Skip to main content
PMC home page
Genetics logoLink to Genetics
. 2008 Jan;178(1):307–323. doi: 10.1534/genetics.107.081869

A Gain-of-Function Suppressor Screen for Genes Involved in Dorsal–Ventral Boundary Formation in the Drosophila Wing

Fernando Bejarano 1,1, Carlos M Luque 1,1,2, Héctor Herranz 1, Georgina Sorrosal 1, Neus Rafel 1, Thu Thuy Pham 1, Marco Milán 1,3
PMCID: PMC2206080  PMID: 18202376

Abstract

The Drosophila wing primordium is subdivided into a dorsal (D) and a ventral (V) compartment by the activity of the LIM-homeodomain protein Apterous in D cells. Cell interactions between D and V cells induce the activation of Notch at the DV boundary. Notch is required for the maintenance of the compartment boundary and the growth of the wing primordium. Beadex, a gain-of-function allele of dLMO, results in increased levels of dLMO protein, which interferes with the activity of Apterous and results in defects in DV axis formation. We performed a gain-of-function enhancer-promoter (EP) screen to search for suppressors of Beadex when overexpressed in D cells. We identified 53 lines corresponding to 35 genes. Loci encoding for micro-RNAs and proteins involved in chromatin organization, transcriptional control, and vesicle trafficking were characterized in the context of dLMO activity and DV boundary formation. Our results indicate that a gain-of-function genetic screen in a sensitized background, as opposed to classical loss-of-function-based screenings, is a very efficient way to identify redundant genes involved in a developmental process.

IN multicellular organisms, initially homogenous sheets of cells are often subdivided into adjacent cell populations by the activity of certain transcription factors (reviewed in Irvine and Rauskolb 2001). In many cases, cell interactions between these populations lead to the restricted expression of signaling molecules at their boundaries, which organize growth and/or the pattern of nearby cells. The stability of these boundaries frequently relies on the acquisition of differential cell affinities between adjacent populations. When these boundaries behave as lineage restriction boundaries, these populations are called compartments (García-Bellido et al. 1973). The Drosophila wing primordium, a monolayered epithelium that gives rise to the adult wing and part of the thorax, is subdivided into an anterior and a posterior compartment by the activity of the homeodomain transcription factors Engrailed and Invected in posterior cells (García-Bellido and Santamaria 1972; Lawrence and Morata 1976; Tabata et al. 1995; Zecca et al. 1995). During larval development, the wing primordium suffers a secondary compartment subdivision. The activity of the LIM-homeodomain transcription factor Apterous (Ap) is responsible for this later subdivision into a dorsal (D) and a ventral (V) compartment (Diaz-Benjumea and Cohen 1993).

Ap has three functions in wing development. It is responsible for the establishment of the Notch-dependent signaling center, the generation of a lineage restriction at the DV boundary, and the acquisition of a dorsal identity during cell differentiation. Ap exerts these functions through three classes of target genes. The complementary expression of Serrate and Delta, two ligands of the receptor Notch, to D and V cells, respectively, initiates a cascade of short-range cell interactions that lead to the activation of Notch at the DV boundary (Figure 1B). Dorsally expressed Serrate and ventrally expressed Delta activate Notch symmetrically in cells on both sides of the DV compartment boundary (Diaz-Benjumea and Cohen 1993; de Celis et al. 1996b; Doherty et al. 1996). Expression of the glycosyltransferase Fringe in D cells makes them more sensitive to Delta and less sensitive to Serrate (Bruckner et al. 2000; Moloney 2000; Munro and Freeman 2000), thus polarizing Notch activation toward the DV boundary. Notch activation induces Wingless (Wg) expression in cells along this boundary. The combined activity of Notch and Wg organizes the growth and patterning of the whole wing primordium (Giraldez and Cohen 2003). The transmembrane proteins Capricious (Caps) and Tartan (Trn) belong to the second class of Ap target genes that contribute to the generation of an affinity difference between D and V cells (Milán et al. 2001a). Finally, the activity of the homeodomain protein Msh, another Ap target, confers D identity (Milán et al. 2001b).

Figure 1.—

Figure 1.—

Open in a new tab

Design of the genetic screen for suppressors of the Beadex wing phenotype. The wing primordium is subdivided into a dorsal (D) and a ventral (V) compartment by the restricted expression and activity of Apterous (Ap) in D cells. (A) ap-lacZ expression in a third instar wing disc visualized by histochemical staining for β-gal activity. (B) Early in development, Serrate (Ser) signals to V cells to activate Notch (N). Likewise, Delta (Dl) signals to D cells to activate Notch modified by Fringe (Fng) along the DV boundary. (C) Beadex1/FM6; apterousGal4/CyO flies, which have a strong loss of wing-margin phenotype, were crossed with a large number of independent EP-containing lines. Gal4 expressed in D cells should bind to Gal4 binding sites within the target element enhancer and activate an adjacent endogenous gene X. Those lines that rescued the wing-margin phenotype were selected.

The activity of Ap must be tightly regulated during development to allow the dynamic change in the expression pattern of Serrate and Delta. Later in development, these proteins are restricted to the presumptive vein tissue to help define the width of the adult longitudinal wing veins (de Celis et al. 1997). Ap activity depends on the formation of a higher order complex, in which two molecules of Ap are bridged by a dimer of its cofactor, the LIM-domain binding protein dLDB/Chip (Fernandez-Funez et al. 1998; Milán and Cohen 1999; van Meyel et al. 1999). The level of Ap activity is regulated during wing development by expression of another LIM-domain protein, dLMO (Milán et al. 1998; Shoresh et al. 1998; Zeng et al. 1998). dLMO competes with Ap for binding to its cofactor Chip/dLDB, contributes to reducing the activity of Ap, and facilitates the transition in the expression pattern of Serrate and Delta, which, late in development, become symmetrically expressed along the wing veins in both D and V compartments (Milán and Cohen 2000).

To further our understanding of the process of boundary formation in the Drosophila wing, we performed a gain-of-function suppressor screen. This screen is based on the capacity of genes to bypass the requirement of Ap protein activity in DV boundary formation when they are overexpressed in the domain of ap. Here we identify, characterize, and discuss four classes of genes in the context of DV boundary formation or dLMO activity: chromatin organization genes, transcription factors, micro-RNAs, and proteins involved in vesicle trafficking and membrane fusion.

MATERIALS AND METHODS

Drosophila strains:

Bx1, apgal4, and ap-lacZ are described in Milán et al. (1998). UAS-Caps, UAS-Trn, caps65.2, and trn25/4 are described in Milán et al. (2001a). AxM1 is described in Perez et al. (2005). lilli4u5 and lilli632 are described in Wittwer et al. (2001). UAS-p35 is described in Hay et al. (1995). UAS-mtv and mtv6 are described in Funakoshi et al. (2001). Other stocks are described in FlyBase. The following Drosophila genotypes were used to generate loss-of-function clones:

  • hs-FLP; lilli4u5 FRT40A/Ubi-GFP FRT40A

  • hs-FLP; cbtE1 FRT40A/Ubi-GFP FRT40A

  • hs-FLP; cbtE28 FRT40A/Ubi-GFP FRT40A

  • hs-FLP; nmdK10909 FRT40A/Ubi-GFP FRT40A

  • hs-FLP; FRT42D mtv6/FRT42D Ubi-GFP

  • hs-FLP; FRT42D l(3)04708/FRT42D Ubi-GFP

  • hs-FLP; nufKG02305 FRT80/Ubi-GFP FRT80

  • hs-FLP; draperd5 FRT80/Ubi-GFP FRT80

  • hs-FLP; draperd19 FRT80/Ubi-GFP FRT80

  • hs-FLP; FRT82 tara1/FRT82 Ubi-GFP.

Larvae were heat-shocked for 1 hr at 37° and dissected 60 hr later.

Crossing scheme:

In a cross, four virgins of a Bx1/FM6; apgal4/CyO stock were mated with 2–3 males of 4200 independent w; EP (white+) insertions (Rorth et al. 1998), generated by the groups of S. Cohen, A. Ephrussi, M. Mlodzik, and P. Rorth (EMBL, Heidelberg, Germany) and kindly maintained by Günter Brönner in Göttingen (Germany). At least 10 Bx1/Y; apgal4/EP males per cross were scored for their wing phenotype. Candidate enhancer-promoter (EP) lines were tested with the Bx1 stock for their capacity to rescue the wing phenotype in a Gal4-independent manner. Candidate EP lines were also tested for their capacity to cause a gain-of-function phenotype when overexpressed with the ptc-gal4, en-gal4, and ap-gal4 wing drivers. Wings were mounted in Faure's medium.

Molecular characterization of EP lines:

To identify the genes isolated by their gain-of-function capacity to suppress the Beadex1 phenotype, flanking DNA was isolated by plasmid rescue and the genomic region immediately downstream of the EP element promoter (at the 3′ end of the P element) was sequenced. Flanking DNA was also isolated by inverse PCR to verify the presence of only one EP line per stock, and the genomic region immediately downstream of the EP element promoter was sequenced to confirm the plasmid rescue results. Details on the protocols followed can be found at the Berkeley Drosophila Genome Project Web site (http://www.fruitfly.org/).

Antibodies and constructs:

Monoclonal antibodies against Wingless (Wg) and Cut are described in the Developmental Hybridoma Bank. Antibody against dLMO is described in Milán et al. (1998) and was kindly provided by S. M. Cohen. Other antibodies are commercially available. In situ hybridization was carried out as in Milán et al. (1996). The dLMO 3′-UTR was amplified by PCR from genomic DNA and cloned into tubulin-enhanced green fluorescence protein (EGFP) as described in Brennecke et al. (2003). The miR-14 hairpin was cloned downstream of dsRed2 in pUAST as described in Brennecke et al. (2003).

