Skip to main content
BMC Biotechnology logoLink to BMC Biotechnology
. 2007 Oct 24;7:72. doi: 10.1186/1472-6750-7-72

An integrative expression vector for Actinosynnema pretiosum

Shan Goh 1,4, Andrea Camattari 1, Daniel Ng 1, Ruth Song 1, Kevin Madden 2, Janet Westpheling 3, Victor VT Wong 1,✉
PMCID: PMC2194683  PMID: 17956638

Abstract

Background

The Actinomycete Actinosynnema pretiosum ssp. auranticum has commercial importance due to its production of ansamitocin P-3 (AP-3), a potent antitumor agent. One way to increase AP-3 production would be to constitutively express selected genes so as to relieve bottlenecks in the biosynthetic pathway; however, an integrative expression vector for A. pretiosum is lacking. The aim of this study was to construct a vector for heterologous gene expression in A. pretiosum.

Results

A series of integrative expression vectors have been made with the following features: the IS117 transposase from Streptomyces coelicolor, the constitutive ermE* promoter from Saccharopolyspora erythraea, different ribosome-binding site (RBS) sequences and xylE as a translational reporter. Positive E. coli clones and A. pretiosum transconjugants were assayed by catechol. pAP42, containing an E. coli consensus RBS, and pAP43, containing an asm19 RBS, gave strong and moderate gene expression, respectively. In addition, an operon construct capable of multi-gene expression was created. Plasmid integration sites in transconjugants were investigated and four different sites were observed. Although the most common integration site was within a putative ORF with sequence similarity to NADH-flavin reductase, AP-3 levels and cell growth of transconjugants were unaffected.

Conclusion

A set of integrative vectors for constitutive gene expression in A. pretiosum has been constructed. Gene translation is easily determined by colorimetric assay on an agar plate. The vectors are suitable for studies relating to AP-3 biosynthesis as they do not affect AP-3 production.

Background

Actinosynnema pretiosum is a commercially important organism due to its ability to produce ansamitocin P-3 (AP-3), a potent anti-tumor agent [1,2]. The cytotoxicity of ansamitocin has prompted its use as a toxic "warhead" in immuno-toxin conjugates [3]. Several of these conjugates are currently in late-phase clinical trials as therapeutic agents against solid tumors [4]. Thus, there is interest in generating strains of A. pretiosum that produce greater concentrations of AP-3 to meet increasing industrial demands, particularly as the yield from wild type A. pretiosum is low (~18 – 83 mg/l) [2,5]. Previously, a random mutagenesis approach [6] has been used to generate strains which produce 5- to 10-fold more AP-3 than the parental strain. Recently, deletion of a putative transcriptional repressor, asm2, has also been reported to increase AP-3 yield [7].

One method to improve the productivity of A. pretiosum would be to alter the regulation of ansamitocin biosynthesis through genetic manipulation of selected genes. The AP-3 biosynthetic genes, identified through comparisons with the Amycolatopsis mediterranei rifamycin biosynthetic gene clusters, and gene expression in Streptomyces lividans [8] and S. coelicolor [9], revealed the lack of a rifH homologue in A. pretiosum [9]. The rifH gene encodes an aminoDAHP synthase in A. mediterranei and is involved in the synthesis of aminoDAHP required for the AP-3 precursor, 3-amino-5-hydroxy-benzoic acid (AHBA). Addition of AHBA has been shown to increase AP-3 production [10]. Although DAHP synthase from the shikimate pathway in A. pretiosum may supply the AHBA pathway [9], it is not dedicated to aminoDAHP synthesis. Based on these reports, we hypothesized that a metabolic bottleneck in the synthesis of aminoDAHP was the limiting factor in AP-3 biosynthesis and sought to relieve this bottleneck through heterologous expression of rifH, thus providing an aminoDAHP synthase for A. pretiosum.

We report the construction of a series of novel expression vectors that allow stable integration of target genes into the A. pretiosum genome. The vectors have components from pSET152 [11], the IS117 transposable element [12] and the ermE* promoter [13], all of which have never previously been used in A. pretiosum. We have shown functionality of the vectors in E. coli, as the cloning host, and in A. pretiosum, as the transconjugant. We also validated plasmid constitutive expression, reporter function and integration preference, which did not alter host cell density or AP-3 levels. Finally, we demonstrate the vector's usefulness in heterologous expression of rifH in A. pretiosum and report its effects on AP-3 production.

Results

Conjugable and integrative pAP expression plasmids in A. pretiosum

IS117 is a well studied transposable element capable of integrating into several Streptomyces species [14,15] and into Mycobacterium smegmatis [16]. Plasmids containing IS117 had previously been derived from the mini-circle version [16,17]. In this study, IS117 was derived from a linearized and amplified copy in the Streptomyces coelicolor A3(2) chromosome and modified at the ends for integration into the chromosome of A. pretiosum (Figure 1). Plasmid containing IS117 with unmodified ends did not result in A. pretiosum transconjugants. By moving the attM (reverse complement) sequence, CTA, and the 15 bases upstream of it from the 3' end (downstream of orf2) to the 5' end (upstream of orf1), chromosomal integration at the attM site was restored. In this regard, consensus sequences of up to 19 nucleotides flanking attM have been identified in the genomes of S. lividans [14] and M. smegmatis [16], suggesting a role in alignment of the integration site. Transconjugants of pAP40 were apramycin resistant and circular plasmids were not detected in a chromosomal DNA preparation (not shown), which was expected, as the plasmid lacked a Streptomyces replicon.

