc) has been confirmed by real-time PCR (2.3-fold; P < 0.05). As has previously been shown in Northern blots (6) and in Fig. 2A, there was no fructose-induced increase in intestinal GLUT5 mRNA abundance as measured by microarray at 10 d of age.

Table 2.

Intestinal genes of 10-d-old pups whose expression changed with fructose perfusion

Access no.	Symbol	Name	Mean fold change	se	Frequency
		Up-regulated genesa
Metabolic activity
L20869	Pap3	Pancreatitis-associated protein 3	3.79	1.42	5
S43715	Reg	Regeneration protein	2.87	1.18	5
NM_013098	G6Pc	Glucose-6-phosphatase, catalytic	2.14	1.17	4
Development
NM_171992	Ccnd1	Cyclin D1	1.54	1.14	4
Unknown
D78359	Srpx	Sushi-repeat-containing protein	1.54	1.20	3
		Down-regulated genesa
Metabolic activity
RNU42627	rVH6	Dual-specificity protein tyrosine phosphatase	−1.62	1.14	3
Development
K01231		α -Fetoprotein 3′ end	−1.69	1.29	3
NM_012493	Afp	α -Fetoprotein	−1.58	1.38	4

Values are mean ± se for each gene (n = 5). Negative values indicate the fold decrease in the expression of a gene in fructose compared with glucose-perfused intestine. 

^aGenes listed were up-regulated and down-regulated by more than 1.5-fold in at least three of five samples and whose the fold change is significantly different from a fold change of 1.0 (no change) (P < 0.05). 

Microarray analysis of age-related genes responding to both glucose and fructose.

In the second experiment, we compared the expression of intestinal genes from 20 d with those from 10-d-old pups perfused with either fructose or glucose. A total of 306 genes, representing 3.6% of all genes analyzed, was identified as differentially expressed with age. Among these genes, 140 (28 + 71 + 41) were up- and 166 down-regulated (Fig. 3). The complete list of genes was divided into three groups: those whose expression changed with age only under fructose perfusion (Tables 3 and 4); those whose expression changed only with age under glucose perfusion (supplemental Tables 1A and 2A, published as supplemental data on The Endocrine Society’s Journals Online web site at http://endo.endojournals.org); and those whose expression changed with age under both fructose and glucose perfusion (Tables 5 and 6, and supplemental Tables 3A and 4A). DAVID and EASE bioinformatics resources were used to find the functional annotations [gene ontology (GO)], and the biological process of the differentially expressed genes (http://david.niaid.nih.gov/david/ease.htm).

Table 3.

Microarray results of intestinal genes up-regulated, under fructose perfusion only, in 20 d relative to those in 10-d-old pups

Access no.	Symbol	Name	Mean fold change 20 vs. 10F	se	Frequency
Metabolic activity
U33500	Rdh2	Retinol dehydrogenase type 2	5.10	2.06	5
NM_012608	Mmed	Membrane metallo endopeptidase	3.12	1.57	5
NM_019168	Arg2	Arginase 2	3.05	1.32	5
NM_012600	Me1	Malic enzyme 1	2.07	0.28	5
NM_012569	Gls	Glutaminase	1.98	0.24	5
NM_017156	Cyp2b15	Cytochrome P450, 2b15	1.81	0.57	4
NM_017085	Cyp19	Cytochrome P450, subfamily 19	1.80	0.51	4
AF121345	Phyh	Phytanoyl-CoA hydroxylase (Refsum disease)	1.78	0.20	4
U03629	Gda	Guanine deaminase	1.66	0.17	5
Transcription regulation/transcription factor
NM_017115	Myog	Myogenin	2.31	0.16	4
AB026288	Cebpd	CCAAT/enhancer binding, protein (C/EBP) δ	1.61	0.10	5
Signal transduction activity
M92920	Phkb	Phosphorylase kinase, β	5.61	2.26	5
AJ130946	Kpna2	Karyopherin (importin) α-2	2.33	0.80	5
U32434	Rgs3	Regulator of G protein signaling 3	1.84	0.52	5
Receptor activity
AF177685	Pcdha11	Protocadherin α 11	2.31	0.88	4
NM_019295	Cd5	CD5 antigen	2.18	0.71	4
AF016184	LOC286985	Putative pheromone receptor (Go-VN7)	1.61	0.35	4
AF016178	LOC286915	Putative pheromone receptor (Go-VN1)	1.60	0.23	4
Hormone metabolism
X91234	Hsd17b2	17-β Hydroxysteroid dehydrogenase type 2	2.03	0.63	5
U89280	Hsd17b6	17-β Hydroxysteroid dehydrogenase type 6	1.77	0.71	4
NM_017092	Tyro3	TYRO3 protein tyrosine kinase 3	1.67	0.51	5
Unclassified
M83209	Psp	Parotid secretory protein	4.47	2.98	5
X60661		Potential ligand-binding protein, RYD5	2.81	1.03	4
S82649	Narp	Neuronal activity regulated pentraxin	2.65	0.74	4
AF078778		Microtubule-associated protein 1B, noncoding exon 3U	2.56	0.47	5
AF168362	Pass1	Protein associating with small stress protein PASS1	1.85	0.73	5
AJ005161		Mitochondrial translational elongation factor	1.82	0.41	4
M93401	Mmsdh	Methylmalonate semialdehyde dehydrogenase gene	1.64	0.14	4

Up-regulated genes must have changed by more than 1.5-fold in at least four of five samples, and the fold change must be significant (P < 0.05). Values are means ± se for each gene (n = 5). Values indicate the fold increase in the expression of a gene in 20-d-old fructose-perfused compared with 10-d-old fructose-perfused intestine. 