RESULTS AND DISCUSSION

Several ways to rescue the Beadex1 wing phenotype:

Beadex1 (Bx1) is a gain-of-function allele of dLMO that results in higher levels of dLMO mRNA in the developing wing imaginal disc (Milán et al. 1998; Shoresh et al. 1998; Zeng et al. 1998). dLMO protein competes with Ap for binding to its cofactor Chip. Consequently, the activity of the Ap protein is reduced in a Bx1 background, its target genes are not expressed at appropriate levels, and the activation of Notch at the DV boundary and the formation of the adult wing margin are compromised (Figure 2B). Activation of the Notch signaling pathway by means of a gain-of-function allele of Notch (Abruptex, de Celis and García-Bellido 1994) or reduced levels of Hairless, an antagonist of Notch signaling activity (Bang et al. 1995), rescued the Bx1 phenotype (Figure 2, I and J), indicating that the wing-margin defects of Bx1 wings are a direct consequence of reduced levels of Notch.

Figure 2.—

Figure 2.—

Open in a new tab

Increased Notch activity or Caps/Tartan expression rescues the Beadex wing phenotype. (A, C, and E) Cuticle preparations of Bx1/Y; apgal4/+ (A), Bx1/Y; apgal4/uas-caps (C) and Bx1/Y; apgal4/uas-trn (E) adult wings. Note rescue of the wing-margin defects when Caps or Trn are expressed. Note also the blistered wing phenotype in C and E, probably due to defects in cell apposition between D and V wing surfaces in the presence of high levels of Caps or Trn expression. (B, D, and F) Cuticle preparations of Bx1/+ (B), Bx1/+, caps65.2/+ (D), and Bx1/+, trn25/4/+ (F) adult wings. Note enhancement of the wing-margin defects when either caps or trn are removed. (G and H) Bx1/Y; apgal4/+ (G) and Bx1/Y; apgal4/uas-caps (H) wing discs labeled to visualize Gal4 (red) and Wingless (Wg, blue) protein expression. Dorsal (d) and ventral (v) compartments are marked. (I and J) Cuticle preparations of Bx1/AxM1 (I) and Bx1/+; HE·31/+ (J) adult wings. Note rescue of the wing-margin defects when compared to the Bx1/+ wing shown in B.

Overexpression of ap in its own expression domain (using the apgal4 driver) rescues the Bx1 phenotype (in Bx1/Y; apgal4/UAS-ap flies), and reduced levels of ap or Chip enhance the Bx1 phenotype (Milán et al. 1998, 2004). Two classes of Ap target genes contribute to the formation of the DV boundary. fringe and Serrate are directly involved in the activation of Notch at the DV boundary (Irvine and Wieschaus 1994; Diaz-Benjumea and Cohen 1995). As expected, overexpression of either of these genes in the ap expression domain rescues the Bx1 phenotype, and reduced levels of these two genes enhance it (Milán et al. 1998, 2004). The leucine-rich repeat (LRR) transmembrane proteins Caps and Trn are involved in the generation of an affinity difference between D and V cells. Reduced levels of caps or trn have been shown to enhance the Bx1 phenotype (Milán et al. 2001a; compare also Figure 2D and 2F with 2B), indicating that these two genes contribute to the formation of the DV boundary. We then monitored the capacity of overexpressed Caps or Trn to rescue the wing-margin defects of Bx1 adult wings. Overexpression of either of these two proteins suppressed the wing-margin defects (Figure 2, C and E). Interestingly, they also rescued the Notch activation levels at the DV boundary, as shown by the levels of Wg protein expression (compare Figure 2G and 2H and data not shown). Taken together, these results indicate that Caps and Trn contribute to the activation of Notch at the DV boundary, probably through the generation of a stable DV affinity boundary. The Bx1 wing-margin phenotype therefore appears to be a highly sensitive background in which to search for genes involved in Ap activity and Notch activation, and as such we used it in a gain-of-function-based screen, described in the next section.

The suppression screen:

A loss-of-function approach has been widely used in traditional genetic screenings but has several limitations. Redundancy between genes that have overlapping functions might partially or completely mask gene function, and an early phenotype caused by a mutation might prevent the detection of later phenotypes. The gain-of-function approach bypasses these two limitations and allows the examination of the misexpression of phenotypes in the biological context of choice. This approach has been shown to be a powerful tool in identifying genes involved in development (Rorth et al. 1998). Here we performed an EP-mediated overexpression screening, in which 4200 randomly inserted and independently generated EP insertions, which allow the misexpression of genes that lie immediately downstream of the point of insertion, were driven in the developing wing by a dorsal-specific Gal4 driver (apgal4) in a Bx1 sensitized background (Figure 1C). Bx1/Y; apgal4/+ male flies showed a strong scalloping phenotype (loss of wing-margin structures) as a result of reduced levels of Ap activity (note that apgal4 is a loss-of-function allele of ap). Those EP insertions, which have the capacity to rescue the wing-margin phenotypes of these flies, drive candidate genes involved in DV boundary formation, either as positive regulators of Ap activity or as downstream genes involved indirectly or directly in the activation of Notch at the boundary. Fifty-three EP lines partially or totally rescued the scalloping phenotype. Most of these lines (47/53) showed a complete rescue. Table 1 describes the relationship of the EP insertion with known and predicted genes. These EP insertions correspond to 35 genes. The finding of EP lines that drive the expression of fringe (EPs 3-511, 3-581, 3-612, and 3-934), ap (EP 3-1583) or osa (EPs 3-473, 3-619, 3-900, 3-941, 3-1074, 3-1386, and 3-1591), a member of the Brahma chromatin-remodeling complex that binds Chip and modulates the expression of Ap target genes (Collins et al. 1999; Heitzler et al. 2003; Milán et al. 2004), confirms the success of our screen.

TABLE 1.

List of suppressor lines

EPG Closest gene Percentage and type of rescue Verification Genetic interaction Other phenotypes 3′ genomic sequence
2-18 Sly Complete/GOF Df(2L)C144 Loss of macrochaete CTAACTCGTCGCCGTCGGCGACTa
2-27 lilliputian Complete/GOF UAS-lilli lillil(2)00632 Loss of macro-/microchaete TGTTATTTGAAAACGTAAGTTCA
2-235 miR-14 Complete/GOF UAS-miR-14 No interaction with miR14Δ1 tggttcgcgtttttccgttctgc
2-356 miR-14 Complete/GOF UAS-miR-14 No interaction with miR14Δ1 gataaaacataaaacgtgtaataa
2-402 miR-14 Complete/GOF UAS-miR-14 No interaction with miR14Δ1 gataaaacataaaacgtgtaataa
2-408 cabut Complete/GOF EP2237 No interaction with cbtE28 gttgagctcccatactctcctgctt
2-430 CG15095 Complete/GOF ccgcacacgacgaaggcacccgat
2-446 nmd /Msp Complete/LOF nmdry4 GCCAACGTATTTGCTCTAAATAGAb
2-473 mtv/sbb/bks Complete/GOF UAS-mtv mtv6 Loss of macrochaete attgcgctctccctctctgtctc
2-760 CG5890 Complete/GOF Df(3R)Espl3 Loss of macrochaete TGGGGTTTGAATTTAAGTTAT
2-814 miR-14 Complete/GOF UAS-miR-14 No interaction with miR14Δ1 Loss of macrochaete gttctgcgtttcattcgtcgtcgaa
2-865 CG8405 Partial/GOF Df(2R)Jp1 Loss of macrochaete cgctaaacgaaacaaagctcaattc
2-867 Draper Complete/LOF EP522, drprd5, drprd19 Loss of macrochaete/Ectopic vein 2 GGTTTGAATGGCCAAAGTTTCNTb
2-1069 chameau Complete/GOF Df(2L)spd Loss of macrochaete CACCAACCTTCCACGCCCCTGGCATac
2-1080 CG4477 Complete/GOF Df(3L)29A6 Loss of micro-/macrochaete, Small D compartment GGCCACGAAAGTTAGCAAGACTTAA
2-1142 miR-14 Complete/GOF UAS-miR-14 No interaction with miR14Δ1 Loss of macrochaete ggcgcacatataaaacgtttatata
2-1279 schnurri Complete/GOF EP2359 shn1, shn04738 Loss of macrochaete, Ectopic vein 2 CCACAGACGCAACAGTCTCGCTCAC
2-1583 apterous Complete/GOF UAS-ap apugo35 Ccgggcaggcgattaca
2-1743 schnurri Complete/GOF EP2359 shn1, shn04738 Loss of macrochaete, Small D compartment TCTGAATGAATTTCGCTGGTCGCCT
3-26 miR-282-RA Partial/GOF EP3041 Df(3L)HR370, Df(3L)HR232, NP0245 Ectopic vein 2 agtgctgccccaaaagaacgatgct
3-28 CG11399 Complete/GOF GS11380/in situ hybridization EY11352 dupl macrochaete, Large D compartment GGCTCCGAGTTTCGTCG
3-364 miR-279a Complete/GOF EP3069/EP3626 Df(3R)3450, l(3)04708 Small D compartment tcaattaccaggcttaccagggt
3-378 HLH-gamma Partial/GOF Df(3R)Espl3 Loss of micro-/macrochaete gatgttgcacacgtgcaacgccgagggaat
3-473 osa Complete/GOF UAS-osa osaeld380 CTCTCAAGACAACGGCAGCGGCCAAAAGc
3-488 Mcpc Complete/GOF Mcpc564 Small D compartment, Loss of micro-/macrochaete ctcacggaggtgcagcgatttctca
3-511 fng Complete/GOF UAS-fng fng80 Ttcggcagctactgtggcacaagcta
3-532 pap/skuld Complete/LOF EP3375, skd10198, skd10197 GACGGGCAGCAGCATTCCTCTCAc
3-562 Annexin IX Complete/GOF EY08209 l(3)neo54 Loss of macro Gagacgcacagccgcttgaagtc
3-581 fng Complete/GOF UAS-fng fng80 tggaccagctcaaagggaatt
3-612 fng Complete/GOF UAS-fng fng80 Gcttgtgccacagtagctgcca
3-619 osa Complete/GOF UAS-osa osaeld380 GTCTGTGGACGGTCGTCAATGCGTGAb
3-637 pointed Complete/GOF uas-pointedP2 No interaction with pntΔ88 Blisters cgtcggccttttttcggtttgtttctttt
3-732 PAR-5/14-3-3ɛ Complete/GOF EP3423/in situ hybridization Df(3R)Cha7 acagccactgtgcagcgtcgccga
3-797 CG1943 Partial/GOF Df(3R)Antp17, Df(3R)Tpl10 gccagacttcttcgagtagagccg
3-826 CG8369 Complete/GOF In situ hybridization Df(3R)p40, Df(3R)p712 Small D compartment Atcgtcggcatgctggcaccttntaa
3-853 pointed Complete/GOF uas-pointedP2 No interaction with pntΔ88 cgtcggccttttttcggtttgtttctt
3-900 osa Complete/GOF UAS-osa osaeld380 ggctcgcttcttcgtcatgc
3-934 fng Complete/GOF UAS-fng fng80 Tgtgccacagtagctgca
3-941 osa Partial/GOF UAS-osa osaeld380 CTCTCAAGACAACGGCAGCGGCCc
3-980 CG8149 Partial/GOF Df(3R)by10 aactgaacctttggcgattccgattcgt
3-1005 capicua Complete/GOF cicD49d ttggagccgtgaaacgaggagag
3-1074 osa Partial/GOF UAS-osa osaeld380 GTGCTGCCCGTTTCATTCGTTTCc
3-1199 CG 14073 Complete/GOF In situ hybridization Df(3L)Cat acccaggttattttttgtcattcat
3-1386 osa Complete/GOF UAS-osa osaeld380 GTGCGTGTATAGCCGCCAAATGTGAAAc
3-1575 taranis Complete/GOF EP3463 tara1, tara3881 Loss of macro ttaaagtgaactgcatta
3-1591 osa Complete/GOF UAS-osa osaeld380 gtgcgtgctacccgctctaatcttgt
3-1638 pointed Complete/GOF uas-pointedP2 No interaction with pntΔ88 Small D compartment, Loss of macrochaete cgtcggccttttttcggtttgtttc
3-1715 nuclear fallout Complete/GOF nufKG02305 Small D comparment agccaatgcaaaccggaaacaac
3-1729 miR-279a Complete/GOF EP3069/EP3626 Df(3R)3450/l(3)04708 Small D compartment gtgtgtgcaaatgatacaaagcaga
3-1789 γ-SNAP Complete/GOF Df(3L)XS572 Small D compartment ATTCGGTGCCACATTGCCAAATCCC
3-1809 CG14709 Complete/GOF Df(3R)M-Kx1 gtgccaggttaagatcagcgctctttgtgg
3-1859 pointed Complete/GOF uas-pointedP2 No interaction with pntΔ88 Loss of macrochaete agccgagctaaaccgatccccgattt
3-2015 Su(Tpl)/dEll Complete/GOF Su(Tpl)17, Su(Tpl)S-192 GTTATCACCACCTCCCTCGTTTac
Open in a new tab