Figure 1.

Figure 1

Construction of A. pretiosum vectors. Maps of plasmids with relevant features and single restriction sites are shown. Site directed mutagenesis of IS117 for a functional attM is indicated in pAP3. pAP41, pAP42 and pAP43 consist of xylE with RBS sequences from S. erythraea, E. coli and A. pretiosum genes, respectively, although only the E. coli RBS sequence is indicated. The aac(3)IV gene encoding apramycin resistance is represented by aprR.

The ermE*p is a strong promoter that has been used in Streptomyces for protein expression [18,19] and modulating secondary metabolites production [20-22], making it useful for this study. Three different RBS sequences were tested for efficiency: the unusual RBS sequence of ermE (pAP41) [13], an E. coli consensus RBS sequence (pAP42) [17], and a putative RBS sequence found upstream of the A. pretiosum gene, asm19 (pAP43) [9] (Figure 1). E. coli clones and transconjugants of pAP41, 42, and 43 were tested for metapyrocatachase activity, encoded by xylE, with catechol. Catechol positive colonies were observed strongly in E. coli clones of pAP42 and mildly in pAP43 clones while pAP41 clones were negative (Figure 2a). A. pretiosum transconjugants of pAP42 turned bright yellow, while transconjugants of pAP43 and pAP41 turned slightly yellow and did not change color, respectively (Figure 2b). This indicated the E. coli RBS sequence was the most robust, and that the ermE* promoter was functional in A. pretiosum. In addition, xylE was a suitable translational reporter in A. pretiosum.

Figure 2.

Figure 2

Catechol assay for xylE expression. (a) E. coli clones expressing xylE with an E. coli consensus RBS (pAP42), ermE RBS (pAP41) and asm19 RBS (pAP43). (b) A. pretiosum transconjugants of the same plasmids responded to catechol as in (a). Also shown are the operon construct (pAP50) and the fusion construct (pAP47).

To apply the reporter gene in an expression system, two versions of a translational reporter vector were constructed. Transconjugants of pAP47 (xylE and rifH fusion) did not result in catechol positive colonies while transconjugants of pAP50 (xylE and rifH operon; Figure 1) were catechol positive and their activities were comparable to transconjugants of pAP42 (Figure 2b).

Constitutive expression of rifH in A. pretiosum

To determine whether the ermE* promoter enabled constitutive expression of rifH in A. pretiosum, a clone of pAP50 was grown in shake-flasks and cells were harvested over 9 days. Quantitation of rifH mRNA was normalized against 16S rRNA and calculated relative to the first harvest point (day 2). The amount of rifH mRNA on day 4, 7 and 9 did not change significantly (p = 0.16, by one-way ANOVA) (Figure 3).

Figure 3.

Figure 3

Constitutive expression of rifH. A clone of pAP50 grown in YMG shake-flasks in triplicate was harvested over 9 days and rifH mRNA abundance relative to day 2 was determined by qRT-PCR.

Integration sites, sequences and stability of pAP40, pAP42 and pAP50 in A. pretiosum

It was important to determine the site of integration of the transconjugants to ensure the integrative vector was not affecting essential genes or genes involved in secondary metabolite production, and subsequently growth or AP-3 production. IS117 transposition integration has not been studied in A. pretiosum. Integration frequency was determined by Southern hybridization of genomic DNA from 12 transconjugants to an IS117 probe (Figure 4). No signal was observed from wild type A. pretiosum (not shown), while a single integration event at a specific site was observed in each transconjugant. Four specific integration sites (A, B, C and D) were found from sampling 12 transconjugants. The most common was A (9 of 12) while B, C and D each occurred once (Figure 4). The sequences of integrated plasmids and chromosomal junctions were determined by plasmid rescue, which allowed the design of site A, B, C and D specific PCR primers (Table 1) and amplification of the chromosomal integration sites. Comparison of the IS117 integration sites in A. pretiosum to those in M. smegmatis revealed consensus sequences for A. pretiosum sites A, C and D and M. smegmatis site A, and A. pretiosum site B and M. smegmatis sites B and C (Figure 5). Sequence analysis revealed that A. pretiosum site A was within an ORF with homology to a putative NADH-flavin reductase of Nocardia farcinica IFM 10152 (gi 54024270, E-value 1e-13, similarity in 70 of 192 aa). Sites B, C and D were in intergenic regions, upstream of a putative integral membrane protein of Thermobifida fusca YX, downstream of a glutamyl-tRNA synthetase of Nocardia farcinica IFM 10152, and upstream of a putative ATP-dependent RNA helicase of N. farcinica IFM 10152, respectively. The pAP plasmids did not cause target site duplication upon integration. PCR amplification of chromosomal and plasmid junctions was used to detect tandem insertions, which would result in amplicons of 272 bp and > 6 kb, or deletions, which would not result in an amplicon. Tandem insertions or deletions were not detected in the transconjugants by Southern hybridization or PCR (not shown).

Figure 4.

