Skip to main content
PMC home page
UKPMC Funders Author Manuscripts logoLink to UKPMC Funders Author Manuscripts
. Author manuscript; available in PMC: 2008 Jan 22.
Published in final edited form as: Br J Nutr. 2007 Mar;97(3):435–439. doi: 10.1017/S0007114507352392

Dietary protein restriction of pregnant rats in the F0 generation induces altered methylation of hepatic gene promoters in the adult male offspring in the F1 and F2 generations

Graham C Burdge 1,*, Jo Slater-Jefferies 1, Christopher Torrens 1, Emma S Phillips 2, Mark A Hanson 1, Karen A Lillycrop 1
PMCID: PMC2211514  EMSID: UKMS1427  PMID: 17313703

Abstract

Epidemiological studies and experimental models show that maternal nutritional constraint during pregnancy alters the metabolic phenotype of the offspring and that this can be passed to subsequent generations. In the rat, induction of an altered metabolic phenotype in the liver of the F1 generation by feeding a protein-restricted diet (PRD) during pregnancy involves altered methylation of specific gene promoters. We therefore investigated whether altered methylation of peroxisomal proliferator-activated receptor (PPARα) and glucocorticoid receptor (GR) promoters is passed to the F2 generation. Females rats (F0) were fed a reference diet (RD, 18% protein) or PRD (9% protein) throughout gestation, and AIN76A during lactation. F1 offspring were weaned onto AIN76A. F1 females were mated and fed AIN76A throughout pregnancy and lactation. F1 and F2 males were killed on postnatal d 80. Hepatic PPARα and GR promoter methylation was significantly (P<0.05) lower in the PRD group in the F1 (PPARα 8%; GR 10%) and F2 (PPARα 11%; GR 8%) generations. There were trends (P<0.1) towards higher expression of PPARα, GR, acyl-CoA oxidase and phosphoenolpyruvate carboxykinase (PEPCK) in the F1 and F2 males, although this was only significant for PEPCK. These data show for the first time that altered methylation of gene promoters induced in the F1 generation by maternal protein-restriction during pregnancy is transmitted to the F2 generation. This may represent a mechanism for the transmission of induced phenotypes between generations.

Keywords: Fetal programming, transgeneration, epigenetic, liver

Introduction

Developmental plasticity allows the generation of a number of phenotypes from a single genotype (Gluckman & Hanson, 2004a). Epidemiological (Godfrey & Barker, 2001) and experimental studies (Bertram & Hanson, 2002) show that aspects of the prenatal environment such as maternal nutrition and stress levels provide cues which modify the phenotype of the offspring without overt reductions in fetal growth. Such nutritional cues operate within the normal range for the human population and contribute to the early life origins of risk of chronic diseases such as the metabolic syndrome (Godfrey & Barker, 2002).

There is evidence in humans and in experimental models for non-genomic transmission between generations of induced phenotypic traits associated with impaired capacity to maintain energy balance. Diabetes mortality was increased in men if the paternal grandfather was exposed to abundant nutrition during puberty (Pembrery et al., 2006). The daughters of women exposed to nutrient-restriction and environmental stress during pregnancy as a result of the Dutch Hunger Winter showed decreased birthweight and increased risk of insulin resistance, while their daughters also were born with a lower birthweight (Stein & Lumey, 2000; Painter et al. 2005). In rats, feeding a protein-restricted diet (PRD) during pregnancy in the F0 generation resulted in elevated blood pressure and endothelial dysfunction (Torrens et al. 2002) and insulin resistance (Martin et al. 2000; Zambrano et al. 2005) in the F1 and F2 generations, despite normal nutrition during pregnancy in the F1 generation. The adverse effects on glucose homeostasis of feeding a PRD during pregnancy in the F0 generation have been found in the F3 generation (Benyshek et al. 2006). Administration of dexamethasone to dams in late pregnancy induced increased expression of the glucocorticoid receptor (GR) and its target gene phosphoenolpyruvate carboxykinase (PEPCK) in the liver of the F1 and F2 offspring (Drake et al. 2005). This effect was transmitted through both male and female F1 lines. However, these changes in gene expression were not present in the F3 generation.