GOF, gain of function; LOF, loss of function. Candidate genes validated with an UAS transgene, RNA probe (in situ hybridization) or genetic interaction with a mutant allele are in boldface type. Forty-one EP lines have been validated this way. Candidate genes validated with an EP insertion or genetic interaction with a deficiency are underlined. Ten EP lines have been validated this way.

a

The EP insertion is pointing in reverse.

b

The EP is sitting in an exon.

c

The EP is sitting in an intron.

Most EPs were located in the correct location (5′ end) of the nearby genes that would generate Gal4-driven sense-strand full-length mRNAs. This result was also observed in other published EP screens (Rorth et al. 1998; Toba et al. 1999). A low percentage of EP lines were located in intronic or exonic sequences. Partial Gal4-driven sense-strand functional mRNAs might be generated in the former case. Note three EP lines were inserted in the first intron of osa (Table 1) and the rescue capacity of this gene has already been demonstrated by means of an UAS-osa transgenic construct (Milán et al. 2004). When inserted in exonic sequences, mutant alleles of the candidate genes might be produced. Note those EP lines inserted in skuld, Draper, and nonmitochondrial derivative (nmd) were located in exonic sequences (Table 1). The loss of function of these genes, and not its Gal4-mediated overexpression, was responsible for the Bx1 rescue, as demonstrated by the dominant genetic interaction between Bx1 and loss-of-function alleles of these genes (see below). Surprisingly, some EPs (e.g., 3-1583 driving the expression of ap; 3-612 and 3-934 driving the expression of fringe) were located in the opposite direction, suggesting that the Gal4 binding sites were duplicated during transposition, or alternatively, that the EP drives the expression of 3′-located genes. Interestingly, a similar case was found in UAS transgenic constructs, in which a genomic fragment containing a micro-RNA in antisense orientation relative to the pUAST vector is transcribed in a Gal4-driven sense strand, probably as a result of the capacity of the Gal4-dependent transcription to increase the activity of the endogenous promoter (Brennecke et al. 2003).

Two different methods were used to validate the candidate genes whose overexpression was able to rescue the Beadex wing-margin phenotype. First, available UAS transgenes, or alternatively, available EP insertions located at the 5′ end of the candidate genes were tested for the ability to rescue, in a Gal4-dependent manner, the Beadex wing-margin phenotype. We found that in the cases analyzed (32/53 EPs) this was the case (Table 1). In some cases, UAS transgenes or other EP insertions were not available. We then carried out in situ hybridization with RNA-labeled probes of the genes downstream of the EP insertions. We found that in the cases analyzed (4) the genes are overexpressed in a Gal4-dependent manner (Figure 3). Our experience with EP insertions somehow indicates, however, that this might not be the best way for the validation, since many genes in the neighborhood can be upregulated upon Gal4 transcriptional activation. This is the reason we have not performed in situ hybridization for more EP insertions.

Figure 3.—

Figure 3.—

Open in a new tab

In situ hybridization to wild type (A, B, E, F, and H), apgal4/+; EP-732/+ (C), apgal4/+; EP-826/+ (D), and apgal4/+; EP-1199/+ (G) wing (A–G) or eye-antenna (H) imaginal discs with anti-sense (AS) or sense (SS) par 5 (A–C), CG8369 (D), and CG14073 (E–H) RNA probes. Note high levels of CG14073 expression at the morphogenetic furrow of the eye-antenna imaginal disc.

Since we performed a misexpression screening, several of the candidate genes able to rescue the Bx1 phenotype may not be required for wing development and DV boundary formation in wild-type flies. To test this, we searched FlyBase for mutants in the candidate genes or deficiencies covering them, and checked whether there were any dominant interactions with Bx1. Bx1/+ females have a mild scalloping in the posterior compartment of the wing (Figure 2B). Males carrying a mutation in the candidate gene or a deficiency covering it were crossed with Bx1 females, and the wing phenotype of the female progeny was tested for enhancement. The vast majority of the candidate genes showed a dominant interaction with Beadex1 (Table 1; 28/34 genes tested; Figure 4). Some of the genes, when removed, rescued the Bx1 phenotype (nmd, skuld/pap, and Draper, Figure 4R and data not shown), indicating that the suppression is due to the loss of function of the candidate gene.

Figure 4.—

Figure 4.—

Open in a new tab

Wing phenotypes of the suppressor lines. Cuticle preparations of adult wings are from the following genotypes: (A) Bx1/Y; apgal4/EP2-18 (Sly); (B) Bx1/Y; apgal4/EP2-408 (cbt); (C) Bx1/Y; apgal4/EP2-446 (nmd); (D) Bx1/Y; apgal4/EP2-760 (CG5890); (E) Bx1/Y; apgal4/EP2-1069 (chm); (F) Bx1/Y; apgal4/EP2-1080 (CG4477); (G) Bx1/Y; apgal4/EP2-1279 (shn); (H) Bx1/Y; apgal4/EP2-1583 (ap); (I) Bx1/Y; apgal4/EP3-26 (miR-282-RA); (J) Bx1/Y; apgal4/EP3-364 (miR-279a); (K) Bx1/Y; apgal4/EP3-378 (HLH-γ); (L) Bx1/Y; apgal4/EP3-532 (skuld); (M) Bx1/Y; apgal4/EP3-562 (Annex-IX); (N) Bx1/Y; apgal4/EP3-1575 (tara); (O) Bx1/+; shn4738/+; (P) Bx1/+; NP0245/+; (Q) Bx1/+; l(3)04708/+; (R) Bx1/Y; skuld10198/+; (S) Bx1/+; l(3)neo54/+; and (T) Bx1/+; tara1/+.

Finally, we analyzed the capacity of the genes identified to cause a gain-of-function phenotype in the wing, in an otherwise wild-type background. For this purpose, we used the following Gal4 drivers: ap-gal4 (expressed in dorsal cells), patched-gal4 (expressed along the anterior–posterior compartment boundary), and engrailed-gal4 (expressed in the posterior compartment). Ectopic expression of fringe or ap in the V compartment, using the patched-gal4 or engrailed-gal4 drivers, induces ectopic wing-margin structures (Milán and Cohen 2003). When using the same Gal4 drivers, none of the lines identified, with the exception of those driving the expression of fringe or ap, caused this phenotype (data not shown). This observation indicates that the number of genes with an instructive role like fringe, Serrate, or ap is very low, and that the newly identified genes encode for proteins that modulate the activity of the elements or pathways involved in DV boundary formation. Many of these genes caused the loss of macro- and micro-chaetae in the adult notum (when expressed with the ap-Gal4 driver), thereby resembling a Notch gain-of-function phenotype (Table 1, Heitzler and Simpson 1991). This suggests that the nature of the Bx1 rescue by overexpression of these genes is through an increase in Notch activity levels, as occurred in an Abruptex or Hairless mutant background (Figure 2, I and J). Taken together, these results indicate that the designed suppression screen is efficient in identifying modulators of the pathways and elements involved in DV boundary formation.