Table 4.

Microarray results of intestinal genes down-regulated, under fructose perfusion only, in 20 d relative to those in 10-d-old pups

Access no.	Symbol	Name and function	Mean fold change 20 vs. 10F	se	Frequency
Metabolism activity
M18769	Siat1	Sialyltransferase 1	−4.00	1.92	5
U13617	Z49858	Plasmolipin	−3.13	0.59	5
NM_012682	Ucp1	Uncoupling protein 1	−1.82	0.79	4
NM_19333	Pfkfb4	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	−1.64	0.40	4
NM_017006	G6pdx	Glucose-6-phosphate dehydrogenase	−1.56	0.24	4
Transcription regulation activity/transcription factor
NM_012639	Raf1	Murine leukemia viral (v-raf-1) oncogene homolog 1 (3611-MSV)	−1.92	0.18	5
U56241	Mafb	v-maf musculoaponeurotic fibrosarcoma oncogene family, protein B (avian)	−1.61	0.60	4
AF286534	Rab11b	RAB11B, member RAS oncogene family	−1.61	0.23	4
Signal transduction activity
D87336	Blmh	Bleomycin hydrolase	−5.00	4.75	5
U73184	Sdc3	Syndecan 3	−2.44	0.59	5
NM_012649	Sdc4	Syndecan 4	−1.69	0.26	4
Development/proliferation/differentiation
U69279	Efna5	eph-related receptor tyrosine kinase ligand 7	−3.85	1.63	5
U61261	Lama3	Laminin 5 α 3	−1.96	0.77	4
X81448	Krt1–18	Keratin complex 1, acidic, gene 18	−1.85	0.51	4
AF017637	Cpz	Carboxypeptidase Z	−1.75	0.71	4
X77934	Aplp2	Amyloid β (A4) precursor-like protein 2	−1.72	0.15	5
Transport
NM_019229	Slc12a4	Solute carrier family 12, member 4	−1.96	0.81	4
Immune activity
AJ271303	Birc1	Baculoviral IAP repeat-containing 1	−1.85	0.65	5
AJ006070	Rag1	Recombination activation protein 1	−1.59	0.18	4
Unclassified
L01122	Ftl1	Ferritin light chain 1	−1.75	0.09	5
NM_017188	Uncl19	UNC-119 homolog (C. elegans)	−1.75	0.25	5
S74323		Clone E5103, estrogen-induced gene	−1.75	0.28	4

Down-regulated genes must have changed by more than 1.5-fold in at least four of five samples, and the fold change must be significantly different (P < 0.05). Values are mean ± se for each gene (n = 5). Negative values indicate the fold decrease in the expression of a gene in 20-d-old compared with 10-d-old fructose-perfused intestine. 

Table 5.

Microarray results of intestinal genes differentially regulated under glucose or fructose perfusion between 20- and 10-d-old pups