The mechanism for transgenerational transmission of induced phenotypes is not known. Stable changes to gene expression which underlie individual phenotypes are the result of the epigenetic regulation of transcription which includes DNA methylation and covalent modifications to histones. Methylation of cytosines in CpG dinucleotides in the promoter region of genes permanently suppresses transcription (Bird, 2002). Soon after fertilization, the genome undergoes demethylation. This is followed by the methylation of the promoters of specific genes in the early embryo (Bird, 2002). Such epigenetic gene silencing is critical for cellular differentiation and is maintained throughout the lifespan. Allele-specific silencing of imprinted genes by DNA methylation is well established (Arnaud & Feil, 2005; Lander-Diner & Cedar, 2005) and methylation patterns are resistant to demethylation during the early development of the embryo, although the underlying mechanism is unclear (Lane et al. 2003). We have shown recently that feeding a PRD to pregnant rats resulted in hypomethylation and increased expression of the peroxisomal proliferator-activated receptor (PPAR) -α and GR110 promoters in the liver of the offspring on postnatal d 34 (Lillycrop et al. 2005). This shows that induction of different metabolic phenotypes in the offspring by maternal nutrition during pregnancy in non-imprinted genes also involves altered epigenetic regulation of gene expression. Moreover, in our previous study this epigenetic change in the PPARα and GR promoters was prevented by supplementation of the PR diet with folic acid during pregnancy (Lillycrop et al. 2005), which suggests that altered 1-carbon metabolism is involved in the process of inducing altered DNA methylation.

In the present study, we have tested the hypothesis that transmission of phenotypes between the F1 and F2 generations involves altered epigenetic regulation of specific genes. We report the effect of feeding a PRD during pregnancy in the F0 generation on the methylation status and expression of the GR and PPARα promoters, and on the expression of their respective target genes PEPCK and acyl-CoA oxidase (AOX) in the liver of the F1 and F2 offspring.

Materials and methods

Animal procedures

Female Wister rats (F0) were mated and then fed throughout pregnancy either a reference diet (RD) containing 18% (w/w) casein or an isocaloric protein-restricted diet (PRD) containing 9% (w/w) casein as described (Langley & Jackson, 1994) (Table 1). At delivery, litters were reduced to 8 pups. Dams were fed purified AIN76A diet throughout lactation (Table 1). Offspring were weaned onto AIN76A 28 days after birth. Male offspring (F1) were killed at postnatal d 80. Livers were removed immediately, frozen in liquid nitrogen and stored at −80°C. Two female F1 offspring were selected from each litter by random removal from the cage and mated at postnatal d 125 with males which had received adequate nutrition throughout life. F1 females were fed AIN76A (Table 1) throughout pregnancy and lactation. Litters were reduced to 8 at birth and the F2 offspring were weaned at postnatal day 28. Male offspring were killed at postnatal d 80. Livers were removed immediately, frozen in liquid nitrogen and stored at −80°C. Livers were selected at random for studies of gene methylation and expression by removal from collections of stored specimens without knowledge of any aspect of the phenotype of the offspring. Liver from one offspring was studied from each litter.

Table 1.

Composition of the diets fed

F0 pregnancy diets Diet fed to F0 dams during lactation and to F1 and F2 offspring
RD PRD AIN-76A
Casein (g/kg) 180 90 200
Folic acid (mg/kg) 1 1 2
Cornstarch (g/kg) 425 482 150
Sucrose (g/kg) 213 243 500
Choline chloride (g/kg) 2 2 2
DL-methionine (g/kg) 5 5 3
Vitamin mix1 (g/kg) 5 5 5
Mineral mix2 (g/kg) 20 20 20
Cellulose (g/kg) 50 50 50
Corn oil (g/kg) 100 100 50
Total metabolisable energy (MJ/kg) 20.2 19.9 15.5
Open in a new tab
1

Vitamin mix: Thiamine hydrochloride 2.4 mg/kg; riboflavin 2.4 mg/kg; pyridoxine hydrochloride 2.8 mg/kg; nicotinic acid 12.0 mg/kg; D-calcium pantothenate 6.4 mg/kg; biotin 0.01 mg/kg; cyanocobalbumin 0.003 mg/kg; retinyl palmitate 6.4 mg/kg; DL-_-tocopherol acetate 79.9 mg/kg; cholecalciferol 1.0 g/kg; menaquinone 0.02 mg/kg.