Figure 4

Integration sites in A. pretiosum transconjugants of pAP40, pAP42 and pAP50. Total DNA from apramycin resistant transconjugants were digested with ApaI and hybridized to a DIG-labeled IS117 probe. Unintegrated pAP40, pAP42 and pAP50 from E. coli were similarly digested and included as controls. Patterns of hybridized bands of each sample representing an integration site was arbitrarily labeled A, B, C and D. Site A consisted of an unchanged 3.5 kb band from the right arm of the integrated plasmid, and a variable left arm, dependent on the cloned gene of interest. Control plasmids have the same molecular weight as the left arm of its corresponding integrated plasmids because of an ApaI site on the genome, and not because of unintegrated plasmids in the total DNA extract. Transconjugants 1, 2, 3 and 4 of pAP40, pAP42 and pAP50 were subsequently tested for AP3 production.

Table 1.

Primers used in this study.

Primer Sequence (5' – 3')
Vector construction
 IS117-KpnI TGACTGGTACCGGAGTCGGGGATGTTCTTGTTC*
 IS117-NheI TGACTGCTAGCGTACCGGTGCCCCGATAGAC
 ermE-XbaI/KpnI AAAATCTAGAGGTACCAGCCCGACCCGAGCA
 ermE-BamHI/EcoRV AAAAGATATCGGATCCACCAACCGGCACGA
 xylE-F4Bam CGCGGATCCAGCGATGAACAAAGGTGTAATGCGACC
 xylE-FEBam CGCGGATCCAAGCTAACGTAAGGAGGAAAAACATATGAACAAAGGTGTAATGCGACCGGGCCAT
 xylE-FABam CGAGGATCCTCCCCACAGACAGGGAGCCCAGCATATGAACAAAGGTGTAATGCGACCGGGCCAT
 xylE-REcoRI GCGGAATTCTCAGGTCAGCACGGTC
 rifH-FNdeI CGCATACATATGGTGAAGCGGCAGCCGGACTTCG
 rifH-RASE CGCGAATTCACTAGTCCTAGGCTAGCGCAGCATCTTCGCGATCG
 xylE-FSpeI AATACTAGTATGAACAAAGGTGTAATGCGACCGGGCCAT
 xylE-FRBSSpeI CGCAATACTAGTAAGCTAACGTAAGGAGGAAAAACATATGAACAAAGGTGTAATGCGACCGGGCCAT
qPCR
 rifH-668F AGATCTACGTCAGCCACGAAATG
 rifH-788R TCGCCGATCCACAGGAA
 16S-F CAGAAGAAGCACCGGCTAAC
 16S-R TTAAGCCCCAAGTTTTCACG
Southern hybridization
 IS117-F CTGAACTCACCGCGACGTATCG
 IS117-R GCTAGCGTACCGGTGCCCCG
Plasmid rescue and sequencing
 intseq1 CCGTTTGGCCTCCGACTAAC
 intseq2 GCTCTATCGGGAGGCCTCAC
 attM5'1 GGAGCAGACGCTCGTCCGGG
 siteA-F GTCGTGGTCACCAGGCGGAC
 siteA-R ACCGCCTTCGTCCGTGCCAG
 siteB-F GATCTGTGTTCGCGGAGAGC
 siteB-R ACAAGGGCGTCAGCGAGGAA
 siteC-F GGTGTCCTCGATGCGGAAGA
 siteC-R AAGTCCCCGTGCTTCTCCAG
 siteD-F GACCCCCTCCGCGAACTGGT
 siteD-R GGCCTGCGAGGTTTGTGCGC

*Restriction sites are underlined

Figure 5.

Figure 5

Alignment of IS117 integration sites in A. pretiosum and M. smegmatis. Bold letters indicate cross over point and capital letters indicate identical bases in all compared sequences.

Stability of plasmids integrated into sites A, B, C and D of A. pretiosum was determined. After 50 duplications under non-selective conditions, cultures representing each of the integration sites had less than 1% plasmid loss.

AP-3 production of transconjugants

Since the most common site of plasmid integration was within a putative ORF, the effect of integration on AP-3 production was of interest. Mean AP-3 yields from WT in YMG obtained on ten different occasions were 13.3 ± 5.6 mg/l for day 7 and 15.3 ± 5.1 mg/l for day 9. Transconjugants 1 to 4 of pAP40, pAP42 and pAP50 having either site A, B, C or D plasmid integrations were assayed for AP-3 production in YMG. For pAP40 transconjugants, site A mutants did not affect AP-3 yield over 9 days, but the site D mutant had lower AP-3 yields, particularly on day 7 (Figure 6a). All pAP42 and pAP50 transconjugants expressing xylE and rifH, respectively, had similar AP-3 yield to the WT at the end of the fermentation period (Figure 6b &6c). Packed cell volume of transconjugants, representing cell growth, was also measured for each AP-3 assay and found to be equivalent to that of WT (not shown).

Figure 6.

Figure 6

AP-3 production of A. pretiosum transconjugants in YMG in shake flasks. AP-3 concentration was measured over 9 days. (a) Transconjugants 1 (■), 2 (▲), 3 (▼) and 4 (◆) of pAP40 compared to WT (○). (b) Transconjugant 1 (■), 2 (▲), 3 (▼) and 4 (◆) of pAP42 expressing xylE, compared to WT (○). (c) Transconjugant 1 (■), 2 (▲), 3 (▼) and 4 (◆) of pAP50 expressing rifH, compared to WT (○).