Classes of genes:

Of the 35 genes identified in the screen, 20 corresponded to genes previously characterized. Five genes [ap, osa, fng, skuld/pap, and E(spl-γ)] participate in Notch signaling and/or DV boundary formation in the Drosophila wing (Diaz-Benjumea and Cohen 1993; Irvine and Wieschaus 1994; de Celis et al. 1996a; Janody et al. 2003; Milán et al. 2004). Other genes are involved in other aspects of wing development (e.g., capicua and pointed in EGF receptor signaling, mtv and schnurri in Dpp signaling) (Greider et al. 1995; Funakoshi et al. 2001; Roch et al. 2002) and Hedgehog signaling (Bejarano et al. 2007), suggesting that either different signaling pathways are closely coordinated during DV boundary formation or distinct pathways share common elements. A large group of genes with essential roles in other developmental processes were identified (e.g., PAR-5/14-3-3ɛ in anterior–posterior axis formation in the oocyte, cabut in JNK signaling, and embryonic dorsal closure) (Benton et al. 2002; Muñoz-Descalzo et al. 2005). Many of these have not been tested for their role in DV boundary formation; however, they might also be involved in this developmental process. These genes are described in Table 2. Here we will further discuss the function of several of these genes.

TABLE 2.

Classes of suppressor lines

Type of genes Genes EP line Description of gene References
Epigenetic mechanisms osa 3-473, 3-619, 3-900, 3-941, 3-1074, 3-1386, 3-1591 A trithorax group gene that associates with the Brahma chromatin remodeling complex. Osa binds Chip and modulates the expression of Ap target genes. Heitzler et al. (2003)
Milán et al. (2004)
taranis 3-1575 A novel trithorax-group member, involved in maintaining an active chromatin structure; it genetically interacts with osa Calgaro et al. (2002)
chameau 2-1069 Histone acetyltransferase activity, involved in chromatin-mediated gene silencing Grienenberger et al. (2002)
Transcription apterous 3-1583 LIM-homeodomain transcription factor, involved in DV boundary formation in the wing Diaz-Benjumea and Cohen (1993)
E(spl)-γ 3-378 HLH-containing transcription factor that serves as an important effector of Notch to control neuronal cell fate Bray (1997)
skuld/pap 3-532 RNA polymerase II transcription mediator activity, involved in maintaining the compartment affinity boundaries Janody et al. (2003)
pointed 3-637, 3-853, 3-1638, 3-1859 Type II transforming growth factor-β receptor in the nucleus that regulates transcription of aos Hsu and Schulz (2000)
capicua 3-1005 Transcription repressor acting in EGFR signaling to induce vein/intervein cell fate decision Roch et al. (2002)
schnurri 2-1279, 2-1743 Zinc finger transcription factor involved in both activation and repression of Dpp target genes Greider et al. (1995)
mtv/sbb/bks 2-473 Zinc finger protein, interacts with Groucho to repress hh expression in the anterior compartment of the wing disc Bejarano et al. (2007)
lilliputian 2-27 Nuclear protein involved in the control of cell size Wittwer et al. (2001)
cabut 2-408 Nuclear protein involved in embryonic dorsal closure Muñoz-Descalzo et al. (2005)
Su(Tpl)/dEll 3-2015 RNA polymerase II transcription elongation factor activitya Strong interaction with Cut and Notch Eissenberg et al. (2002)
CG8149 3-980 SAP domain/DNA binding domain containing protein
CG11399 3-28 WW domain protein involved in coactivation of transcription and modulation of RNA polymerase II activity
Micro-RNAs mir-14 2-235, 2-356, 2-402, 2-814, 2-1142, Micro-RNA that suppresses cell death Xu et al. (2003)
mir-282-RA 3-26
mir-279a 3-364, 3-1729
Membrane trafficking γ-Snap 3-1789 γ-soluble NSF attachment protein, involved in synaptic vesicle priming and protein transport, involved in the Notch signaling pathway Stewart et al. (2001)
Sly 2-18 SNARE-binding activity, involved in protein targeting/intracellular protein transport and a component of the membrane
nuf 3-1715 Nuf is required for localizing Rab11 to the recycling endosome and for recruiting proteins to the plasma membrane during cellularization. Emery et al. (2005)
Annexin IX 3-562 Calcium-dependent phospholipid binding activity, involved in cytoskeletal interaction and intracellular signaling
Others fringe 3-511, 3-581, 3-612, 3-934 Target of Apterous encoding a glycosyltransferase activity involved in Notch signaling Irvine and Wieschaus (1994)
PAR-5/14-3-3ɛ 3-732 Protein kinase activity/Ras signal transductionb/anterior-posterior polarization in Drosophila Benton et al. (2002)
Draper 2-867 Extracellular matrix structural constituentc involved in phagocytosis of apoptotic cells by hemocytes
CG8369 3-826 Kazal-type serin protease inhibitor
CG15095 2-430 General substrate transporter of the Major facilitator superfamily
CG14709 3-1809 Fatty acid binding activity; transporter activityd
nmd/Msp 2-446 ATPase in ER probably involved in intracellular protein transport
Mcpc 3-488 Mitochondrial phosphate carrier protein
CG5890 2-760 Calciume binding protein
CG8405 2-865 K+ channel
CG4477 2-1080 Peptidase
CG1943 3-797 Unknown
CG14073 3-1199 Four Ankyrin Repeats. It binds through CG4195 to two additional proteins involved in chromatin silencing: polyhomeotic-p (CG18412) and polyhomeotic-d (CG3895). Giot et al. (2003)
Open in a new tab

Chromatin organization genes:

Eukaryotic nucleosome assembly and higher-order packaging produce a general repression of gene expression. Remodeling of chromatin structure is required for gene activation. ATP-dependent protein complexes with chromatin-remodeling activity can change nucleosomal pattern and DNA packaging. In Drosophila, the Polycomb group of genes maintains repression of homeotic genes by inducing a repressive chromatin structure while some members of the trithorax group of genes suppress dominant Polycomb phenotypes (Kennison and Tamkun 1988). In our screen, we found two members of the trithorax group of genes: taranis (3-1575) and osa (3-473, 3-619, 3-900, 3-941, 3-1074, 3-1386, 3-1591), whose misexpression rescues the Bx1 mutant phenotype (Figure 4N and Milán et al. 2004), and one member of the Polycomb group of genes: chameau (2-1069), whose, most probably, loss of function dominantly rescues the Bx1 mutant phenotype (Figure 4E). osa, a trithorax gene, associates with the Brahma chromatin remodeling complex (Collins et al. 1999), binds and genetically interacts with Chip, the Ap cofactor (Heitzler et al. 2003), and modulates the expression of Ap target genes (Milán et al. 2004). taranis, another member of the trithorax group of genes, appears to be involved in integrating chromatin structure with cell-cycle regulation (Calgaro et al. 2002). Although taranis genetically interacts with osa and Beadex1 (Figure 4T and Calgaro et al. 2002; Milán et al. 2004), clones of cells mutant for taranis did not affect DV boundary formation (supplemental Figure S1 at http://www.genetics.org/supplemental/), thus suggesting that the role of taranis in this process is redundant with another gene. chameau, a member of the Polycomb group of genes, is involved in gene silencing. The EP line 2-1069 is inserted pointing reverse in the fifth exon of chameau and it is thus supposed that it drives transcription of antisense strand chameau mRNA. Consequently, the rescued phenotype observed might be the result of decreased expression of chameau.

Genes involved in the control of transcription:

The percentage of genes involved in transcriptional regulation, as detected in the screen, was very high, corresponding to almost half of the lines. Three genes have already been well-characterized for their role in DV boundary formation and/or Notch signaling in the Drosophila wing, including ap (2-1583, Figure 4H). E(spl)-γ (3-378, Figure 4K), a member of the Enhancer of split gene complex, is a downstream effector of Notch, acts as a transcriptional repressor in controlling neuronal cell fate decisions (Robey 1997), and belongs to the Hairy-related proteins with a proline basic HLH domain. skuld/pap/TRAP240 (3-532, Figure 4L), a homolog of TRAP240, together with kohtalo, the TRAP230 homolog, are the largest subunits of the Drosophila mediator complex. Proteins of this complex act as transcriptional coactivators that link specific transcription factors to RNA polymerase II and basal transcriptional machinery. skuld and kohtalo are required to maintain the difference in cell affinities between D and V cells (Janody et al. 2003). One might then expect that mutations in these genes would enhance, like caps and tartan mutant alleles do, the Bx1 wing-margin phenotype (Milán et al. 2001a). However, this was not the case. The EP line 3-532, which is inserted in the first intron, and loss-of-function mutations in skuld dominantly rescued the Bx1 phenotype in a Gal4-independent manner (Figure 4R and data not shown), indicating that skuld might be involved in other aspects of wing development and not simply in controlling cell affinities.

Five genes have already been well-characterized for their role in other aspects of wing development. capicua (3-1005), a transcriptional repressor involved in wing-vein patterning (Roch et al. 2002), and pointed (3-637, 3-853, 3-1638, and 3-1859), a gene encoding two ETS-related proteins, are two transcriptional mediators of the EGF receptor pathway in Drosophila. The restricted expression of the EGF receptor ligand vein in the most dorsal part of the early wing primordium induces the activation of the EGF receptor pathway and the expression of ap, thus defining the dorsal compartment (Wang et al. 2000; Zecca and Struhl 2002). Given that transheterozygous combinations for pointed loss-of-function alleles resemble the phenotypes caused by early depletion of the EGF receptor pathway (Scholz et al. 1993), the activity of the EGF receptor pathway might be mediated by pointed. The role of capicua in this process remains to be analyzed.

schnurri (2-1279 and 2-1743), a zinc finger-containing transcription factor, master of thickveins (mtv, 2-473), a zinc finger-containing nuclear protein, and lilliputian (lilli, 2-27), the only member of the fragile X/Burkitt's lymphoma family of transcription factors in Drosophila, are involved in various aspects of dpp-dependent patterning in embryonic and/or wing development (Aurora et al. 1995; Greider et al. 1995; Funakoshi et al. 2001; Su et al. 2001). Two distinct insertions driving the expression of schnurri were identified as suppressors of Bx1 (Figure 4G) and an independently generated EP insertion driving schnurri expression (EP2359; Rorth et al. 1998) also suppressed the Bx1 wing-margin phenotype. Overexpression of lilli or mtv in the D compartment of Bx1 males completely rescued the wing-margin defects of the adult flies and Notch activity levels at the DV boundary, as shown by the expression of Wg protein (Figures 5, B and D, and 6A and data not shown). In these two cases, the rescue was verified with an UAS transgenic construct (Figure 5C and data not shown). Note the overexpression of schnurri, lilli, or mtv caused growth and wing-folding defects, indicating that these genes are involved in other developmental processes (Greider et al. 1995; Funakoshi et al. 2001; Su et al. 2001; Wittwer et al. 2001; Bejarano et al. 2007). In all cases, loss of one copy of the gene strongly enhanced the Bx1 heterozygous adult wing phenotype (compare Figures 4O, 5A, and 6B with 2B). schnurri mutant cells have been previously shown to cause loss of wing-margin structures in the adult wing (Greider et al. 1995). We have analyzed the capacity of lilli or mtv mutant cells to activate the Notch pathway at the DV boundary. For this purpose, we monitored the expression of wg and cut, two target genes of Notch at the wing margin. Notch activity levels were strongly reduced in mtv mutant cells (Figure 5E). Consistent with this, mtv mutant clones induced loss of wing-margin structures in the adult (Figure 5, F and G). Loss of lilli caused a slight reduction in Wg expression levels (Figure 6, D–F) and did not produce any overt adult wing phenotype. Altogether, these results indicate that these three genes are directly or indirectly required for proper Notch activation at the DV boundary. Mtv protein is known to work in the same protein complex as Groucho (Bejarano et al. 2007), the founding member of a superfamily of transcriptional corepressors that operate in many signaling pathways, including Notch in the Drosophila wing. We would then like to speculate that Mtv exerts its function together with Groucho in the Notch pathway.