2

Mineral mix: Calcium phosphate dibasic 11.3 g/kg; sodium chloride 1.7 g/kg; potassium citrate monohydrate 5.0 g/kg; potassium sulphate 1.2 g/kg; magnesium sulphate 0.5 g/kg; magnesium carbonate 0.1 g/kg; ferric citrate 0.1 g/kg; zinc carbonate 36.2 mg/kg; cupric carbonate 6.8 mg/kg; potassium iodate 0.2 mg/kg; sodium selenite 0.2 mg/kg; chromium potassium sulphate 12.5 mg/kg.

Measurement of DNA methylation

The methylation status of the GR110 and PPARα promoters was determined by methylation-sensitive real-time PCR (Lillycrop et al. 2005). Briefly, genomic DNA (5 μg) was isolated from liver using by standard methods and treated with the methylation-sensitive restriction enzymes AciI and HpaII as instructed by the manufacturer (New England Biolabs (UK), Hitchin, Hertfordshire, UK). Purified DNA was then amplified using real-time PCR using primers listed in table 2. The reaction volume was carried out in a total volume of 25 μL with SYBR® Green Jumpstart ready mix as described by the manufacturer (Sigma, Poole, Dorset, UK). The promoter region of the rat PPARγ2 gene, which contains no CpG islands and no AciI or HpaII recognition sites, was used as an internal control. There was no effect of maternal diet or generation on the methylation status of the hepatic PPARγ2 promoter. All Ct values were normalized to the internal control.

Table 2.

PCR primers for analysis of promoter methylation and mRNA expression

Gene Forward primer Reverse primer
Methylation-sensitive PCR
GR110 TCCTCCATTTTTGCGAGCTC CCACCGCAGCCAGATAAAC
PPAR-γ2 GTCTCTGCTCTGGTAATTC AAGGCTTGTGGTCATTGAG
PPARα CGACTGTGAGGAGCAAGG CCCAGGTCTCTTCTTCAG
mRNA expression
GR110 TGACTTCCTTCTCCGTGACA GGAGAATCCTCTGCTGCTTG
PPARα CTGGTCAAGCTCAGGACACA AAACGGATTGCATTGTGTGA
AOX CCAATCACGCAATAGTTCTGG CGCTGTATCGTATGGCGAT
PEPCK AGCTGCATAATGGTCTGG GAACCTGGCGTTGAATGC
Ribosomal 18S GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGTAGCG
Open in a new tab

AOX, acyl-CoA oxidase; GR110, glucocorticoid receptor; PEPCK, phosphoenolpyruvate carboxykinase; PPARα, peroxisomal proliferator-activated receptor-α.

†

Primers designed by QIAGEN Ltd UK, Crawley, UK.

Measurement of mRNA expression

mRNA Expression was determined by real-time RTPCR amplification (Harris et al. 2002). Briefly, total RNA was isolated from cells using TRIZOL reagent (InVitrogen, Paisley, Scotland,UK), and 0.1 μg was used as a template to prepare cDNA using 100 U Moloney-Murine Leukemia Virus reverse transcriptase. Primer sequences are listed in table 2. The PCR reaction was carried out in a total volume of 25 μL with SYBR® Green Jumpstart ready mix as described by the manufacturer (Sigma). mRNA expression was normalized using the housekeeping gene ribosomal 18S RNA using the ΔCt method (Bustin, 2000). There was no effect of maternal diet or generation on the mRNA expression of 18S ribosomal RNA.