Discussion

An important factor in expression vectors is a suitable RBS; failure of pAP41 for xylE expression in E. coli was likely due to host ribosome and RBS incompatibility. The vector with an E. coli consensus RBS sequence (pAP42) resulted in the strongest expression of xylE, while the putative RBS sequence of A. pretiosum asm19 (pAP43) resulted in weaker expression. Hence, while pAP42 is useful for strong constitutive expression of target genes, pAP43 may be used if moderate expression is required. To confirm translation of the gene of interest, two versions of a translational reporter vector were made. The pAP47 rifH-xylE fusion construct (not shown) did not produce a functional metapyrocatachase, perhaps due to steric hindrance of the fused protein or the lack of appropriate translational signals for xylE, while the pAP50 rifH-xylE operon construct with an RBS sequence dedicated to the reporter gene worked well.

For the purposes of this study, it was important that the integrative plasmid did not affect host AP-3 production or bacterial growth. Hence, plasmid integration sites and their effect on AP-3 levels were determined. Plasmid integration into site A was most common, while sites B, C and D occurred once in each set of transconjugants containing either pAP40, pAP42 or pAP50. Since only four transconjugants of each set were screened, it is unlikely these secondary sites are plasmid-dependent. Comparison of A. pretiosum integration sites with those of M. smegmatis and hence S. lividans revealed GC-rich consensus recognition sequences flanking the attM that are broadly categorized into two groups, consisting of either AG or TAG as the cross-over sequence.

Integration of a plasmid into site A may have inactivated a putative ORF region, however unchanged AP-3 levels and packed cell volume in mutants indicate that a preference for site A did not interfere with AP-3 biosynthesis or cell growth. Similarly, integration into secondary sites of B, C and D did not markedly affect AP-3 production after 9 days. Although rifH mutants also had unchanged AP-3 levels, suggesting the presence of aminoDAHP synthase does not have any effect on AP-3 biosynthesis, more work needs to be done to assess the activity of RifH in transconjugants, and to optimize substrates in the growth media, to draw any final conclusions on the effect of RifH modulation on AP-3.

Conclusion

We have constructed a series of useful genetic tools for the industrially valuable bacterium A. pretiosum. Stable maintenance, translational reporter function in E. coli and A. pretiosum, strong and moderate constitutive gene expression and lack of any effect on AP-3 production and bacterial growth are all desirable features of the pAP42/43/50 vectors.

Methods

Bacterial strains, plasmids and growth conditions

Media was prepared from DIFCO stocks and antibiotics were purchased from Sigma, unless otherwise stated. A. pretiosum and E. coli strains used in this study are listed in Table 2. A. pretiosum spore stocks were prepared as previously described [23], and working stocks were either subcultured from spore stocks or a single colony grown on YMG agar (4 g/l yeast extract, 10 g/l malt extract, 4 g/l glucose, 20 g/l agar, pH 7.2) or MYM agar (4 g/l yeast extract, 4 g/l maltose, 10 g/l malt extract, 20 g/l agar) at 26°C for 2–3 days, and inoculated in YMG or VM (5 g/l meat extract, 5/L g peptone, 5 g/l yeast extract, 2.5 g/l enzyme hydrolysate of casein, 20 g/l glucose, 1.5 g/l NaCl) [24]. A. pretiosum mutants containing the integrative vector were grown in media supplemented with apramycin (50 μg/ml). E. coli JM109, XL1 Blue and XL10 Gold transformants were cultured in LB medium at 37°C supplemented with apramycin (50 μg/ml). ET12567/pUZ8002 transformants was maintained in chloramphenicol (25 μg/ml), kanamycin (25 μg/ml) and apramycin (50 μg/ml).

Table 2.

Bacterial strains and plasmids used in this study

Strain or plasmid Relevant characteristic Purpose Reference/Source
Amycolatopsis mediterranei Rifamycin producer Amplification of rifH ATCC
S. coelicolor A(3)2 IS117 transposable elements Amplification of IS117 ATCC
A. pretiosum 31565 AHBA biosynthesis gene cluster Amplification of asm19 RBS, conjugation ATCC
E. coli
 ET12567/pUZ8002 Methylation-deficient host with non-transmissible helper plasmid Conjugation host [25]
Plasmids
 pKS1 aprR, ori Vector backbone This study
 pXE3 xylE Amplification of xylE [25]
 pAP40 ermE*p, IS117, aac(3)IV Assessment of IS117 This study
 pAP41 Derived from pAP40, ermE RBS, xylE Assessment of RBS This study
 pAP42 Derived from pAP40, E. coli RBS, xylE Assessment of RBS This study
 pAP43 Derived from pAP40, putative asm19 RBS, xylE Assessment of RBS This study
 pAP44 Derived from pAP42, E. coli RBS, rifH Construction of translational reporter This study
 pAP47 Derived from pAP44, E. coli RBS, rifH-xylE fusion Assessment of translational reporter This study
 pAP50 Derived from pAP44, E. coli RBS, rifH-xylE operon construct Assessment of translational reporter This study

Construction of pAP plasmids

Construction of the pAP plasmids are summarized in Figure 1. The plasmid pKS1, derived from pSET152 by digestion with SphI and HindIII and treated with Klenow before ligation, consisted of the apramycin resistance gene (aac(3)IV) and oriT but not the ϕC31 integrase and attachment site. IS117 was amplified from an integrated linear copy in the S. coelicolor A3(2) genomic DNA using primers IS117-KpnI and IS117-NheI (Table 1). The IS117 PCR product, consisting of orf1, 2 and 3, was digested with KpnI and NheI and cloned into similar ends in a modified pKS1 with a KpnI site (pKS1m). IS117 was modified to obtain a functional attM firstly by mutation of CTA to CCC downstream of orf2, and secondly by inserting AGCCCCCTGAGATGT upstream of CTA at the 5' end of orf1 by site-directed mutagenesis, resulting in pAP3. The ermE* promoter was amplified from pIJ4090 [23] using primers ermE-XbaI/KpnI and ermE-BamHI/EcoRV (Table 1) digested with XbaI and EcoRV and cloned into pAP3 at similar sites to create pAP40.

The reporter gene xylE with different types of RBS was amplified from pXE3 [25] with forward primers specifying an RBS from either the ermE* promoter [13] (xylE-F4Bam), E. coli genes [17] (xylE-FEBam) or asm19 (gi 21449342) of A. pretiosum.(xylE-FABam), and a reverse primer (xylE-REcoRI). The different xylE PCR products were digested with BamHI and EcoRI and cloned into pAP40 with similar ends to produce pAP41, 42 and 43 having the ermE RBS, E. coli consensus RBS and asm 19 RBS, respectively, upstream of xylE. Clones of pAP41, 42 and 43 were used in catechol assays to determine functionality of RBS.

rifH (gi 41581793) was amplified from the A. mediterranei genome with primers rifH-FNdeI and rifH-RASE. The xylE gene was excised from pAP42 at NdeI and EcoRI to allow cloning of the rifH PCR product, which was digested with the same restriction enzymes. This resulted in plasmid pAP44 containing an E. coli RBS upstream of rifH. Translation of rifH was determined by creating a xylE fusion and an operon construct of rifH and xylE. For the fusion recombinant, xylE was amplified from pXE3 with xylE-FSpeI and xylE-REcoRI. The PCR product was digested with SpeI and EcoRI and cloned into pAP44 with similar ends. The rifH stop codon was then removed to enable translational read through to xylE (pAP47, not shown). For the operon construct, xylE was amplified with a forward primer containing an E. coli RBS (xylE-FRBSSpeI) and xylE-REcoRI. The PCR product was digested with SpeI and EcoRI and cloned into pAP44 with similar ends to result in pAP50. Clones of pAP50 were examined for constitutive expression of rifH by qRT-PCR and AP-3 production in YMG.

Transformation and conjugation

Transformation of E. coli was performed by electroporation using a Gene Pulser (Bio-Rad) as recommended by the manufacturer. Conjugation between ET12567/pUZ8002 and A. pretiosum was as described previously [23]. The integrative vectors were transformed into ET12567/pUZ8002 and selected with apramycin on LB agar plates. Selected transformant colonies were grown in LB medium supplemented with kanamycin (25 μg/ml), chloramphenicol (25 μg/ml) and apramycin (50 μg/ml) at 37°C for 20 hours. A 1/50 dilution of the E. coli was made and grown for 4–5 hours at 37°C to an OD600 of 0.4–0.6. The cells were harvested, washed twice with equal volumes of LB and resuspended in 0.1× original volume. A. pretiosum spores (~108) in 2 × YT were heat-shocked at 50°C for 10 min, then mixed with the E. coli suspension by swirling. The mixture was plated on mannitol soy agar (MS)+10 mM MgCl2 and incubated at 37°C for 16 h. The plates were overlaid with 4 ml nutrient soft agar (0.5% w/v) supplemented with nalidixic acid (120 μg/ml) and apramycin (60 μg/ml), and incubated at 26°C for 5–7 days. Transconjugants were picked and transferred to fresh YMG plates supplemented with apramycin (50 μg/ml) and nalidixic acid (25 μg/ml). Spore stocks were subsequently prepared from the single colonies.

Plasmid stability of transconjugants

A. pretiosum transconjugants of pAP40, pAP42 and pAP50, representing plasmids integrated at sites A, B, C and D were tested for plasmid stability [26]. A single colony from MYM with apramycin (50 μg/ml) was inoculated into VM (80 ml) and grown at 26°C at 180 rpm for three days. An aliquot of the culture was appropriately diluted and plated onto MYM, while the remaining culture was grown in VM at 26°C with shaking. Colonies (200 cfu) from the day three MYM plate were transferred to MYM with apramycin (50 μg/ml) to obtain a ratio of resistant cells to total cells. After propagating the transconjugant culture for approximately 50 duplications in VM, the ratio of apramycin resistant cells to total cells was determined as before, and plasmid loss was also calculated.

Plasmid rescue

To determine the site of vector integration in transconjugants, plasmid rescue was carried out with AscI, which is a non-cutter for the pAP plasmids. Genomic DNA (1 μg) with integrated plasmid was digested with AscI and ligated with T4 DNA ligase (NEB) at 16°C for overnight. The ligation reaction was electroporated with E. coli JM109 cells and transformants were selected on LB agar with apramycin (50 μg/ml). Plasmid DNA was extracted from randomly selected transformants and sequenced with primers intseq1 and attM5'1 for the right hand plasmid-chromosome junction, and intseq2 for the left hand junction (Table 1). Primers specific for the bacterial chromosome to the left and right of each integration site (siteA-F, siteA-R; siteB-F, siteB-R; siteC-F, siteC-R; siteD-F, siteD-R; Table 1) were used to determine sequences flanking the integrated plasmid, as well as the integration site of the wild type genome. Sequence analyses were carried out by BLASTN and BLASTX.