Access no.	Symbol	Name and function	20F vs. 10F			20G vs. 10G
			Mean fold change	se	Freq	Mean fold change	se	Freq
Up-regulated genes
Metabolism
NM_013061	Si	Sucrase isomaltase	19.89	5.98	5	29.40	10.85	5
NM_017013	Gsta2	Glutathione-S-transferase, α type2	7.45	4.67	5	10.12	6.86	5
M25148	Pla2g2a	Phospholipase A2, group IIA	6.38	6.14	5	5.08	2.26	5
D10354	Gpt	Glutamic-pyruvate transaminase (alanine amino-transferase)	4.99	1.72	5	5.33	1.37	5
L81170	Cyp2j4	CYP2J4	4.52	2.97	5	7.64	4.43	5
AF111160	Gsta1	Glutathione S-transferase, α-1	3.92	1.50	4	6.22	3.54	5
Nucleotide/DNA metabolism
NM_013097	Dnase1	Deoxyribonuclease I	11.04	2.44	5	10.30	3.84	5
U90888	Ampd3	Adenosine monophosphate deaminase 3	4.33	1.97	5	6.15	3.43	5
Signal transduction activity
AB002801	Cnga3	Cyclic nucleotide gated channel α 3	7.10	3.24	5	2.90	1.31	5
U44750	Hpgd	NAD-dependent 15-hydroxyprostaglandin dehydro-genase	5.95	3.51	5	5.83	1.83	5
Development/proliferation/differentiation
AF205717	LRTM4	Tetraspan protein	3.90	1.59	5	7.57	2.88	5
NM_017037	Pmp22	Peripheral myelin protein 22	2.17	0.89	5	6.27	2.85	5
Transport
D13871	Slc2a5	Fructose transporter	7.12	6.20	4	2.70	0.93	4
AF058714	SDCT1	Sodium-dicarboxylate cotransporter	2.38	1.29	4	5.36	2.93	5
Immunity/inflammation
U16683		Defensin RatNP-3 precursor	3.91	4.22	5	10.50	6.36	5
Unknown
AF296690		Rattus norvegicus unknown mRNA	5.61	2.13	5	4.91	2.42	5
Z30584	Zg-16p	ZG-16p protein	5.35	3.37	5	5.27	1.12	5
Down-regulated genes
Metabolism
D00680	Gpx3	Glutathione peroxidase 3	−14.29	2.36	5	−16.67	4.59	5
AF154349	Prsc1	Protease, cysteine, 1 (legumain)	−10.00	3.21	5	−10.00	3.78	5
J02773	Fabp3	Fatty acid binding protein 3	−5.88	2.25	5	−6.25	3.25	4
AB048711	Dpp7	Dipeptidylpeptidase 7	−5.00	2.03	5	−7.69	3.01	5
NM_012562	Fuca	Fucosidase, α-l-1, tissue	−4.76	1.89	5	−16.67	5.30	5
NM_013156	Ctsl	Cathepsin L	−4.17	1.90	5	−16.67	4.78	5
NM_012939	Ctsh	Cathepsin H	−3.57	2.01	4	−5.56	2.12	5
J00705	Apoe	Apolipoprotein E	−3.03	1.20	5	−5.56	3.01	4
M33648	Hmgcs2	3-hydroxy-3-methylglutaryl-coenzyme A synthase 2	−2.78	0.98	4	−5.88	3.20	4
NM_012558	Fbp1	Fructose-1,6- biphosphatase 1	−2.70	0.68	5	−5.26	2.31	5
Signal transduction
D10233	Renbp	Renin-binding protein	−6.25	1.96	5	−7.14	2.31	5
U24489	Tnxa	Tenascin XA	−5.26	2.11	5	−11.11	3.21	5
AB016536	Hnrpab	Heterogeneous nuclear ribonucleoprotein A/B	−3.45	1.20	5	−9.09	3.54	4
Development/proliferation/differentiation
NM_012493	Afp	α -Fetoprotein	−9.09	2.01	5	−25.00	6.54	5
AF045657	Dab2	Disabled homolog 2, mitogen-responsive phosphoprotein	−4.55	1.98	5	−7.69	2.02	5
Transport
L37380	LOC252882	Apical early endosomal glycoprotein	−8.33	2.15	5	−16.67	3.58	5
AF219904	Folr1	Folate receptor 1 (adult)	−6.25	2.23	5	−11.11	2.89	5
AB003400	Dao1	d-amino acid oxidase	−4.55	1.45	5	−7.69	3.78	5

Genes up- and down-regulated that changed by more than 5-fold in four of five samples in at least one sugar perfusion condition (fructose or glucose perfusion) and whose the fold change is significant (P < 0.05). Values are means ± se for each gene (n = 5 experiments). Values in the ″20F vs. 10F″ column indicate the fold change in the expression of a gene in 20-d-old compared with 10-d-old fructose-perfused intestine. Values in the ″20G vs. 10G″ column indicate the fold change in the expression of a gene in 20-d-old compared with the 10-d-old glucose-perfused intestine. Freq, Frequency. 

Table 6.

Real-time PCR confirmation of microarray results for selected genes significantly up- or down-regulated between 20- and 10-d-old pups

Accession no.	Symbol	Name and function	Mean fold change 20F vs. 10F		Mean fold change 20G vs. 10G
			Real-time PCR	Microarray	Real-time PCR	Microarray
Transcription regulation/transcription factor
AB026288	Cebpd	CCAAT/enhancer binding, protein (C/EBP) δ	1.1	1.6a	−1.1	NS
Z36277	Nucb	Nucleobinding	1.3	−1.8a	1.1	−2.0a
NM_012639	Raf1	Murine leukemia viral (v-raf-1) oncogene homolog 1 (3611-MSV)	2.0	−2.0a	−1.2	NS
NM_017115	Myog	Myogenin	−1.6	2.3a	−1.3	NS
U18374	Nr1h4	Nuclear receptor subfamily 1, group H, member 4	−3.1b	−2.3a	−2.6	−2.6a
Signal transduction activity
AB002801	Cnga3	Cyclic nucleotide gated channel α 3	1.1	7.1a	−1.3	2.9a
D87336	Blmh	Bleomycin hydrolase	1.1	−5.0a	−1.6	NS
AJ130946	Kpna2	Karyopherin (importin) α-2	3.1b	2.3a	1.8	NS
Carbohydrate metabolism
NM_019333	Pfkfb4	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	1.4	−1.9a	1.3	−2.3a
NM_013098	G6Pc	Glucose-6-phosphatase, catalytic	−2.0b,c	−2.2a	−12.5b	−4.7a
M18769	Siat1	Siat1	−7.1b	−4.0a	−4.1	NS
Glucocorticoid-sensitive or involved in glucocorticoids metabolism
NM_013061	Si	Sucrase isomaltase	159.9b	19.9a	166.6b	29.4a
NM_019168	Arg2	Arginase 2	45.0b	3.0a	50.0b	NS
NM_012608	Mmed	Membrane metallo endopeptidase	17.9b,c	3.1a	9.5b	NS
M25148	Pla2g2a	Phospholipase A2, group IIA	7.8b,c	6.1a	3.5b	5.1a
NM_017081	Hsd11b2	Hydroxysteroid 11-β dehydrogenase 2	3.1b	2.2a	2.6	3.8a
NM_012569	Gls	Glutaminase	1.4	1.9a	3.0b	NS
NM_012493	Afp	α -Fetoprotein	−1.1.108b	−9.1a	−1.4.108b	−25.0a
X14834	IGF2	Insulin-like growth factor-II	−125b	−2a	−125.0b	−2.0a
Steroid metabolism
X91234	Hsd17b2	17-β hydroxysteroid dehydrogenase type 2	2.4b	2.0a	1.9	NS
U89280	Hsd17b6	17-β hydroxysteroid dehydrogenase type 6	10.0b	1.6a	7.8b	NS
NM_012661	Sts	Steroid sulfatase	−6.6b	−1.8a	−5.4b	−1.7a
NM_017154	Srd5a2	Steroid 5-α -reductase 2	−66.6b	NS	−83.3b	−2.0a