Statistical comparisons

Normalised Ct values are presented as proportion of the RD group in the F1 generation (Mean (SEM), n 6 offspring per F0 dietary group, 1 offspring per litter). Analysis of the covariate by independent variable interaction showed that the homogeneity of the regression slopes could be assumed for each of the genes studied. Therefore, ANOVA was used to assess the effects of diet and generation on promoter methylation status and mRNA expression. The extent of interactions between the diet of the F0 dams and the generation of offspring was determined by 2-way ANOVA. Comparisons of DNA methylation and mRNA expression between F0 dietary groups and generations of offspring were by 1-way ANOVA with Dunnett’s post hoc test (2-sided) using the RD F1 group as reference.

Results

DNA methylation

The results of measurements of the methylation status of the GR110 promoter which is expressed in liver and of the PPARα promoter are summarised in figure 1. Analysis by 2way ANOVA showed that there was no significant effect of generation or interaction between F0 diet and generation on the methylation of the GR110 or PPARα promoters. However, there was a significant effect of diet (P<0.001) on the methylation status of both genes. Methylation of the GR110 promoter was significantly lower (P<0.05) in the liver of the male offspring of the F0 PRD group in the F1 (10.2 %) and F2 (7.9 %) generations compared to the F0 RD group. Methylation of the PPARα promoter was significantly lower in the liver of the males offspring of the F0 PRD group in the F1 (8.2%) and F2 (10.5 %) generations compared to the F0 RD group. There were no significant differences between F1 and F2 generations within a F0 maternal dietary group.

Fig. 1.

Fig. 1

Open in a new tab

Effect of maternal protein intake during pregnancy in the F0 generation on hepatic (A) PPARα and (B) glucocorticoid receptor promoter methylation in the F1 and F2 male offspring. Values are mean (SEM) normalized to the offspring of the F1 RD group (n 6 per group). * Indicates values significantly different (P<0.05) between maternal diets within a generation by 1-way ANOVA with Dunnett’s post hoc test (2-sided) using the RD F1 group as reference. PRD, protein-restricted diet; RD, reference diet.

mRNA expression

The results of measurements of mRNA expression are summarised in table 3. Analysis by 2-way ANOVA showed that there was no significant interaction effect between generation and F0 dietary group on the expression of any of the genes measured. Analysis by 1-way ANOVA showed that there were no significant differences in the expression of any of these genes between F1 and F2 generations with a F0 maternal dietary group. There was no significant effect of F0 maternal diet on the expression of PPARα or GR110 in the F1 or F2 generations, although there were trends (P<0.1) towards higher mRNA expression in the PRD group in the F1 (29% and 15%, respectively) and F2 (44% and 31%, respectively) compared to the F1 RD group. 2-way ANOVA showed that there was a significant effect of the F0 maternal diet on the expression of AOX (P = 0.016) and PEPCK (P = 0.006). For AOX, 1-way ANOVA showed a significant difference between groups although this did not reach statistical significance in pair-wise comparisons. However, there were trends (ANOVA P<0.05) towards higher AOX mRNA expression in the PRD group in the F1 (65%) and F2 (105%) generations although these did not reach statistical significance in pair wise comparisons (Table 3). PEPCK expression was significantly (P<0.05) greater in the PRD group in the F1 (59%) and the F2 (73%) generations (Table 3).

Table 3.

Measurements of hepatic mRNA expression

mRNA expression (%, compared to F1 RD group)
F1 F2
RD PRD RD PRD
Mean SEM Mean SEM Mean SEM Mean SEM ANOVA
PPARα 100.0 15.0 129.4 15.8 106.2 5.1 143.8 33.2 0.093
GR110 100.0 24.0 115.0 18.2 105.6 14.4 130.9 24.4 0.080
AOX 100.0 14.0 164.8 7.6 101.2 19.8 204.6 37.3 0.039
PEPCK 100.0 16.0 158.7* 14.9 107.4 6.4 172.8* 13.2 0.023
Open in a new tab

Values are mean (SEM) for n 6 male offspring in each F0 dietary group in each generation.

*

Indicates values significantly different (p<0.05) between maternal diets within a generation by 1-way ANOVA with Dunnett’s post hoc test (2-sided) using the RD F1 group as reference.