Nucleic acid extractions

Plasmid DNA extractions were carried out using Qiaprep Spin Miniprep kit (Qiagen) according to manufacturer's specifications, while genomic DNA extractions were carried out as previously described [23]. A three day culture of A. pretiosum in 30 ml VM was washed twice in 10.3% (w/v) sucrose, treated with lysozyme (1 mg/ml), proteinase K (560 μg/ml), SDS (1% v/v) and RNase A (100 μg/ml). The lysate was washed three times with equal volumes of phenol: chloroform: isoamyl alcohol (Sigma) and once in an equal volume of chloroform. DNA was precipitated in 2 M NaCl and 0.6 × isopropanol, washed twice in 70% (v/v) ethanol, air-dried and dissolved in 10 mM Tris-Cl (pH 8).

Total RNA extraction of A. pretiosum grown in YMG broth harvested at days 2, 3, 4, 7, 8 and 9 was carried out using the RiboPure™-Bacteria Kit (Ambion), with the following modifications. Cultures (7–10 ml) were pelleted and stored at -80°C until extracted. Cell pellets were resuspended in 0.5 × original volume of DEPC water (0.1%, v/v), freeze-thawed five times in liquid nitrogen and at 55°C, then treated with lysozyme (3.5 mg/ml) at 37°C for 20 min. Cells were pelleted, resuspended in 350 μl of RNAwiz, vortexed with zirconia beads for 15 mins before continuing with the manufacturer's protocol. RNA was treated with DNase I, electrophoresed in a 1% TAE agarose gel and quantified spectrophotometrically.

Quantitative RT-PCR (qRT-PCR) and sequencing

RNA (1 μg) from three biological replicates was converted to cDNA using random hexamers and the iScript cDNA Synthesis kit (Bio-Rad) in a 20 μl reaction. Subsequently, 5 μl of cDNA was used for rifH amplification. For 16S rRNA amplification, cDNA was diluted 106-fold and 5 μl was used for quantitative PCR (qPCR). Amplification was carried out in an ABI Prism 7000 sequence detector where each amplification reaction contained 12.5 μl of iTaq SYBR Green Supermix with Rox (Bio-Rad) and 300 nM each of forward and reverse primers in a 25 μl reaction. RNA from three biological replicates was used and qPCR of each cDNA sample was carried out in triplicate. Primers were designed by Primer Express (Applied Biosystems) and are as follows: rifH-688F and rifH-788R for the target gene rifH and 16S-F and 16S-R for the reference gene 16S rRNA (Table 1). The cycling conditions were 3 min at 95°C, followed by 45 cycles of 15 s at 95°C and 45 s at 58°C. Efficiencies of both primer pairs were found to be similar, hence, data was analyzed by the 2-ΔΔCT method [27]. Sequencing was carried out in an ABI Prism 3100 Genetic Analyzer with Big-Dye chemistry.

Southern hybridization

The frequency and site of vector integration in A. pretiosum transconjugants were determined by Southern hybridization. Genomic DNA (4–6 μg) digested with ApaI was hybridized with DIG-labeled IS117 probe (25 ng/ml) using the DIG-labeling and detection starter kit (Roche) [28]. DIG-labeled probe was derived from 1 μg of IS117 amplified from pAP40 with primers IS117-F and IS117-R (Table 1). Hybridization was carried out at 40°C and stringency washes were performed in 0.1 × SSC at 65°C.

Catechol assay

Catechol assay was carried out as previously described with modifications [25]. Streaks were made from single colonies of the various E. coli transformants onto LB plates or A. pretiosum transconjugants onto YMG plates containing 50 μg/ml apramycin. After one (for E. coli) or two (for A. pretiosum) days, 0.5 M aqueous catechol (Sigma) was sprayed onto the surface of the plates containing the colonies and incubated in the dark at 28°C for 40 min. Positive xylE expression was seen as a yellow halo around bacterial streaks.

Extraction and quantification of AP-3

A single colony of either mutant or wild type A. pretiosum from a working stock plate was subcultured into 10 ml of YMG with or without apramycin, respectively. The culture was incubated for 9 days at 26°C with shaking, and aliquots were removed on days 4, 7 and 9 for AP-3 measurement as follows:1 ml was centrifuged at 3270 × g for 15 min and 400 μl of supernatant was mixed with 7.6 ml of ethyl acetate (Merck) for 1 min by vortexing and centrifuged as above at 4°C, while the cell pellet (packed cell volume) was weighed and noted. The organic phase of the supernatant mixture was transferred to a fresh tube, evaporated in a nitrogen sample concentrator (Techne) and the desiccated material was resuspended in 200 μl of a 60%/40% (v/v) solution of solvent A (0.1% formic acid (Merck) in high purity water) and solvent B (0.1% formic acid in methanol). The sample was eluted at 0.8 ml/min in a Shimadzu chromatographer with a Hypurity C18 column (Thermo) with the following gradient pattern: 45% solvent B for 10 min, 45–70% solvent B for 20 min, 80% solvent B for 5 min and 45% solvent B for 20 min. The concentration of AP-3 in the sample was determined by peak comparison with an AP-3 standard (Calbiochem) of known concentration.

Statistical analysis

Statistical significance was determined by one-way analysis of variance (ANOVA) test performed using Microsoft Excel. A p-value < 0.05 was considered significant.

Competing interests

The author(s) declares that there are no competing interests.

Authors' contributions

SG carried out vector construction and other genetic manipulations, the ANOVA test, participated in study design and drafted the manuscript. AC carried out plasmid rescue, determined plasmid stability and participated in AP-3 assays. DN carried out qRT-PCR, statistical analysis and participated in AP-3 assays. RS carried out Southern hybridization and RNA extraction. KM and JW participated in study design and helped draft the manuscript. VW conceived the study, carried out vector construction and AP-3 assays and helped with study design and drafting of the manuscript. All authors read and approved the final manuscript.

Acknowledgments

Acknowledgements

We thank Corrine Wan for HPLC measurements of AP-3 concentrations. This work was funded by the Agency for Science, Technology and Research (A*STAR), Singapore.

Contributor Information

Shan Goh, Email: Shan.Goh@ki.se.

Andrea Camattari, Email: camattari_andrea@bti.a-star.edu.sg.

Daniel Ng, Email: daniel_ng@bti.a-star.edu.sg.

Ruth Song, Email: ruth_song@bti.a-star.edu.sg.

Kevin Madden, Email: kmadden@microbia.com.

Janet Westpheling, Email: janwest@uga.edu.

Victor VT Wong, Email: victor_wong@bti.a-star.edu.sg.

References

  1. Higashide E, Asai M, Ootsu K, Tanida S, Kozai Y, Hasegawa T, Kishi T, Sugino Y, Yoneda M. Ansamitocin, a group of novel maytansinoid antibiotics with antitumor properties from Nocardia. Nature. 1977;270:721–722. doi: 10.1038/270721a0. [DOI] [PubMed] [Google Scholar]
  2. Tanida S, Hasegawa T, Hatano K, Higashide E, Yoneda M. Ansamitocins, maytansinoid antitumor antibiotics producing organism, fermentation and antimicrobial activities. J Antibiot (Tokyo) 1980;33:192–198. doi: 10.7164/antibiotics.33.192. [DOI] [PubMed] [Google Scholar]
  3. Liu C, Tadayoni BM, Bourret LA, Mattocks KM, Derr SM, Widdison WC, Kedersha NL, Ariniello PD, Goldmacher VS, Lambert JM, Blattler WA, Chari RV. Eradication of large colon tumor xenografts by targeted delivery of maytansinoids. Proc Natl Acad Sci USA. 1996;93:8618–8623. doi: 10.1073/pnas.93.16.8618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cassady JM, Chan KK, Floss HG, Leistner E. Recent development in the maytansinoid antitumor agents. Chem Pharm Bull. 2004;52:1–26. doi: 10.1248/cpb.52.1. [DOI] [PubMed] [Google Scholar]
  5. Tanida S, Izawa M, Hasegawa T. Ansamitocin analogs from a mutant strain of Nocardia: I. Isolation of the mutant, fermentation and antimicrobial properties. J Antibiot (Tokyo) 1981;34:489–495. doi: 10.7164/antibiotics.34.489. [DOI] [PubMed] [Google Scholar]
  6. Chung J, Byng GS. Mutant Actinosynnema pretiosum strain with increased maytansinoid production. U.S. patent 0157694A1. 2003.
  7. Srinivasulu B, Kim YJ, Chang YK, Shang G, Yu TW, Floss HG. Construction of asm2 deletion mutant of Actinosynnema pretiosum and medium optimization for ansamitocin P-3 production using statistical approach. J Microbiol Biotechnol. 2006;16:1338–1346. [Google Scholar]
  8. Kato Y, Bai L, Xue Q, Revill WP, Yu TW, Floss HG. Functional expression of genes involved in the biosynthesis of the novel polyketide chain extension unit, methoxymalonyl-acyl carrier protein, and engineered biosynthesis of 2-desmethyl-2-methoxy-6-deoxyerythronolide B. J Am Chem Soc 2002 May 15;124(19):5268-9. 2002;124:5268–9. doi: 10.1021/ja0127483. [DOI] [PubMed] [Google Scholar]
  9. Yu TW, Bai L, Clade D, Hoffmann D, Toelzer S, Trinh KQ, Xu J, Moss SJ, Leistenr E, Floss HG. The biosynthetic gene cluster of the maytansinoid antitumor agent ansamitocin from Actinosynnema pretiosum. Proc Natl Acad Sci USA. 2002;99:7968–7973. doi: 10.1073/pnas.092697199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hatano K, Akiyama S, Asai M, Rickards RW. Biosynthetic origin of aminobenzenoid nucleus (C7N-unit) of ansamitocin, a group of novel maytansinoid antibiotics. J Antibiot (Tokyo) 1982;35:1415–1417. doi: 10.7164/antibiotics.35.1415. [DOI] [PubMed] [Google Scholar]
  11. Bierman M, Logan R, O'Brien K, Seno ET, Rao RN, Schoner BE. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 1992;116:43–49. doi: 10.1016/0378-1119(92)90627-2. [DOI] [PubMed] [Google Scholar]
  12. Henderson DJ, Lydiate DJ, Hopwood DA. Structural and functional analysis of the mini-circle, a transposable element of Streptomyces coelicolor A3(2) Mol Microbiol. 1989;3:1307–1318. doi: 10.1111/j.1365-2958.1989.tb00112.x. [DOI] [PubMed] [Google Scholar]
  13. Bibb MJ, White J, Ward JM, Janssen GR. The mRNA for the 23S rRNA methylase encoded by the ermE gene of Saccharopolyspora erythraea is translated in the absence of a conventional ribosome-binding site. Mol Microbiol. 1994;14:533–545. doi: 10.1111/j.1365-2958.1994.tb02187.x. [DOI] [PubMed] [Google Scholar]
  14. Smokvina T, Hopwood DA. Analysis of secondary integration sites for IS117 in Streptomyces lividans and their role in the generation of chromosomal deletions. Mol Gen Genet. 1993;239:90–96. doi: 10.1007/BF00281606. [DOI] [PubMed] [Google Scholar]
  15. Smokvina T, Henderson DJ, Melton RE, Brolle DF, Kieser T, Hopwood DA. Transposition of IS117, the 2.5 kb Streptomyces coelicolor A3(2) 'minicircle': roles of open reading frames and origin of tandem insertions. Mol Microb. 1994;12:459–468. doi: 10.1111/j.1365-2958.1994.tb01034.x. [DOI] [PubMed] [Google Scholar]
  16. Bhatt A, Kieser T. Transposition of IS117 of Streptomyces coelicolor A3(2) in Mycobacterium smegmatis. Microbiology. 1999;145 ( Pt 5):1201–1207. doi: 10.1099/13500872-145-5-1201. [DOI] [PubMed] [Google Scholar]
  17. Motamedi H, Shafiee A, Cai SJ. Integrative vectors for heterologous gene expression in Streptomyces spp. Gene. 1995;160:25–31. doi: 10.1016/0378-1119(95)00191-8. [DOI] [PubMed] [Google Scholar]
  18. Nguyen KT, Kau D, Gu JQ, Brian P, Wrigley SK, Baltz RH, Miao V. A glutamic acid 3-methyltransferase encoded by an accessory gene locus important for daptomycin biosynthesis in Streptomyces roseosporus. Mol Microbiol. 2006;61:1294–1307. doi: 10.1111/j.1365-2958.2006.05305.x. [DOI] [PubMed] [Google Scholar]
  19. Singh D, Seo MJ, Kwon HJ, Rajkarnikar A, Kim KR, Kim SO, Suh JW. Genetic localization and heterologous expression of validamycin biosynthetic gene cluster isolated from Streptomyces hygroscopicus var. limoneus KCCM 11405 (IFO 12704) Gene. 2006;376:13–23. doi: 10.1016/j.gene.2005.12.035. [DOI] [PubMed] [Google Scholar]
  20. Parajuli N, Viet HT, Ishida K, Tong HT, Lee HC, Liou K, Sohng JK. Identification and characterization of the afsR homologue regulatory gene from Streptomyces peucetius ATCC 27952. Res Microbiol. 2005;156:707–712. doi: 10.1016/j.resmic.2005.03.005. [DOI] [PubMed] [Google Scholar]
  21. Pulsawat N, Kitani S, Kinoshita H, Lee CK, Nihira T. Identification of the bkdAB gene cluster, a plausible source of the starter-unit for virginiamycin M production in Streptomyces virginiae. Arch Microbiol. 2007;187:459–466. doi: 10.1007/s00203-007-0212-2. [DOI] [PubMed] [Google Scholar]
  22. Stassi D, Post D, Satter M, Jackson M, Maine G. A genetically engineered strain of Saccharopolyspora erythraea that produces 6,12-dideoxyerythromycin A as the major fermentation product. Appl Microbiol Biotechnol. 1998;49:725–731. doi: 10.1007/s002530051238. [DOI] [PubMed] [Google Scholar]
  23. Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA. Practical Streptomyces genetics. Norwich, UK, The John Innes Foundation; 2000. [Google Scholar]
  24. Kim CG, Kirschning A, Bergon P, Zhou P, Su E, Sauerbrei B, Ning S, Ahn Y, Breuer M, Leistner E, Floss HG. Biosynthesis of 3-amino-5-hydroxybenzoic acid, the precursor of mC7N units in ansamycin antibiotics. J Am Chem Soc. 1996;118:7486–7491. doi: 10.1021/ja9601292. [DOI] [Google Scholar]
  25. Ingram C, Brawner M, Youngman P, Westpheling J. xylE functions as an efficient reporter gene in Streptomyces spp.: use for the study of galP1, a catabolite-controlled promoter. J Bacteriol. 1989;171:6617–6624. doi: 10.1128/jb.171.12.6617-6624.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Camattari A, Bianchi MM, Branduardi P, Porro D, Brambilla L. Induction by hypoxia of heterologous-protein production with the KlPDC1 promoter in yeasts. Appl Environ Microbiol. 2007;73:922–929. doi: 10.1128/AEM.01764-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  28. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd. Vol. 1. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]

Articles from BMC Biotechnology are provided here courtesy of BMC

RESOURCES