Columns ″20F vs. 10F″ indicate the fold change in expression of a gene in fructose-perfused intestine of 20-d compared with 10-d-old pups. Columns ″20G vs. 10G″ indicate the fold change in expression of a gene in glucose-perfused intestine of 20-d compared with 10-d-old pups. NS, No significant difference in fold change measured by microarray. 

^aValues, measured by microarray, significantly different from 1.0 (P < 0.05). 

^bValues, measured by real-time PCR, significantly (P < 0.05) different from 1.0, between 20 and 10F, or between 20 and 10G groups. 

^cValues, measured by real-time PCR, significantly different from 1.0, between 20F and 20G groups. 

Genes differentially expressed between 20- and 10-d-old intestines perfused with fructose.

We identified 28 up- and 22 down-regulated genes that changed with age under fructose conditions (Tables 3 and 4, and Fig. 3). Some up- and down-regulated genes belonged to similar categories, primarily metabolism (nine are up-regulated genes and five down-regulated), transcription regulation (two up-regulated genes and three down-regulated), and signal transduction (three up-regulated and three down-regulated). It is quite interesting to note that development/proliferation/differentiation genes were mainly down-regulated with age, whereas receptor activity and hormone metabolism genes were mainly up-regulated with age. Two genes involved in steroid hormone metabolism, 17-β hydroxysteroid dehydrogenase type 2 (Hsd17b2) and 17-β hydroxysteroid dehydrogenase type 6 (Hsd17b6), were also up-regulated. The function of seven genes was not yet known. The fold change for up-regulated genes ranged between 1.6 (putative pheromone receptor) and 5.1 [retinol dehydrogenase type 2 (Rdh2)], whereas down-regulated genes exhibited fold changes between −5 [bleomycin hydrolase (Blmh)] and −1.56 [glucose-6-phosphate dehydrogenase (G6pdx)].

Genes differentially expressed between 20 and 10-d-old intestines perfused with glucose.

A total of 41 up-regulated and 46 down-regulated genes has been identified in the intestine of 20-d-old pups perfused only with glucose, relative to those in the 10-d-old pups (supplemental Tables 1A and 2A). The majority of the up-regulated genes belonged to three categories: metabolism (14 genes), cell-to-cell communication (14), and transport (7). The main categories of down-regulated genes were metabolism (10 genes), signal transduction (10), proliferation and development (15), and transport (5). Moreover, two genes down-regulated by age and glucose were involved in steroid hormone metabolism: Steroid 5-α-reductase 2 (Srd5a2) and 3β-hydroxysteroid dehydrogenase 1 (Hsd3b1). It is interesting to note that expression of glucose-sensitive genes, like that of fructose-sensitive genes, involved in proliferation and development was being markedly down-regulated as the rat was nearing completion of weaning.

Gene differentially expressed in 20- and 10-d-old intestines perfused with either fructose or glucose.

Relative to 10-d-old pups, we identified 71 genes up-regulated and 98 down-regulated in the intestine of 20-d-old pups perfused with either fructose or glucose. Therefore, these genes change in expression with age under either perfusion condition. In Tables 5 and 6 we show only the genes with more than 4-fold changes, the rest is presented in supplemental Tables 3A (for up-regulated) and 4A (down-regulated). The majority of these highly age-sensitive genes are involved in metabolism, transport, or development and differentiation activities (Fig. 4, A and B). The major difference between up- and down-regulated genes is that 28% of the down-regulated genes are involved in transduction activities, but only 6% in the up-regulated genes. Among the genes involved in carbohydrate metabolism, all of the up-regulated genes are involved in the glycolysis or Krebs cycle (enolase, pyruvate kinase, lactate dehydrogenase, phosphoglycerate kinase 1, and fumarate hydratase 1), whereas some down-regulated genes participate in gluconeogenesis (G6Pc and fructose-1,6- biphosphatase 1) (supplemental Tables 3A and 4A).

Figure 4.

GO of the genes differentially expressed in the intestine of pups after glucose or fructose perfusion. A, GO of the genes up-regulated in 20-d compared with 10-d-old pups, under glucose or fructose perfusion. B, GO of the genes differentially down-regulated between 20-d- and 10-d-old pups, under glucose or fructose perfusion.

Surprisingly, from the microarray results, GLUT5 has been sorted in this category because it was up-regulated modestly with age, even in glucose-perfused intestine (2.7 times; P < 0.05). GLUT5 up-regulation with age, also as measured by microarray, was much greater under fructose perfusion (7.12 times; P < 0.001). However, as measured by real-time PCR, GLUT5 is only significantly up-regulated under fructose perfusion (Fig. 2A).

Genes responsive to age and fructose, and those regulated by glucocorticoids

We reexamined by real-time PCR the expression of approximately 20 genes based on expression changes, GO analysis, and potential involvement in glucocorticoid metabolism or glucocorticoid sensitivity as identified using the Pathway Assist and Genomatix Bibliosphere programs (Table 6). We selected representative genes involved in the regulation of transcription and signal transduction to identify those potentially involved in GLUT5 regulation by age and fructose. The expression level of genes involved in carbohydrate metabolism (Table 6) or sugar transport (the results for GLUT5, SGLT1, and GLUT2 are illustrated in Fig. 2, A–C, respectively) were also measured by real-time RT-PCR. Finally, we analyzed eight genes identified as being glucocorticoid sensitive or involved in glucocorticoid/steroid metabolism.

By microarray analysis, the age-related changes in expression of some genes identified as transcription factors were either borderline or not significant, and these findings were in agreement with those obtained by real-time PCR (Table 6). The nuclear receptor for bile acids, nuclear receptor subfamily 1, group H, member 4 (Nr1h4), was confirmed to be down-regulated with age by two to three times under fructose perfusion conditions. The up-regulation as measured by microarray of expression of two genes involved in signal transduction, cyclic nucleotide-gated channel and Blmh, was not confirmed by real-time PCR; PCR also failed to confirm microarray determined up-regulation of cyclic nucleotide-gated channel in previous work (13). However, karyopherin (Kpna2) was confirmed to be up-regulated (P < 0.01) by age and fructose perfusion. Both microarray and real-time PCR analyses also confirmed that β-galactoside α 2,6-sialyltransferase 1 (Siat1), a member of the glycosyltransferase family of enzymes, is uniquely up-regulated with age only under fructose perfusion conditions.

All the genes affected by age and identified to be glucocorticoid sensitive by microarray were generally confirmed by real-time PCR. For example, membrane metallo endopeptidase (Mmed) and Pla2g2 were significantly up-regulated by age, and markedly so when the intestine was perfused with fructose. Hsd1b6 was up-regulated, and Sts as well as Srd5a2 were down-regulated by age under both glucose and fructose perfusion. By real-time PCR, Hsd11b2 and Hsd17b2, genes involved in steroid metabolism, appear to be specifically up-regulated by age only under fructose perfusion conditions, confirming microarray results. Glutaminase (Gls) up-regulation was borderline; it was up-regulated by microarray with age under fructose perfusion, but real-time failed to confirm this finding. Instead, real-time PCR found Gls to increase in the intestine of rats perfused with glucose.

A significant number of genes that was specifically responsive to both age and fructose was also identified by Pathway Assist to be regulated by glucocorticoids, suggesting that glucocorticoids may play an important role not only in the development of GLUT5, but also of these genes. Ten of these genes [Mmed, arginase 2 (Arg2), malic enzyme 1 (Me1), Gls, cytochrome P450 2b15 (Cyp2b15), cytochrome P450 subfamily 19 (Cyp19), Myog, Cebp, Hsdd17b2, and Hsd17b6] were up-regulated, and six were down-regulated [Siat1, uncoupling protein 1 (Ucp1), G6pdx, Raf1, syndecan 3 (Sdc3), and syndecan 4 (Sdc4)] by age and fructose perfusion. Because of this interesting link, we reevaluated the role of corticosteroids in intestinal GLUT5 development. We also determined the expression of several genes identified by microarray and Pathway Assist as either being glucocorticoid sensitive or involved in glucorticoid metabolism.

Dex effect parallels the effect of age on GLUT5 development.

Incredibly, dex at doses far below that used for humans allows fructose to enhance GLUT5 expression in 10-d-old pups (compare Fig. 5A with Fig. 2A) at magnitudes similar to those elicited by fructose perfusion of intestines in 20-d-old pups. Without dex, there is no increase in GLUT5 mRNA abundance in the intestine of fructose compared with glucose-perfused pups. In contrast, dex induces a dramatic 35-fold increase in GLUT5 mRNA abundance in fructose-perfused pups and a modest increase of 7-fold (P < 0.01) in glucose-perfused pups. SGLT1 and GLUT2 mRNA abundance each did not vary with dex treatment (P > 0.50) and sugar perfusion (P > 0.10) (Fig. 5, B and C).

Figure 5.

The effects of glucose and fructose perfusion on sugar transporter mRNA levels and sugar uptakes in the small intestine of the 10-d-old pups injected with dex (GD or FD) or salt solution (GS or FS). The mRNA abundance was measured by real-time PCR using EF1α as a reference gene. Bars are means ± sem (n = 5). mRNA abundance and activities in 10-d-old glucose perfused without dex pups (GS) were designated as 100%, to normalize other groups to this value. Letters indicate significant differences (P < 0.05). Relative mRNA abundance of GLUT5 (A), SGLT1 (B), and GLUT2 (C). Relative uptake rates of fructose (D) and glucose (E). Please note that the ordinate of A differs markedly from B and C. It is clear that dex allows fructose to simulate GLUT5 expression and activity, and that its effects mimic that of age (compare with Fig. 2).

Like the effect of age, dex also allowed luminal fructose to stimulate fructose uptake. There was an increase of 2.7-fold in fructose uptake in dex-treated, fructose-perfused pups (compare Fig. 5D with Fig. 2D). Intestinal glucose uptake increased by 1.6 times (statistically borderline; P = 0.05) in pups perfused with glucose and injected with dex, but there was no effect of dex on glucose uptake in the fructose-perfused pups (Fig. 5E). Proline uptake was independent of dex treatment (P = 0.82) and perfusion solution (P = 0.42) (data not shown), suggesting that dex affects sugar transporters and substantially affects GLUT5 more than SGLT1.

Other genes whose expression are sensitive to both age and dex.

The expression of sucrase isomaltase (Si) increased by 20–30 times with age (Table 5) and was precociously induced by dex 100–300 times. The magnitudes of age and dex effects for Si were similar in both glucose- and fructose-perfused intestines (Fig. 6A). In contrast, the magnitude of age-related increase in mRNA abundance for Arg2 and Mmed expression was greater under fructose perfusion (Table 3). The magnitude of dex-related increase in Arg2 and Mmed mRNA expression was also greater in fructose-perfused intestines (Fig. 6, B and C). Fructose magnified the effect of dex, such that Arg2 expression increased from 15 times in glucose perfused to 45 times in fructose perfused, and Mmed from three times to 10 times. Genes down-regulated with age, like α-fetoprotein (Afp) and Hsd11b2 (Table 5), were interestingly not significantly affected by dex (Fig. 6, D and E), although the mRNA abundance of Afp tended to decrease by more than three times with dex and fructose perfusion.

Figure 6.

The effects of glucose and fructose perfusion in combination with dex on mRNA levels of five highly fructose-responsive genes in the small intestine of 10-d-old pups. The mRNA abundance has been measured by real-time PCR using EF1α as a reference gene. Bars are means ± sem (n = 5). The mRNA abundance in 10-d-old glucose-perfused pups was designated as 100%, to normalize other groups to this value. Letters indicate significant differences (P < 0.05). Relative mRNA abundance of Si (A), Arg2 (B), Mmed (C), Afp (D), and Hsd11b2 (E). Arg2 and Mmed expression are regulated by dex in a similar manner as GLUT5 (compare with Fig. 5A).

Discussion

GLUT5 is a highly interesting model of developing transporter systems in the small intestine because it has sharply defined stages that are characterized by differences in the ability of its substrate to regulate GLUT5 transcription. In this study we answer two related questions “Since GLUT5 is regulatable by fructose when pups are weaning but not when pups are suckling, what are the fructose-responsive genes in the suckling stage and are they different from those in the weaning stage?” Although only a few genes were found fructose sensitive at 10 d old, we identified a large number of genes that, like GLUT5, was fructose sensitive at 20 d of age (13). Second, “What intestinal genes change in expression from suckling to weaning stage?” Here, we identified an enormous number of genes that changes with age but were able to segregate a few genes that change in expression only under conditions when the enterocytes were exposed to fructose. A significant number of these age-responsive and fructose-sensitive genes turned out to be subject to glucocorticoid regulation, and we did find that glucocorticoids can prematurely induce GLUT5 expression and fructose uptake in the 10-d-old pups perfused with fructose. Siat1 and Kpna2, two regulatory genes that specifically become more fructose sensitive with age, could play a major role in regulating GLUT5 during the suckling period.

Fructose-sensitive genes in intestine of 10-d-old rats

Among the fructose-sensitive genes identified by Cui et al. (8) in 20-d-old rat intestine, only cyclin D1 and G6Pc are also regulated by fructose at 10 d old. Interestingly, G6Pc was the only gene up-regulated by fructose after 20-min perfusion in the intestine of 20-d-old pups. The fold increase of G6Pc measured at 10 d old after 4-h fructose perfusion (2.1 times) is similar to the one measured in 20 d old after either 20-min or 4-h fructose perfusion (1.9 times), and much less than that measured at 20 d after 4-h fructose perfusion (10.5 times) (8). The rapid response after just 20-min intestinal exposure to fructose, the magnitude of the response after 4-h perfusion, and the universal response to fructose across various developmental stages indicate that G6Pc has a much higher fructose sensitivity compared with the other genes, including GLUT5. G6Pc is a major regulatory enzyme in the gluconeogenic pathway and may be involved in converting excess fructose to glucose in neonatal enterocytes. Intestinal gluconeogenesis (19) remains a highly controversial issue, with most studies suggesting it does not occur in adults (20,21) but may occur in neonates (22).

Down-regulated genes may also be important. G6pdx catalyzes the conversion of glucose-6-phosphate to 6-phosphogluconolactone, and in doing so, generates reduced nicotinamide adenine dinucleotide phosphate (NADPH) from nicotinamide adenine dinucleotide phosphate positive (NADP+). The 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 4 (Pfkfb4) is responsible for maintaining the cellular levels of fructose-2,6-bisphosphate, which is a key regulator of glycolysis. Therefore, G6pdx and Pfkfb4 are key enzymes regulating intracellular sugar metabolism and contributing to the energy level in the cells. The role of these enzymes and the many others that are regulated differently by fructose and/or glucose would indeed be interesting studies to pursue because of their potential importance to GLUT5 regulation.

Specificity of GLUT5 induction by age and dex

The increasing sensitivity of GLUT5 to fructose with age appears very specific because only GLUT5 and not SGLT1 or GLUT2 gene expression is up-regulated (∼50 times) by fructose. Moreover, glucose perfusion does not affect GLUT5 at any age. GLUT2 expression is unchanged between the 10 and 20-d-old rat intestine perfused with either glucose or fructose. Similarly, SGLT1 expression is not affected by age and fructose perfusion. GLUT1 and GLUT8 are age sensitive but not fructose sensitive (supplemental Table 4A). Luminal fructose also increases only fructose uptake at 20 d of age; luminal glucose does not regulate fructose uptake at 10 and 20 d of age. Because glucose uptake is not regulated by fructose, it indicates that the brush border GLUT SGLT1 is not regulated by fructose. Therefore, developmental regulation of GLUT5 is markedly different from SGLT1 and other GLUTs.

Likewise, the role of dex in the fructose-induced increase in GLUT5 expression in 10-d-old pups is also highly specific because SGLT1 and GLUT2 expression is not or only modestly affected by dex, independent of the type of sugar perfused. Dex also allows fructose to only increase fructose and not glucose or proline uptakes (17). Moreover, dex does not allow glucose to increase fructose uptake. Therefore, regulation by glucocorticoids of GLUT5 is specific and markedly different from SGLT1 and other GLUTs.

The role of glucocorticoids in regulating GLUT5 expression during development

Glucocorticoids could be one of the key factors that modulate the ontogenic appearance of GLUT5 in the gut and allow its induction by fructose at 20 but not at 10 d of age. Plasma corticosterone concentration increases dramatically after 14 d of age (23) and may trigger gut maturation. In fact, before weaning in mink and other animals, cortisol generally increased hydrolytic and absorptive capacities of the entire small intestine (24). Therefore, it is important to distinguish the effect of age from the effect of corticosterone during the weaning stage. When gene expression in the small intestine of dex-treated and untreated mice was compared, genes in the development category emerged as being likely candidates for mediation of glucocorticoid-induced maturation of intestinal function (25). Glucocorticoids can modify age-induced changes in meprin β, Gls, and Arg2 expression in neonatal rats (26,27) and pigs (28), but it is not clear whether their effect is independent of age. In this study dex allowed fructose to enhance GLUT5 expression in 10-d-old pups at magnitudes (∼20–30 times) similar to those allowed by age in 20-d-old pups, suggesting that dex might mimic the specific effect of age on GLUT5 development.

A previous study by us attempted to distinguish glucocorticoid from age effects by using adrenalectomized rats (29). We showed that in 20-d-old rats adrenalectomized at 10 d old before the endogenous corticosterone surge and exhibiting low corticosterone levels in the plasma, GLUT5 expression and activity were still inducible by fructose. This suggested that fructose used glucocorticoid-independent mechanisms to induce GLUT5 at 20 d of age. However, to avoid salt and water wasting, these adrenalectomized pups received a daily injection of aldosterone. In vivo, mineralocorticoids (aldosterone) and glucocorticoids (corticosterone in rodent) can act in a complementary manner and bind to either the glucocorticoid (GR) or mineralocorticoid (MR) receptors (30). In the study by Monteiro and Ferraris (29), aldosterone may have bound to the MR and/or GR and compensated for the absence of corticosterone, therefore allowing gut maturation and subsequent GLUT5 induction by fructose. Therefore, renewed efforts must be done using adrenalectomized pups to distinguish age from corticosterone effects.

Dex, like corticosterone, is able to bind MR, GR, or the pregnane xenobiotic receptor (31), each of which is expressed in the small intestine of neonatal rats (our unpublished observations). Interestingly, among the age- and fructose-sensitive genes also up-regulated by dex, Arg2 is transcriptionally regulated by glucocorticoids through the intestinal GR (32), whereas CYP3A family members are regulated by pregnane xenobiotic receptor, also in the intestine (33). Moreover, Hsd11b2, which in vivo ensures the selective access of the aldosterone to the MR, is up-regulated by fructose and age. [Because corticosterone and aldosterone bind with equal affinity to MR, the catabolism of corticosterone into inactive 11-dehydro-corticosterone by Hsd11b2 enhances the binding of aldosterone to the MR (30)]. We also identified six potential GR response elements in the GLUT5 promoter regions 0- to 1250-bp upstream from the transcription start site (−128/−119, −306/−297, −551/−542, −1041/−1032, −1238/−1229, and −1246/−1232) using the ElDorado system (www.genomatix.de), suggesting that dex could have a direct nuclear action. However, more studies need to be done to characterize the specific nuclear receptor(s) and response element(s) modulating the effect of dex on GLUT5.

GLUT5 transports a nonessential nutrient that normally appears in the gut lumen only when rats and other omnivorous mammals are weaned, therefore, GLUT5 may require tighter regulation (presence of substrate fructose plus either age or corticosterone) to prevent premature synthesis. More vital transporter genes like SGLT1 and the proline transporter SIT1 are already significantly expressed.

Are Kpna2 and Siat1 involved in GLUT5 development

The failure of fructose to stimulate GLUT5 in intestines of 10-d-old rats could be the result of either inhibitory factors in 10-d-old pups preventing precocious GLUT5 stimulation by fructose, or stimulatory factors appearing only at 20 d of age, and allowing GLUT5 transcription. Two genes, each confirmed by microarray and real-time PCR to be simultaneously fructose responsive and age dependent, may be one of these factors. Kpna2 is overexpressed with age and could be involved in GLUT5 stimulation in 20 d old, whereas Siat1, highly expressed in 10-d-old rat intestines perfused with fructose, could act as an inhibitor of GLUT5 regulation at this age.

Kpna2 is a nuclear import receptor belonging to the importin α-family and implicated in the transport through the nuclear envelope of more than 45 kDa proteins (34). GRs enter the nucleus along with importin proteins. Kpna2 may be linked to GLUT5 regulation because its mRNA is overexpressed in normal testis and malignant breast tumors (35), tissue types characterized by high levels of GLUT5 mRNA or protein (36,37). Moreover, metabolizable sugars induced Kpna2 translocation from the hepatocyte nucleus to the cytoplasm (38,39). This glucose- and fructose-induced movement of Kpna2 is energy dependent but wortmannin insensitive (38). In neonatal rats, fructose-induced GLUT5 expression is also wortmannin insensitive (8). Kpna2 proteins are also known to be tethered to GLUT2 in hepatoma cells, which do not express GLUT5, and may be involved in transmission of the signals that regulate expression of glucose-sensitive genes (39).

Siat1 transfers sialic acid groups to cell-surface glycoproteins and glycolipids, thereby affecting their function (40). The progressive loss of sialic acids in brush-border membrane glycoproteins is one of the major changes occurring in the rat (Table 6) and mouse (41) small intestine during the transition from suckling to weaning. Reduced sialylation with intestinal maturation is the result of a lower expression of Siat1 in weaning rats. Precocious reduction of Siat1 levels could be induced earlier by glucocorticoids (41,42). Interestingly, sialylation could also affect nuclear proteins, and play a role in signal transduction and in repression or activation of gene expression (43). In fact, inhibiting glycosylation of the transcription factor SP1 decreases the expression of membrane transport proteins. Therefore, one of the hypotheses to explain the regulation of GLUT5 during development could be that the decrease in Siat1 expression with age leads to a loss of sialic acids on the nuclear factor(s) involved in GLUT5 transcription.

Caveats, relevance, and future studies

Although we found remarkable differences in expression of intestinal genes between 10- and 20-d-old pups, and between 10-d-old pups perfused with fructose and glucose, the microarray was based on a 5K chip, and, therefore, the list is incomplete. However, the primary objective of the study was not to compile a complete list of age- or fructose-responsive genes (already there are a large number) but to identify pathways involved in GLUT5 development, which can be accomplished by analyzing interactions among a smaller number of genes. For example, the important role of glucocorticoids was discovered when a significant number of fructose- and age-sensitive genes was identified to also be sensitive to glucocorticoids by computer tools that visualize biological pathways and gene regulation networks. The second concern is that the RNA was sampled from a heterogenous cell population. Cell culture approaches do provide a homogenous cell population but cannot be used to study ontogenetic development. In this in vivo study, only the intestinal epithelial layer consisting of more than 80% enterocytes was exposed to differences in luminal sugar; whereas most other cell types were not. Moreover, only the intestinal mucosa was used in this study, thereby eliminating muscle and connective tissue layers, so differences in expression as we have already shown by in situ hybridization (6) and immunocytochemistry (8) would have occurred from the differences in response by enterocytes. In future work, colocalization of age-, dex- or fructose-responsive genes with GLUT5 will confirm their expression in enterocytes. Finally, intestinal development may involve activation (e.g. phosphorylation) of some proteins (44), and not necessarily changes in mRNA expression, therefore, microarray analysis would be unable to detect those changes. However, genes downstream of these activated proteins may still change in expression and would be detected by microarray.

Although they account for less than 10% of births, preterm infants in the United States account for half of infant hospitalization costs occurring, mainly from respiratory distress and necrotizing enterocolitis (45). Because prenatal corticosteroid treatment stimulates lung surfactant synthesis in the preterm infant, prenatal mothers at risk for premature delivery and/or preterm infants receive corticosteroids (46), which as we have clearly shown in this study, also affect the maturation of the fructose transporter system in the small intestine. Biologically, the intestine’s capability to reprogram indicates developmental plasticity that allows a range of phenotypes to develop from a single genotype (47). Plasticity provides organisms with the ability to change function in response to environmental cues. When the dam is under stress, it may release high levels of glucocorticoids in the milk (48) that subsequently and precociously enable the small intestine of the pup to digest and absorb nutrients obtained from the environment, thereby enhancing its survival in case the dam becomes malnourished or dies.

In conclusion, microarray in this study permitted us to identify a pathway, involving glucocorticoids, that participates in the ontogenetic development of GLUT5. In vivo, the timing of the increases in glucocorticoids and GLUT5 fructose sensitivity suggests that GLUT5 gene expression is glucocorticoid dependent at the early stage of neonatal rats. For the first time, the role played by glucocorticoids in GLUT5 regulation in the small intestine has been clearly demonstrated. The potential interaction of signaling factors such as Kpna2 or Siat1 with the glucocorticoids needs to be explored, as well as determining the nuclear receptor involved in glucocorticoid induction of GLUT5.