AOX, acyl-CoA oxidase; GR110, glucocorticoid receptor; PEPCK, phosphoenolpyruvate carboxykinase; PPARα, peroxisomal proliferator-activated receptor-α; PRD, protein-restricted diet; RD, reference diet; NS, not statistically significant.

Discussion

The results of this study show for the first time that altered methylation of gene promoters induced in the F1 offspring by maternal protein-restriction during pregnancy is transmitted to the F2 offspring.

The majority of studies on the induction of an altered metabolic phenotype by maternal dietary restriction in humans and in experimental models have focussed on the first generation offspring. However, there is evidence from epidemiological studies (Stein & Lumey, 2000; Painter et al. 2005) and in particular from animal models (Martin et al. 2000; Torrens et al. 2002; Zambrano et al. 2005; Benyshek et al. 2006) that the phenotype induced in the offspring of the F1 generation can be transmitted to subsequent generations. We have shown previously that increased expression of GR110 and PPARα in the liver of the offspring at postnatal d 34 as a result of feeding a PRD in pregnancy is due to hypomethylation of the respective gene promoters (Lillycrop et al. 2005). Our present findings show that the methylation status of the GR110 and PPARα promoters was reduced in the F1 and F2 offspring of the F0 PRD dams. One possible explanation is that the level of methylation of the GR110 and PPARα promoters was set during the development of the F1 generation and that this is maintained through gamete production, through demethylation of the maternal and paternal genomes after fertilization and during gene specific remethylation in the early embryo. If so, this implies that the process which results in hypomethylation of GR110 and PPARα in the liver also induces a stable reduction of the methylation of these genes in germ cells. Since the F1 females, but not the males with which they were mated, had been exposed to nutritional constraint during pregnancy, our findings suggest that transmission of GR110 and PPARα hypomethylation must have occurred via the female genome and that this was sufficient to alter the methylation of the promoters of these genes in the liver of the F2 males. Studies of the expression of intracisternal A-type particles (IAPs) show that the methylation of these repetitive sequences is resistant to demethylation during pre-implantation development and it has been suggested that such resistance may explain the inheritance of patterns of gene imprinting (Lane et al. 2003). If the level of methylation of non-imprinted genes was also ‘protected’ during post-fertilization demethylation this might explain how patterns of GR110 and PPARα methylation induced in the F1 generation may be transmitted to the F2 generation. One alternative explanation is that prenatal under-nutrition induced changes in the F1 females which constrained the intra-uterine environment experienced by the F2 male offspring, and that hypomethylation of the PPARα and GR110 promoters was thus induced de novo in the male offspring in each generation. This seems unlikely because of the similarity in the degree of hypomethylation induced in the F1 and F2 generations. It might be anticipated that if promoter hypomethylation was induced de novo in each generation, then it would result in different levels of methylation because of differences in the degree of environmental constraint. However, a single environmental challenge in the F0 generation may be expected to induce a similar level of promoter methylation in both generations if the effect on the F1 generation was transmitted to the F2 generation.

Feeding a PRD during pregnancy in the F0 generation induced a trend towards increased expression of PPARα and GR110, and their respective target genes AOX and PEPCK in the liver of the F1 and F2 offspring at d 80, although only the increase in PEPCK expression reached statistical significance. The trend in the expression is consistent with reduced methylation of the GR110 and PPARα promoters. We have shown previously that feeding a PRD during pregnancy significantly increased the expression of PPARα, GR110 and AOX in the liver of the F1 offspring at postnatal d 34 due to hypomethylation of the GR110 and PPARα promoters (Lillycrop et al. 2005) and others have shown increased gluconeogenesis in this model (Burns et al.1997). One possible explanation for the difference between our previous report (Lillycrop et al. 2005) and the present study in the extent to which hypomethylation of the GR and PPARα promoters altered the expression of GR110 and PPARα, and of their target genes AOX and PEPCK is that transcription of PPARα and GR is responsive to environmental stimuli such as dietary fat intake and stress, respectively. In the absence of a dietary or stress challenge, the elevated levels of transcription found in recently weaned animals (Lillycrop et al. 2005) may have diminished by d 80. For example, in the rat hepatic PPARα expression decreases after weaning due to the reduction in fat intake (Panadero et al. 2000). In addition, PPARα expression is less sensitive to dietary fat intake in adult liver compared to neonates (Panadero et al. 2005). Nevertheless, feeding the PRD diet to F0 dams induced in the F1 and F2 offspring the potential for an exaggerated response to stress or dietary fat.