Figure 5.—

Figure 5.—

Open in a new tab

master of thickveins as a suppressor of the the Beadex1 phenotype. (A–C) Cuticle preparations of Bx1/+; mtv6/+ (A), Bx1/Y; apgal4/EP-473 (B), and Bx1/Y; apgal4/uas-mtv (C) adult wings. (D) Bx1/Y; apgal4/uas-mtv wing imaginal discs labeled to visualize Gal4 (green) and Wingless (Wg, red in the top and white in the bottom) protein expression. (E) Clones of cells mutant for master of thickveins (mtv6) and labeled by the absence of the GFP marker (green). Cut protein expression is shown in red (top) or white (bottom). Note loss of Cut expression in clones abutting the DV boundary. (F and G) Clones of cells mutant for master of thickveins (mtv6), labeled by the forked (f36a) cuticle marker and marked by a red line. Note loss of wing-margin structures and ectopic vein tissue.

Figure 6.—

Figure 6.—

Open in a new tab

lilliputian as a suppressor of the the Beadex1 phenotype. (A and B) Cuticle preparations of Bx1/Y; apgal4/EP-27 (A) and Bx1/+; lilli632/+ (B) adult wings. (C–F) Clones of cells mutant for lilliputian (lilli4u5) and labeled by the absence of the GFP marker (green). Wingless (Wg) protein expression is shown in red (top) or white (bottom). Note reduced levels of Wg protein expression in clones abutting the DV boundary (white arrows) when compared to the endogenous level (red arrowhead) of Wg expression.

Finally, overexpression of cabut (2-408), a gene encoding a zinc finger transcription factor and involved in embryonic dorsal closure (Muñoz-Descalzo et al. 2005), rescued the Bx1 phenotype (Figure 4B). It is interesting to note that loss of function mutations of cabut dominantly enhanced the Bx1 phenotype and clones of cells mutant for cabut did not show any apparent wing phenotype (supplemental Figure S1 at http://www.genetics.org/supplemental/). These observations suggest that the role of cabut is redundant with another gene during wing development. Su(Tpl)dEll, a gene encoding an RNA polymerase II transcription elongation factor, is essential for development and strongly interacts with mutants in Notch and cut in the Drosophila wing (Eissenberg et al. 2002). We also verified that loss-of-function mutations of Su(Tpl)dEll dominantly enhanced the Bx1 phenotype (Table 1).

CG11399, a suppressor of Beadex, encodes the Drosophila phosphorylated carboxy-terminal domain interacting protein 1 ortholog:

The EP insertion line 3-28 directed the expression of CG11399 (Figure 7, A–D) and, when overexpressed in the D compartment, completely rescued the Bx1 phenotype (Figure 7E). Another independently generated EP insertion (GS11380) drove the expression of CG11399 and also rescued the wing-margin defects (data not shown). Interestingly, when CG11399 was overexpressed in the notum (in apgal4/+; EP3-28/+ or apgal4/+; GS11380/+ flies), macro- and micro-chaetae were absent, thereby resembling a Notch gain-of-function phenotype (Figure 7, N and O). Consistent with this, an EP insertion located in the fifth protein encoding exon of CG11399 and most probably behaving as a loss-of-function allele of CG11399 (note it has a mild wing-vein phenotype that is also reproduced in a hemizygous condition over a deficiency, Figure 7, G and H) enhanced the wing-margin and -vein defects of NND1, a hypomorphic allele of Notch (compare Figure 7, I and J), and dxenu, a hypomorphic allele of deltex, a positive modulator of a Notch receptor (Matsuno et al. 1995; compare Figure 7, K and L). CG11399 encodes the Drosophila ortholog of human phosphorylated carboxy-terminal domain (CTD) interacting factor 1 (PCIF1), a nuclear WW domain-containing protein (Fan et al. 2003). Phosphorylation of the CTD of the largest subunit of RNA polymerase II is crucial in transcription elongation and in coupling transcription to pre-mRNA processing. The WW domain of PCIF1 directly and preferentially binds to the phosphorylated CTD compared to the unphosphorylated CTD (Fan et al. 2003). PCIF1 may play a role in mRNA synthesis by modulating RNA polymerase II activity. Our results suggest that the Drosophila PCIF1 ortholog, encoded by CG11399, participates in modulating the transcription of certain mRNAs involved in Notch signaling. It is interesting to note that CG11399 specifically modulates the Notch pathway and does not appear to modulate other active pathways in the Drosophila wing, since overexpression or loss of CG11399 activity did not cause any other wing phenotype.

Figure 7.—

Figure 7.—

Open in a new tab

CG11399, the Drosophila phosphorylated C-terminal domain interacting factor, suppresses the Beadex1 phenotype. (A) Genomic map of the CG11399 region. Exons are shown as boxes, and the ORF is marked in black. CG11399 was identified as a suppressor of the Beadex1 phenotype by the EP-3-28 insertion (black arrowhead). Two other EP lines (GS11380 and EY11352, black arrowheads) are shown. (B–D) In situ hybridization to apgal4/+; EP-28/+ (B) and wild-type (C and D) wing imaginal discs with an anti-sense (B and C) and sense (D) CG11399 RNA probe. (E–L) Cuticle preparations of Bx1/Y; apgal4/EP-28 (E), Bx1/+; EY11352/+ (F), EY11352 (G), EY11352/Df(3L)ri-79c (H), NND1/Y (I), NND1/Y; EY11352/+ (J), dxENU/Y (K), and dxENU /Y; EY11352/+ (L) adult wings. Note ectopic vein tissue marked by a black arrow in G and H. (M–O) Cuticle preparations of wild-type (M), apgal4/+; EP-28/+ (N), and apgal4/+; GS11380/+ (O) adult nota. Note loss of macrochaetae in N and loss of both macro- and microchaetae in O.

micro-RNAs:

Three micro-RNAs, small regulatory RNAs that are between 21 and 25 nucleotides in length and repress gene function through interactions with target mRNAs, were identified in the screen: miR-14 (2-235, 2-356, 2-402, 2-814, and 2-1142), miR-282-RA (3-26, Figure 4I) and miR-279a (3-364 and 3-1729, Figure 4J and data not shown, see Tables 1 and 2). Among these, miR-14 was identified in a previous screen as a cell death suppressor (Xu et al. 2003). Five distinct insertions driving the expression of miR-14 were identified as suppressors of Bx1 and an UAS-miR-14 transgenic construct also suppressed the Bx1 wing phenotype (Figure 8, A, B, and D). Expression of miR-14 increased Notch activity levels at the boundary of Bx1 wing discs, as shown by the expression of Wg (Figure 8, F and G). Overexpression of miR-14 has been reported to suppress cell death induced by multiple stimuli (Xu et al. 2003). In this context, it is interesting to note that loss of Notch activity causes cell death in the wing disc (Ye and Fortini 1999) and it has been postulated that this cell death causes defects in the adult wing margin (Adachi-Yamada et al. 1999). We then analyzed the capacity of suppressed cell death to bypass the requirement for Notch in cell survival and, consequently, to rescue the wing-margin defects of Bx1 wings. For this purpose, we used the P35 baculovirus protein, which strongly inhibits caspase enzymatic activity in Drosophila tissues (Hay et al. 1995) and the Drosophila inhibitor of caspases DIAP1 (Wang et al. 1999). Expression of p35 or DIAP1 in the D compartment of Bx1 flies did not rescue the wing-margin defects (Figure 8, C and E). Wg expression levels in boundary cells also were not increased (data not shown). Taken together, these results indicate that the capacity of miR-14 to rescue the Bx1 wing-margin phenotype is not a consequence of suppressed cell death, and the loss of wing-margin structures in this mutant background is not a direct result of cell death. It appears then as if the wing-margin defects in the absence of Notch signaling might be a consequence of impaired patterning of the wing margin as well as a failure of growth and not a direct consequence of cell death.

Figure 8.—

Figure 8.—

Open in a new tab

miR-14 as a suppressor of the Beadex1 phenotype: genomic map of the miR-14 region (blue box). miR-14 was identified as a suppressor of the Beadex1 phenotype by four EP insertions (blue arrowheads). (B–E) Cuticle preparations of Bx1/Y; apgal4/EP-235 (B), Bx1/Y; apgal4/uas-p35 (C), Bx1/Y; apgal4/uas-miR-14 (D), and Bx1/Y; apgal4/EP-DIAP1 (E) adult wings. (F and G) Bx1/Y; apgal4/+ (F) and Bx1/Y; apgal4/ EP-235 (G) wing discs labeled to visualize Gal4 (red) and Wingless (Wg, blue) protein expression. (H) Cuticle preparation of a apgal4/uas-miR-14 adult wing. (I) apgal4/uas-miR-14 adult fly. Note the held-up wing phenotype. (J–L) ptcgal4/uas-miR-14 (J and K) and wild-type (L) wing discs labeled to visualize GFP (red) and dLMO (green, top, or white, bottom) protein expression. Note reduced levels of dLMO protein in the GFP domain (white arrow). (M and N) Expression of the dLMO 3′-UTR sensor transgene (green or white) in ptcgal4/uas-miR-14 (M) or wild-type wing discs (N). The sensor transgene was downregulated by miR-14 overexpression.

In the last few years, several groups have carried out computational identifications of micro-RNA target genes by looking for target sites located in the 3′-UTRs of the mRNAs. Interestingly, Bx/dLMO was identified as a potential miR-14 target gene (Stark et al. 2003). We then monitored the capacity of miR-14 to reduce the levels of dLMO protein in the wing disc as well as to phenocopy a dLMO (held-up wing) loss-of-function phenotype. The phentoype of apgal4;UAS-miR-14 flies resembled the held-up wing phenotype of dLMO mutant flies (Figure 8, H and I), and the expression levels of dLMO protein were reduced by overexpression of miR-14 in the wing disc (Figure 8, J–L). We then monitored the capacity of miR-14 to regulate the expression level of a dLMO 3′-UTR sensor transgene consisting of the dLMO 3′-UTR cloned into the tubulin-promoter-EGFP reporter plasmid. The dLMO 3′-UTR sensor transgene was expressed uniformly in the wing imaginal disc (Figure 8N). Gal4-dependent expression of miR-14 reduced expression of the dLMO 3′-UTR sensor transgene (Figure 8M). Although miR-14 is expressed during larval stages (Grun et al. 2005), loss of miR-14 did not show any overt wing phenotype nor did it enhance the wing-margin defects of Bx1/+ wings. Thus, the direct regulation of dLMO protein levels by miR-14 might be required in other developmental contexts in which dLMO activity is involved (Tsai et al. 2004).

Membrane fusion and vesicle trafficking:

In many signal transduction pathways, vesicle trafficking of ligands or receptors is a key regulatory event (reviewed in Gonzalez-Gaitan 2003). SNARE proteins play a central role in intracellular membrane fusion and vesicle trafficking (reviewed in Jahn and Scheller 2006). The interaction of SNAREs present on two opposing membranes is generally believed to provide the driving force to initiate membrane fusion. We identified two genes involved in SNARE-dependent membrane fusion in our screen: γ-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (SNAP) (3-1789) and Slh (2-18, Figure 4A), the Drosophila ortholog of the Sec1p/Munc18 protein. SNAPs are highly conserved proteins that participate in intracellular membrane fusion and vesicular trafficking. They recruit NSF to the membrane after being bound to specific membrane receptors termed SNAREs (SNAP receptor). The complex, which is then disrupted upon ATP hydrolysis by NSF, is a prerequisite of membrane fusion. Sec1/Munc18 proteins are required for the controlled assembly of SNARE complexes and are essential for membrane fusion at the plasma membrane. The nature of the suppression of the Bx1 phenotype by γ-SNAP or Slh overexpression may rely on elevated levels of transmembrane or secreted proteins involved in Notch signaling and/or DV boundary formation in the plasmatic membrane.

Rab11 is involved in controlling vesicular protein transport through recycling endosomes to the plasma membrane (Pfeffer and Aivazian 2004). Dominant-negative forms of Rab11 inhibit the recycling of endocytosed transmembrane proteins to the plasma membrane, thereby suggesting that Rab11 regulates trafficking of vesicular cargo through the recycling endosomal compartment. Nuf (nuclear fallout) is a homolog of arfophilin-2, an ADP ribosylation factor effector that binds Rab11 and influences recycling endosome (RE) organization (Hickson et al. 2003). Nuf and Rab11 are mutually required for their localization to the RE. Delta has been shown to pass through the recycling endosome which is marked by Rab 11 and Nuf, an essential step for its activity as a Notch ligand (Emery et al. 2005). We identified nuf as a gain-of-function suppressor of the Bx1 phenotype (line 3-1715) and loss-of-function alleles of nuf enhanced the wing-margin defects of Bx1/+ heterozygous flies (Table 1). Clones of cells mutant for nuf did not affect Notch activity levels at the DV boundary, as shown by the expression levels of Wg (supplemental Figure S1 at http://www.genetics.org/supplemental/). Thus, enhanced recycling of endosomal Delta, and probably other proteins involved in DV boundary formation, might increase, directly or indirectly, Notch signal and rescue the wing-margin defects of Bx1 adult wings. This recycling might be required to modulate Notch activity levels at the DV boundary but does not appear to be a strict requirement for this process.

Finally, we identified Annexin IX (3-562, Figure 4M) as a gain-of-function suppressor of Beadex. Annexin IX is a member of the annexin family of intracellular Ca2+-dependent lipid-binding proteins. Interestingly, some members of this family are found in apical transport vesicles in Madin–Darby canine kidney cells and may be involved in apical delivery of trans-Golgi network-derived vesicles (reviewed in Harder and Simons 1997). Taken together, the finding of genes as gain-of-function suppressors of the Bx1 wing-margin phenotype and encoding for proteins involved in membrane fusion, endosome recycling, and vesicle trafficking indicates that the relative levels at the membrane of transmembrane proteins or secreted molecules are crucial and probably modulated during wing development.

Conclusions:

Here we show that a gain-of-function EP-based screen in a Bx1-sensitized background to search for suppressors of the wing-margin phenotype is efficient in identifying known and new genes involved in DV boundary formation as well as in the regulation of Beadex/dLMO gene activity. Dominant genetic interactions of Bx1 with loss-of-function alleles of the suppressor genes identified have demonstrated that the vast majority are involved in wing development. This is in contrast with classic EP screens based on the gain-of-function phenotype of candidate genes, in which the number of genes not participating in the developmental context of interest is relatively higher. We have shown that many of the Bx1 suppressors involved in DV boundary formation are not essential during wing development (i.e., taranis, nmd, nuf, draper, and cabut; supplemental Figure S1 at http://www.genetics.org/supplemental/). This observation suggests that these suppressors share redundant activities with other gene products. The EP gain-of-function approach has also been shown to be extremely efficient in unraveling new roles for the recently identified micro-RNAs (miRs, e.g., Brennecke et al. 2003; Nairz et al. 2006). Loss-of-function-based forward genetic screenings have not been as productive in this respect, probably because of the reduced size of these miRs or their redundant activities. Taken together, a suppressor EP-based gain-of-function screen in a sensitized background provides a suitable combination to identify new genes, including miRs and redundant genes, involved in a given process.

Redundancy and regulatory feedback loops contribute to the robustness of gene regulatory networks (Stelling et al. 2004). Classical loss-of-function-based forward genetic screenings have been highly productive in identifying genes that behave as hubs in these networks (Friedman and Perrimon 2007). Essential genes in yeast are among those most highly connected (Barabasi and Oltvai 2004). However, forward genetic screenings are not as effective in identifying redundant genes or regulators of these feedback loops, whose loss of function might not show any overt phenotype. More quantitative in vivo genetic screenings, such as the one done recently in Drosophila for bristle number (Norga et al. 2003), or, alternatively, cell culture-based RNAi quantitative screenings have been more efficient in this regard (Friedman and Perrimon 2007). Our results indicate that an EP-based gain-of-function in vivo genetic screen in a sensitized background is a strong alternative for the identification of redundant genes or regulators of feedback loops involved in developmental gene regulatory networks.

Here we have identified, characterized, and discussed four classes of genes in the context of DV boundary formation or dLMO activity: chromatin organization genes, transcription factors, miRs, and proteins involved in vesicle trafficking and membrane fusion. Several conclusions can be drawn. Among the genes involved in chromatin organization, Osa binds Chip and modulates the expression of Ap target genes (Milán et al. 2004). Several transcription factors involved in other signaling pathways during wing development have also been shown to act as Bx1 suppressors, suggesting that Notch and these pathways share common elements or that these pathways collaborate with Notch in boundary formation. The finding of genes encoding for proteins that participate in distinct aspects of vesicle trafficking and membrane fusion indicates that the sorting of sufficient levels of certain molecules, including Notch and its ligand Delta, toward the plasma membrane is especially critical to reach appropriate levels of Notch activity at the DV boundary. Consistent with this, it is interesting to note that overexpression of these genes in an otherwise wild-type background does not show any overt wing phenotype, suggesting that the activity of the Notch pathway is finely regulated and buffered during boundary formation (Rulifson et al. 1996; Herranz et al. 2006).

The screen was designed and performed to find new genes involved in Ap and/or dLMO activity, as well as new Ap target genes involved in DV boundary formation. Although genes known to participate in DV boundary formation, like fringe or osa, were scored several times, we did not identify new transmembrane proteins or cell adhesion molecules involved in the generation of an affinity difference between D and V cells. P elements are known for their preferential insertion in certain regions of the genome called hot spots. The gene or genes involved in this process might be located in the so-called cold spots, thus suggesting that a distinct transposable element, like the lepidopteran piggyBac, with a different profile of hot spots and cold spots (Thibault et al. 2004), is a good candidate to search, on a similar suppressor gain-of-function basis, for thesekind of genes.

Acknowledgments

We thank S. Cohen, in whose lab this project was started, and G. Broenner, S. Cohen, J.C. Eissenberg, E. Hafen, B. Hay, N. Paricio, the Bloomington Stock Center, and the Developmental Hybridoma Bank for reagents. We thank A. Olza for technical help, and J. Brennecke for providing us with unpublished reagents. We thank two anonymous reviewers for their comments, which helped to improve the final version of the manuscript. Work in M.M.'s laboratory is funded by a grant from the Dirección General de Investigación Científica y Técnica (BFU2004-00167/BMC), a European Union research contract LSHM-CP-2003-503330 (APOPIS), a grant from the Generalitat de Catalunya (2005 SGR 00118), and Institute for Research in Biomedicine intramural funds.

References

  1. Adachi-Yamada, T., K. Fujimura-Kamada, Y. Nishida and K. Matsumoto, 1999. Distortion of proximodistal information causes JNK-dependent apoptosis in Drosophila wing. Nature 400: 166–169. [DOI] [PubMed] [Google Scholar]
  2. Aurora, K., H. Dai, S. G. Kazuko, J. Jamal, M. B. O'Connor et al., 1995. The Drosophila schnurri gene acts in the Dpp/TGFβ signalling pathway and encodes a transcription factor homologous to the human MBP family. Cell 81: 781–790. [DOI] [PubMed] [Google Scholar]
  3. Bang, A. G., A. M. Bailey and J. W. Posakony, 1995. Hairless promotes stable commitment to the sensory organ precursor cell fate by negatively regulating the activity of the Notch signaling pathway. Dev. Biol. 172: 479–494. [DOI] [PubMed] [Google Scholar]
  4. Barabasi, A. L., and Z. N. Oltvai, 2004. Network biology: understanding the cell's functional organization. Nat. Rev. Genet. 5: 101–113. [DOI] [PubMed] [Google Scholar]
  5. Bejarano, F., L. Perez, Y. Apidianakis, C. Delidakis and M. Milán, 2007. Hedgehog restricts its expression domain in the Drosophila wing. EMBO Rep. 8: 778–783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Benton, R., I. M. Palacios and D. St Johnston, 2002. Drosophila 14–3-3/PAR-5 is an essential mediator of PAR-1 function in axis formation. Dev. Cell 3: 659–671. [DOI] [PubMed] [Google Scholar]
  7. Bray, S. J., 1997. Expression and function of Enhancer of split bHLH proteins during Drosophila neurogenesis. Perspect. Dev. Neurobiol. 4: 313–323. [PubMed] [Google Scholar]
  8. Brennecke, J., D. R. Hipfner, A. Stark, R. B. Russell and S. M. Cohen, 2003. bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 113: 25–36. [DOI] [PubMed] [Google Scholar]
  9. Bruckner, K., L. Perez, H. Clausen and S. Cohen, 2000. Glycosyltransferase activity of Fringe modulates Notch-Delta interactions. Nature 406: 411–415. [DOI] [PubMed] [Google Scholar]
  10. Calgaro, S., M. Boube, D. L. Cribbs and H. M. Bourbon, 2002. The Drosophila gene taranis encodes a novel trithorax group member potentially linked to the cell cycle regulatory apparatus. Genetics 160: 547–560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Collins, R. T., T. Furukawa, N. Tanese and J. E. Treisman, 1999. Osa associates with the Brahma chromatin remodeling complex and promotes the activation of some target genes. EMBO J 18: 7029–7040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. de Celis, J. F., and A. Garcia-Bellido, 1994. Modifications of Notch function by Abruptex mutations in Drosophila melanogaster. Genetics 136: 183–194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. de Celis, J. F., J. de Celis, P. Ligoxygakis, A. Preiss, C. Delidakis et al., 1996. a Functional relationships between Notch, Su(H) and the bHLH genes of the E(spl) complex: the E(spl) genes mediate only a subset of Notch activities during imaginal development. Development 122: 2719–2728. [DOI] [PubMed] [Google Scholar]
  14. de Celis, J. F., A. Garcia-Bellido and S. J. Bray, 1996. b Activation and function of Notch at the dorsal-ventral boundary of the wing imaginal disc. Development 122: 359–369. [DOI] [PubMed] [Google Scholar]
  15. de Celis, J. F., S. Bray and A. Garcia-Bellido, 1997. Notch signalling regulates veinlet expression and establishes boundaries between veins and interveins in the Drosophila wing. Development 124: 1919–1928. [DOI] [PubMed] [Google Scholar]
  16. Diaz-Benjumea, F. J., and S. M. Cohen, 1993. Interaction between dorsal and ventral cells in the imaginal disc directs wing development in Drosophila. Cell 75: 741–752. [DOI] [PubMed] [Google Scholar]
  17. Diaz-Benjumea, F. J., and S. M. Cohen, 1995. Serrate signals through Notch to establish a Wingless-dependent organizer at the dorsal/ventral compartment boundary of the Drosophila wing. Development 121: 4215–4225. [DOI] [PubMed] [Google Scholar]
  18. Doherty, D., G. Fenger, S. Younger-Shepherd, L.-Y. Jan and Y.-N. Jan, 1996. Dorsal and ventral cells respond differently to the Notch ligands Delta and Serrate during Drosophila wing development. Genes Dev. 10: 421–434. [DOI] [PubMed] [Google Scholar]
  19. Eissenberg, J. C., J. Ma, M. A. Gerber, A. Christensen, J. A. Kennison et al., 2002. dELL is an essential RNA polymerase II elongation factor with a general role in development. Proc. Natl. Acad. Sci. USA 99: 9894–9899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Emery, G., A. Hutterer, D. Berdnik, B. Mayer, F. Wirtz-Peitz et al., 2005. Asymmetric Rab 11 endosomes regulate delta recycling and specify cell fate in the Drosophila nervous system. Cell 122: 763–773. [DOI] [PubMed] [Google Scholar]
  21. Fan, H., K. Sakuraba, A. Komuro, S. Kato, F. Harada et al., 2003. PCIF1, a novel human WW domain-containing protein, interacts with the phosphorylated RNA polymerase II. Biochem. Biophys. Res. Commun. 301: 378–385. [DOI] [PubMed] [Google Scholar]
  22. Fernandez-Funez, P., C. H. Lu, D. E. Rincon-Limas, A. Gárcia-Bellido and J. Botas, 1998. The relative expression amounts of apterous and its co-factor dLdb/Chip are critical for dorso-ventral compartmentalization in the Drosophila wing. EMBO J. 17: 6846–6853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Friedman, A., and N. Perrimon, 2007. Genetic screening for signal transduction in the era of network biology. Cell 128: 225–231. [DOI] [PubMed] [Google Scholar]
  24. Funakoshi, Y., M. Minami and T. Tabata, 2001. mtv shapes the activity gradient of the Dpp morphogen through regulation of thickveins. Development 128: 67–74. [DOI] [PubMed] [Google Scholar]
  25. García-Bellido, A., and P. Santamaria, 1972. Developmental analysis of the wing disc in the mutant engrailed of Drosophila melanogaster. Genetics 72: 87–104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. García-Bellido, A., P. Ripoll and G. Morata, 1973. Developmental compartmentalisation of the wing disk of Drosophila. Nat. New Biol. 245: 251–253. [DOI] [PubMed] [Google Scholar]
  27. Giot, L., J. S. Bader, C. Brouwer, A. Chaudhuri, B. Kuang et al., 2003. A protein interaction map of Drosophila melanogaster. Science 302: 1727–1736. [DOI] [PubMed] [Google Scholar]
  28. Giraldez, A. J., and S. M. Cohen, 2003. Wingless and Notch signaling provide cell survival cues and control cell proliferation during wing development. Development 130: 6533–6543. [DOI] [PubMed] [Google Scholar]
  29. Gonzalez-Gaitan, M., 2003. Signal dispersal and transduction through the endocytic pathway. Nat. Rev. Mol. Cell Biol. 4: 213–224. [DOI] [PubMed] [Google Scholar]
  30. Greider, N. C., D. Nellen, R. Burke, K. Basler and M. Affolter, 1995. schnurri is required for Drosophila Dpp signalling and encodes a zinc finger protein similar to the mammalian transcription factor PRDII-BF1. Cell 81: 791–800. [DOI] [PubMed] [Google Scholar]
  31. Grienenberger, A., B. Miotto, T. Sagnier, G. Cavalli, V. Schramke et al., 2002. The MYST domain acetyltransferase Chameau functions in epigenetic mechanisms of transcriptional repression. Curr. Biol. 12: 762–766. [DOI] [PubMed] [Google Scholar]
  32. Grun, D., Y. L. Wang, D. Langenberger, K. C. Gunsalus and N. Rajewsky, 2005. microRNA target predictions across seven Drosophila species and comparison to mammalian targets. PLoS Comput. Biol. 1: e13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Harder, T., and K. Simons, 1997. Caveolae, DIGs, and the dynamics of sphingolipid-cholesterol microdomains. Curr. Opin. Cell Biol. 9: 534–542. [DOI] [PubMed] [Google Scholar]
  34. Hay, B. A., D. A. Wassarman and G. M. Rubin, 1995. Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death. Cell 83: 1253–1262. [DOI] [PubMed] [Google Scholar]
  35. Heitzler, P., and P. Simpson, 1991. The choice of cell fate in the epidermis of Drosophila. Cell 64: 1083–1092. [DOI] [PubMed] [Google Scholar]
  36. Heitzler, P., L. Vanolst, I. Biryukova and P. Ramain, 2003. Enhancer-promoter communication mediated by Chip during Pannier-driven proneural patterning is regulated by Osa. Genes Dev. 17: 591–596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Herranz, H., E. Stamataki, F. Feiguin and M. Milán, 2006. Self-refinement of Notch activity through the transmembrane protein Crumbs: modulation of gamma-secretase activity. EMBO Rep. 7: 297–302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Hickson, G. R., J. Matheson, B. Riggs, V. H. Maier, A. B. Fielding et al., 2003. Arfophilins are dual Arf/Rab 11 binding proteins that regulate recycling endosome distribution and are related to Drosophila nuclear fallout. Mol. Biol. Cell 14: 2908–2920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Hsu, T., and R. A. Schulz, 2000. Sequence and functional properties of Ets genes in the model organism Drosophila. Oncogene 19: 6409–6416. [DOI] [PubMed] [Google Scholar]
  40. Irvine, K., and E. Wieschaus, 1994. fringe, a boundary specific signalling molecule, mediates interactions between dorsal and ventral cells during Drosophila wing development. Cell 79: 595–606. [DOI] [PubMed] [Google Scholar]
  41. Irvine, K. D., and C. Rauskolb, 2001. Boundaries in development: formation and function. Annu. Rev. Cell Dev. Biol. 17: 189–214. [DOI] [PubMed] [Google Scholar]
  42. Jahn, R., and R. H. Scheller, 2006. SNAREs engines for membrane fusion. Nat. Rev. Mol. Cell Biol. 7: 631–643. [DOI] [PubMed] [Google Scholar]
  43. Janody, F., Z. Martirosyan, A. Benlali and J. E. Treisman, 2003. Two subunits of the Drosophila mediator complex act together to control cell affinity. Development 130: 3691–3701. [DOI] [PubMed] [Google Scholar]
  44. Kennison, J. A., and J. W. Tamkun, 1988. Dosage-dependent modifiers of polycomb and antennapedia mutations in Drosophila. Proc. Natl. Acad. Sci. USA 85: 8136–8140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Lawrence, P. A., and G. Morata, 1976. Compartments in the wing of Drosophila: a study of the engrailed gene. Dev. Biol. 50: 321–337. [DOI] [PubMed] [Google Scholar]
  46. Matsuno, K., R. J. Diederich, M. J. Go, C. M. Blaumueller and S. Artavanis-Tsakonas, 1995. Deltex acts as a positive regulator of Notch signaling through interactions with the Notch ankyrin repeats. Development 121: 2633–2644. [DOI] [PubMed] [Google Scholar]
  47. Milán, M., and S. M. Cohen, 1999. Regulation of LIM homeodomain activity in vivo: a tetramer of dLDB and apterous confers activity and capacity for regulation by dLMO. Mol. Cell 4: 267–273. [DOI] [PubMed] [Google Scholar]
  48. Milán, M., and S. M. Cohen, 2000. Temporal regulation of apterous activity during development of the Drosophila wing. Development 127: 3069–3078. [DOI] [PubMed] [Google Scholar]
  49. Milán, M., and S. M. Cohen, 2003. A re-evaluation of the contributions of Apterous and Notch to the dorsoventral lineage restriction boundary in the Drosophila wing. Development 130: 553–562. [DOI] [PubMed] [Google Scholar]
  50. Milán, M., S. Campuzano and A. Garcia-Bellído, 1996. Cell-cycling and patterned cell proliferation in the wing primordium of Drosophila. Proc. Natl. Acad. Sci. USA 93: 640–645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Milán, M., F. J. Diaz-Benjumea and S. M. Cohen, 1998. Beadex encodes an LMO protein that regulates Apterous LIM-homeodomain activity in Drosophila wing development: a model for LMO oncogene function. Genes Dev. 12: 2912–2920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Milán, M., U. Weihe, L. Perez and S. M. Cohen, 2001. a The LRR proteins capricious and Tartan mediate cell interactions during DV boundary formation in the Drosophila wing. Cell 106: 785–794. [DOI] [PubMed] [Google Scholar]
  53. Milán, M., U. Weihe, S. Tiong, W. Bender and S. M. Cohen, 2001. b msh specifies dorsal cell fate in the Drosophila wing. Development 128: 3263–3268. [DOI] [PubMed] [Google Scholar]
  54. Milán, M., T. T. Pham and S. M. Cohen, 2004. Osa modulates the expression of Apterous target genes in the Drosophila wing. Mech. Dev. 121: 491–497. [DOI] [PubMed] [Google Scholar]
  55. Moloney, D. J., 2000. Fringe is a glycosyltransferase that modifies Notch. Nature 406: 357–358. [DOI] [PubMed] [Google Scholar]
  56. Muñoz-Descalzo, S., J. Terol and N. Paricio, 2005. Cabut, a C2H2 zinc finger transcription factor, is required during Drosophila dorsal closure downstream of JNK signaling. Dev. Biol. 287: 168–179. [DOI] [PubMed] [Google Scholar]
  57. Munro, S., and M. Freeman, 2000. The notch signalling regulator fringe acts in the Golgi apparatus and requires the glycosyltransferase signature motif DXD. Curr. Biol. 10: 813–820. [DOI] [PubMed] [Google Scholar]
  58. Nairz, K., C. Rottig, F. Rintelen, E. Zdobnov, M. Moser et al., 2006. Overgrowth caused by misexpression of a microRNA with dispensable wild-type function. Dev. Biol. 291: 314–324. [DOI] [PubMed] [Google Scholar]
  59. Norga, K. K., M. C. Gurganus, C. L. Dilda, A. Yamamoto, R. F. Lyman et al., 2003. Quantitative analysis of bristle number in Drosophila mutants identifies genes involved in neural development. Curr. Biol. 13: 1388–1396. [DOI] [PubMed] [Google Scholar]
  60. Perez, L., M. Milán, S. Bray and S. M. Cohen, 2005. Ligand-binding and signaling properties of the Ax[M1] form of Notch. Mech. Dev. 122: 479–486. [DOI] [PubMed] [Google Scholar]
  61. Pfeffer, S., and D. Aivazian, 2004. Targeting Rab GTPases to distinct membrane compartments. Nat. Rev. Mol. Cell Biol. 5: 886–896. [DOI] [PubMed] [Google Scholar]
  62. Robey, E., 1997. Notch in vertebrates. Curr. Opin. Genet. Dev. 7: 551–557. [DOI] [PubMed] [Google Scholar]
  63. Roch, F., G. Jimenez and J. Casanova, 2002. EGFR signalling inhibits Capicua-dependent repression during specification of Drosophila wing veins. Development 129: 993–1002. [DOI] [PubMed] [Google Scholar]
  64. Rorth, P., K. Szabo, A. Bailey, T. Laverty, J. Rehm et al., 1998. Systematic gain-of-function genetics in Drosophila. Development 125: 1049–1057. [DOI] [PubMed] [Google Scholar]
  65. Rulifson, E. J., C. A. Micchelli, J. D. Axelrod, N. Perrimon and S. S. Blair, 1996. wingless refines its own expression domain on the Drosophila wing margin. Nature 384: 72–74. [DOI] [PubMed] [Google Scholar]
  66. Scholz, H., J. Deatrick, A. Klaes and C. Klambt, 1993. Genetic dissection of pointed, a Drosophila gene encoding two ETS-related proteins. Genetics 135: 455–468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Shoresh, M., S. Orgad, O. Shmueli, R. Werczberger, D. Gelbaum et al., 1998. Overexpression Beadex mutations and loss-of-function heldup-a mutations in Drosophila affect the 3′ regulatory and coding components, respectively, of the Dlmo gene. Genetics 150: 283–299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Stark, A., J. Brennecke, R. B. Russell and S. M. Cohen, 2003. Identification of Drosophila microRNA targets. PLoS Biol. 1: E60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Stelling, J., U. Sauer, Z. Szallasi, F. J. Doyle, 3rd and J. Doyle, 2004. Robustness of cellular functions. Cell 118: 675–685. [DOI] [PubMed] [Google Scholar]
  70. Stewart, B. A., M. Mohtashami, L. Zhou, W. S. Trimble and G. L. Boulianne, 2001. SNARE-dependent signaling at the Drosophila wing margin. Dev. Biol. 234: 13–23. [DOI] [PubMed] [Google Scholar]
  71. Su, M. A., R. G. Wisotzkey and S. J. Newfeld, 2001. A screen for modifiers of decapentaplegic mutant phenotypes identifies lilliputian, the only member of the Fragile-X/Burkitt's lymphoma family of transcription factors in Drosophila melanogaster. Genetics 157: 717–725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Tabata, T., C. Schwartz, E. Gustavson, Z. Ali and T. B. Kornberg, 1995. Creating a Drosophila wing de novo: the role of engrailed and the compartment border hypothesis. Development 121: 3359–3369. [DOI] [PubMed] [Google Scholar]
  73. Thibault, S. T., M. A. Singer, W. Y. Miyazaki, B. Milash, N. A. Dompe et al., 2004. A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac. Nat. Genet. 36: 283–287. [DOI] [PubMed] [Google Scholar]
  74. Toba, G., T. Ohsako, N. Miyata, T. Ohtsuka, K. H. Seong et al., 1999. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics 151: 725–737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Tsai, L. T., R. J. Bainton, J. Blau and U. Heberlein, 2004. Lmo mutants reveal a novel role for circadian pacemaker neurons in cocaine-induced behaviors. PLoS Biol. 2: e408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. van Meyel, D. J., D. D. O'Keefe, L. W. Jurata, S. Thor, G. N. Gill et al., 1999. Chip and apterous physically interact to form a functional complex during Drosophila development. Mol. Cell 4: 259–265. [DOI] [PubMed] [Google Scholar]
  77. Wang, S. L., C. J. Hawkins, S. J. Yoo, H. A. Muller and B. A. Hay, 1999. The Drosophila caspase inhibitor DIAP1 is essential for cell survival and is negatively regulated by HID. Cell 98: 453–463. [DOI] [PubMed] [Google Scholar]
  78. Wang, S. H., A. Simcox and G. Campbell, 2000. Dual role for Drosophila epidermal growth factor receptor signaling in early wing disc development. Genes Dev. 14: 2271–2276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Wittwer, F., A. van der Straten, K. Keleman, B. J. Dickson and E. Hafen, 2001. Lilliputian: an AF4/FMR2-related protein that controls cell identity and cell growth. Development 128: 791–800. [DOI] [PubMed] [Google Scholar]
  80. Xu, P., S. Y. Vernooy, M. Guo and B. A. Hay, 2003. The Drosophila microRNA Mir-14 suppresses cell death and is required for normal fat metabolism. Curr. Biol. 13: 790–795. [DOI] [PubMed] [Google Scholar]
  81. Ye, Y., and M. E. Fortini, 1999. Apoptotic activities of wild-type and Alzheimer's disease-related mutant presenilins in Drosophila melanogaster. J. Cell Biol. 146: 1351–1364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Zecca, M., K. Basler and G. Struhl, 1995. Sequential organizing activities of engrailed, hedgehog and decapentaplegic in the Drosophila wing. Development 121: 2265–2278. [DOI] [PubMed] [Google Scholar]
  83. Zecca, M., and G. Struhl, 2002. Subdivision of the Drosophila wing imaginal disc by EGFR-mediated signaling. Development 129: 1357–1368. [DOI] [PubMed] [Google Scholar]
  84. Zeng, C., N. J. Justice, S. Abdelilah, Y. M. Chan, L. Y. Jan et al., 1998. The Drosophila LIM-only gene, dLMO, is mutated in Beadex alleles and might represent an evolutionarily conserved function in appendage development. Proc. Natl. Acad. Sci. USA 95: 10637–10642. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Genetics are provided here courtesy of Oxford University Press

RESOURCES