These findings suggest that transmission of an altered metabolic phenotype as a result of prenatal nutritional constraint to at least one subsequent generation is the result of induction of altered epigenetic regulation of gene expression in both the F1 and F2 generations. This may also explain transmission of induced phenotypes from the F1 to F2 generations in other experimental systems such as increased hepatic GR expression and PEPCK activity as a result of exposure of the F0 dams to dexamethasone in late gestation (Drake et al. 2005). If this occurs in humans, as indicated by epidemiological studies (Stein & Lumey, 2000; Painter et al. 2005), the findings would suggest that nutrition of pregnant women has a critical impact not only on the health of their children, but also on subsequent generations.

Acknowledgements

Dr GC Burdge and Professor MA Hanson are supported by the British Heart Foundation who also funded part of this study.

References

  1. Arnaud P, Feil R. Epigenetic deregulation of genomic imprinting in human disorders and following assisted reproduction. Birth Defects Res (Part C) 2005;75:81–97. doi: 10.1002/bdrc.20039. [DOI] [PubMed] [Google Scholar]
  2. Benyshek DC, Johnston CS, Martin JF. Glucose metabolism is altered in the adequately-nourished grand-offspring (F(3) generation) of rats malnourished during gestation and perinatal life. Diabetologia. 2006;49:1117–1119. doi: 10.1007/s00125-006-0196-5. [DOI] [PubMed] [Google Scholar]
  3. Bird A. DNA methylation patterns and epigenetic memory. Genes Dev. 2002;16:6–21. doi: 10.1101/gad.947102. [DOI] [PubMed] [Google Scholar]
  4. Burns SP, Desai M, Cohen RD, Hales CN, Iles RA, Germain JP, Going TC, Bailey RA. Gluconeogenesis, glucose handling, and structural changes in livers of the adult offspring of rats partially deprived of protein during pregnancy and lactation. J Clin Invest. 1997;100:1768–1774. doi: 10.1172/JCI119703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol. 2000;25:169–193. doi: 10.1677/jme.0.0250169. [DOI] [PubMed] [Google Scholar]
  6. Drake AJ, Walker BR, Seckl JR. Intergenerational consequences of fetal programming by in utero exposure to glucocorticoids in rats. Am J Physiol. 2005;288:R34–R38. doi: 10.1152/ajpregu.00106.2004. [DOI] [PubMed] [Google Scholar]
  7. Bertram CE, Hanson MA. Prenatal programming of postnatal endocrine responses by glucocorticoids. Reproduction. 2002;124:459–467. doi: 10.1530/rep.0.1240459. [DOI] [PubMed] [Google Scholar]
  8. Drake AJ, Walker BR, Seckl JR. Intergenerational consequences of fetal programming by in utero exposure to glucocorticoids in rats. Am J Physiol. 2005;288:R34–R38. doi: 10.1152/ajpregu.00106.2004. [DOI] [PubMed] [Google Scholar]
  9. Gluckman PD, Hanson MA. The developmental origins of the metabolic syndrome. Trends Endocrinol Metab. 2004a;15:183–187. doi: 10.1016/j.tem.2004.03.002. [DOI] [PubMed] [Google Scholar]
  10. Gluckman PD, Hanson MA. Living with the past: evolution, development, and patterns of disease. Science. 2004b;305:1733–1736. doi: 10.1126/science.1095292. [DOI] [PubMed] [Google Scholar]
  11. Gluckman PD, Hanson MA, Spencer HG, Bateson P. Environmental influences during development and their later consequences for health and disease: implications for the interpretation of empirical studies. Proc R Soc B. 2005;272:671–677. doi: 10.1098/rspb.2004.3001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Godfrey KM, Barker DJ. Fetal programming and adult health. Public Health Nutr. 2001;4:611–624. doi: 10.1079/phn2001145. [DOI] [PubMed] [Google Scholar]
  13. Harris RG, White E, Phillips ES, Lillycrop KA. The expression of the developmentally regulated proto-oncogene Pax-3 is modulated by N-Myc. J Biol Chem. 2002;277:34815–34825. doi: 10.1074/jbc.M109609200. [DOI] [PubMed] [Google Scholar]
  14. Lander-Diner L, Cedar H. Silence of the genes - mechanisms of long-term repression. Nat Rev Genetics. 2005;6:648–654. doi: 10.1038/nrg1639. [DOI] [PubMed] [Google Scholar]
  15. Lane N, Dean W, Erhardt S, Hajkova P, Surani A, Walter J, Reik W. Resistance of IAPs to methylation reprogramming may provide a mechanism for epigenetic inheritance in the mouse. Genesis. 2003;35:88–93. doi: 10.1002/gene.10168. [DOI] [PubMed] [Google Scholar]
  16. Lillycrop KA, Phillips ES, Jackson AA, Hanson MA, Burdge GC. Dietary protein restriction of pregnant rats induces and folic acid supplementation prevents epigenetic modification of hepatic gene expression in the offspring. J Nutr. 2005;135:1382–1386. doi: 10.1093/jn/135.6.1382. [DOI] [PubMed] [Google Scholar]
  17. Martin JF, Johnston CS, Han C-H, Benyshek DC. Nutritional origins of insulin resistance: a rat model for diabetes-prone human populations. J Nutr. 2000;130:741–744. doi: 10.1093/jn/130.4.741. [DOI] [PubMed] [Google Scholar]
  18. Panadero M, Herrera E, Bocos C. Peroxisome proliferator-activated receptor-alpha expression in rat liver during postnatal development. Biochimie. 2000;82:723–726. doi: 10.1016/s0300-9084(00)01147-0. [DOI] [PubMed] [Google Scholar]
  19. Panadero M, Herrera E, Bocos C. Different sensitivity of PPARalpha gene expression to nutritional changes in liver of suckling and adult rats. Life Sci. 2005;76:1061–1072. doi: 10.1016/j.lfs.2004.10.018. [DOI] [PubMed] [Google Scholar]
  20. Painter RC, Roseboom TJ, Bleker OP. Prenatal exposure to the Dutch famine and disease in later life: an overview. Repro Toxicol. 2005;20:345–352. doi: 10.1016/j.reprotox.2005.04.005. [DOI] [PubMed] [Google Scholar]
  21. Pembrey ME, Bygren LO, Kaati G, Edvinsson S, Northstone K, Sjostrom M, Golding J, ALSPAC Study Team Sex-specific, male-line transgenerational responses in humans. Euro J Human Genetics. 2006;14:159–166. doi: 10.1038/sj.ejhg.5201538. [DOI] [PubMed] [Google Scholar]
  22. Stein AD, Lumey LH. The relationship between maternal and offspring birth weights after maternal prenatal famine exposure: the Dutch Famine Birth Cohort Study. Hum Biol. 2000;72:641–654. [PubMed] [Google Scholar]
  23. Torrens C, Brawley L, Dance CS, Itoh S, Poston L, Hanson MA. First evidence for transgenerational vascular programming in the rat protein restriction model. J Physiol. 2002;2002;543.P:41P–42P. [Google Scholar]
  24. Zambrano E, Martinez-Samayoa PM, Bautista CJ, Deas M, Guillen L, Rodriguez-Gonzalez GL, Guzman C, Larrea F, Nathanielsz PW. Sex differences in transgenerational alterations of growth and metabolism in progeny (F2) of female offspring (F1) of rats fed a low protein diet during pregnancy and lactation. J Physiol. 2005;566:225–236. doi: 10.1113/jphysiol.2005.086462. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES