Skip to main content
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2007 Nov;150(2):199–209. doi: 10.1111/j.1365-2249.2007.03468.x

Frequencies and role of regulatory T cells in patients with (pre)malignant cervical neoplasia

J Visser *,†, H W Nijman *, B-N Hoogenboom *,†, P Jager †, D van Baarle ‡, E Schuuring §, W Abdulahad , F Miedema ‡, A G van der Zee *, T Daemen †
PMCID: PMC2219359  PMID: 17937675

Abstract

Oncogenic human papillomavirus (HPV)-infection is crucial for developing cervical cancer and its precursor lesions [cervical intraepithelial neoplasia (CIN)]. Regulatory T cells (Tregs) might be involved in the failure of the immune system to control the development of HPV-induced cancer. We investigated frequencies, phenotype and activity of Tregs in patients with cervical neoplasia. CIN and cervical cancer patients showed increased CD4+/CD25high T cell frequencies in peripheral blood and CD4+ T cell fraction. These CD4+/CD25high T cells represent Tregs as demonstrated by their low proliferation rate, low interferon (IFN)-γ/interleukin (IL)-10 ratio, high expression of CD45RO, GITR, CTLA-4, forkhead box P3 (FoxP3) and low CD45RA expression. Moreover, in HPV16+ cervical cancer patients, in-vitro depletion of CD25+ T cells resulted in increased IFN-γ T cell responses against HPV16 E6- and E7 peptides. Thus, increased frequencies of Tregs in cervical cancer patients may indeed suppress HPV-specific immunity. Longitudinal analysis of CD4+/CD25high T cell frequencies in patients showed a modest decline 1 year after curative surgery or chemoradiation. This study demonstrates increased frequencies and suppressive activity of Tregs in cervical cancer. These results imply that Tregs may suppress the immune control of cervical neoplasia and furthermore that suppression of immunity by Tregs will be another hurdle to overcome in therapeutic immunization strategies against cervical neoplasia.

Keywords: CD4+ T cell, CD8+ T cell, cervical cancer, HPV, regulatory T cells

Introduction

Natural regulatory T cells (Tregs), characterized by co-expression of CD4 and CD25, play an important role in immune homeostasis [1–4]. In animal tumour models, elevated frequencies of Tregs have been demonstrated and Treg depletion increased the anti-tumour immune responses [5,6]. These observations led to the hypothesis that cancer patients have an enlarged population of Tregs inhibiting tumour-specific T cell responses [1–3]. A recent study showed that CD4+/CD25+ Tregs control the induction of antigen-specific T-helper responses in cancer patients [7]. Intratumoral Tregs have been demonstrated in ovarian cancer patients [8] and an enlarged population of Tregs in peripheral blood of patients with different types of cancer [9–13].

Infection with oncogenic human papillomavirus (HPV) is involved in cervical carcinogenesis; HPV DNA can be detected in ≥ 99% of all cervical cancers [14,15]. Most women infected with oncogenic HPV types clear the infection and do not develop (pre)malignant cervical neoplasia. The importance of the immune system in HPV clearance is demonstrated by observations that immunocompromised women fail more often to clear HPV infections and have an increased risk of developing cervical cancer [16].

The E6 and E7 oncoproteins of HPV play a crucial role in the transformation and maintenance of the malignant phenotype [15]. Several reports showed impaired cellular immunity against the HPV16 E6 and/or E7 oncoproteins in cervical cancer patients [17–20]. It has been suggested that impaired cellular immunity against these oncoproteins is responsible for the failure to eradicate HPV infections, leading subsequently to (pre)malignant cervical neoplasia [18]. In other studies, significant cellular immune responses against HPV16 E6 and/or E7 were demonstrated in cervical intraepithelial neoplasia (CIN) and cervical cancer patients [21–23]. However, these responses seem unable to clear HPV infections [21–23]. Interestingly, we observed that (suboptimal) T cell responses against HPV in CIN and cervical cancer patients can be enhanced by invasive surgical procedures [21].

CD4+/CD25+ Tregs have been found in tumour-draining lymph nodes of cervical cancer patients [24,25]. Immunohistochemistry also revealed the presence of CD25+ Tregs in infiltrate associated with CIN lesions [26]. However, in these studies frequencies and phenotypes of Tregs in CIN or cervical cancer patients were not compared to healthy controls; nor was suppression of (HPV-specific) cellular immune responses by Tregs determined.

To elucidate the role of Tregs in developing (pre)malignant cervical neoplasia, we evaluated frequencies, phenotype and suppressive activity of CD4+/CD25+ T cells in peripheral blood of patients with cervical cancer or CIN and healthy controls. Longitudinal analysis of Treg frequencies was performed during and following therapy. We also investigated if the previously observed suboptimal T cell responses against HPV can be ascribed to increased frequencies/activities of Tregs.

Materials and methods

Ethical approval

The study was approved by the local medical ethical committee of the University Medical Center Groningen (UMCG). Written informed consent was obtained from all patients.

Patients

CIN and cervical cancer patients (Table 1) were recruited from the out-patient clinic of the gynecology department at the UMCG, as described previously [21]. In the Netherlands, cervical smears are classified according a modified Papanicolaou system in which borderline dyskaryosis corresponds well with the Bethesda classification of atypical squamous cells of undetermined significance, mild dyskaryosis with low-grade squamous intraepithelial lesions and moderate and severe dyskaryosis and carcinoma in situ with high-grade squamous intraepithelial lesions [27]. Patients referred with cervical carcinoma were staged according FigO criteria [28]. In general, patients with FigO stages Ib/IIa were treated by radical surgery and patients with stages IIb–IV were treated with chemoradiation. Radiotherapy consisted of 50 Gy in 25 fractions, five fractions a week, combined with two fractions of brachytherapy if indicated. In addition to radiotherapy, patients received 40 mg/m2 of cisplatin per week for 6 weeks.

Table 1.

Patient characteristics.

CIN patients Cervical cancer patients


Patient no. Age (years) Diagnosis Grade HPV16 status Patient no. Age (years) Diagnosis Stage HPV16 status
1 26 CIN I neg 1 37 SCC IA1 pos
2 28 CIN I neg 2 30 SCC IA1 pos
3 27 CIN I neg 3 71 SCC IB1 pos
4 50 CIN I ? 4 36 SCC IB1 pos
5 45 CIN I ? 5 33 SCC IB neg
6 27 CIN I neg 6 40 SCC IB1 neg
7 41 CIN I pos 7 75 SCC IB1 pos
8 48 CIN I ? 8 60 SCC IB1 pos
9 34 CIN II pos 9 35 SCC IB1 pos
10 34 CIN III neg 10 45 SCC IB1 neg
11 33 CIN III pos 11 36 SCC IB1 neg
12 45 CIN III pos 12 33 SCC IB2 pos
13 40 CIN III ? 13 26 SCC IBII pos
14 38 CIN III neg 14 54 SCC IIA pos
15 40 CIN III pos 15 43 SCC IIB pos
16 40 CIN III pos 16 70 SCC IIB neg
17 35 CIN III ? 17 43 SCC IIB pos
18 30 CIN III ? 18 46 SCC IIB pos
19 36 SCC IIB pos
20 48 SCC IIB pos
21 51 SCC IIB pos
22 41 SCC IIB pos
23 45 SCC IIB neg
Avg 35 ± 8 Avg 45 ± 13

CIN, cervical intraepithelial neoplasia; SCC, squamous cell carcinoma; HPV, human papillomavirus.

Female healthy volunteers (age 39 ± 11 years) were recruited from the departments of gynecology and medical microbiology of the UMCG.

Isolation of cell subsets

Heparinized blood (50 ml) was obtained and peripheral blood mononuclear cells (PBMC) were isolated with a Ficoll-density gradient. PBMC were cryopreserved using standardized conditions enabling batchwise analysis at a later time.

Using fluorescent activated cell-sorting, thawed PBMC of healthy controls and patients with (pre)malignant cervical neoplasia were separated into CD4+/CD25neg T cells, CD4+/CD25low T cells and CD4+/CD25high T cells. PBMC were stained with αCD4-APC (IQ Products, Groningen, the Netherlands) and αCD25-fluorescein isothiocyanate (FITC) antibodies (BD Biosciences, San Diego, CA, USA). Cells of interest were isolated with a Dako-Cytomation MoFlo High-Speed Sorter (Glostrup, Denmark), using gate-settings as described previously [13,29].

Flow cytometry

PBMC were stained with αCD25-FITC (BD Biosciences), αCD152-PE (CTLA4; BD Biosciences), anti-glucocorticoid-induced tumour necrosis factor (TNF) receptor family-related gene (GITR)-phycoerythrin (PE) (R&D Systems, Minneapolis, OK, USA), αCD45RO-PE (IQ Products), αCD4-antigen-presenting cell (APC) (IQ Products), anti-forkhead box P3 (FoxP3)-PE (eBioscience) and isotype controls to determine the immunophenotype of the different CD25 T cell subsets. Flow cytometry was performed and cells were measured with a fluorescence activated cell sorter (FACS)Calibur (BD Biosciences). Cells were analysed using CellQuest software (BD Biosciences).

Cell cultures, cytokine- and proliferation assays

Isolated CD4+/CD25 T cell subsets were cultured at a density of 2·5 × 104 cells/well in 96-well round-bottomed plates (Nunc, Rochester, NY, USA). Cells were cultured in a volume of 200 µl RPMI-1640 (Gibco, Breda, the Netherlands) supplemented with 10% fetal calf serum (FCS) (BioWhittaker, Verviers, Belgium), penicillin/streptomycin and 50 µM β-mercaptoethanol.

Cells were stimulated with 0·75 µg/ml αCD3/1 µg/ml αCD28 (Sanquin Research, Amsterdam, the Netherlands). Culture supernatants were harvested after 3 days and cell proliferation was measured by overnight [3H]-thymidine incorporation (1 µCi/well; Amersham, Bucks, UK). Labelled cells were harvested and [3H]-thymidine incorporation measured with a liquid scintillation counter (Canberra-Packard, Meriden, CT, USA).

Cytokines were measured in culture supernatants using commercially available enzyme-linked immunosorbent assay (ELISA) kits (Sanquin Research).

Expansion and detection of interferon (IFN)-γ-producing HPV16E6- and E7-specific T cells

For expansion and detection of HPV16 E6- and E7-specific T cells, we adapted an assay developed previously for detection of Epstein–Barr virus-specific CD4+ and CD8+ T cells [30,31]. HPV16 E6- or E7-specific T cells were stimulated using 15-mer peptides with an 11-aa overlap spanning the complete sequence of HPV16 E6 (37 peptides) or E7 (22 peptides) protein. Peptides were synthesized by Mimotopes/Perbio Sciences. Purity (> 90%) and sequences were verified by high performance liquid chromatography (HPLC)/mass-spectrometry. Peptides were dissolved in dimethylsulphoxide (DMSO) and pooled (final concentration of 1 mg/ml of each peptide). Stimulations with peptide pools and medium were performed in the presence of co-stimulation (2 µg/ml αCD28). As a negative control, cells were stimulated with medium and co-stimulation only. As a positive control, cells were stimulated with 10 ng/ml phorbol myristate acetate (PMA)/2 µg/ml ionomycin.

To expand HPV16 E6- or E7-specific T cells, total PBMC or CD25+ cell-depleted PBMC were cultured for 12 days in the presence of E6 or E7 peptide pools. Culture medium consisted of RPMI-1640 (Gibco) supplemented with penicillin/streptomycin, 50 µM β-mercaptoethanol and 10% human pool serum (Sigma, Zwijndrecht, the Netherlands; complete medium). Cells were cultured at 2 × 105 PBMC/well in 100 µl complete medium in 96-well round-bottomed plates at 37°C and 5% CO2. The peptide pool (at 2 µg/ml of each peptide) was added on days 0 and 6. Interleukin (IL)-2 (10 U/ml) was added on days 3, 6 and 9. On day 12, cells were pooled, washed in RPMI-1640 and incubated overnight in complete medium.

On day 13, the number of IFN-producing cells were determined by intracellular cytokine staining; 106 cells were stimulated in 500 µl complete medium for 6 h with HPV16 E6 or E7 peptide pools (at 2 µg/ml of each peptide) and αCD28 (2 µg/ml; Sanquin Research) as co-stimulation. After 1 h, brefeldin-A (Golgiplug; BD Biosciences) was added at a dilution of 1 : 1000 to allow cytokine accumulation in the cytosol. After stimulation, cells were washed in phosphate-buffered saline (PBS) + 0·5% bovine serum albumin (BSA), permeabilized (FACS permeabilizing solution; BD Biosciences), washed again and stained with αCD3-PE/Cy5 (Sanquin Research), αCD4-APC (IQ Products), αCD8-FITC (Sanquin Research) and anti-IFN-PE (IQ Products). Cells were washed again, fixed (Cellfix; BD Biosciences) and 2 × 105 events were acquired on a FACSCalibur and data analysed using CellQuest software.

Enzyme-linked immunospot (ELISPOT) to determine HPV16 E6- and E7-specific T cell responses

Cryopreserved PBMC were thawed and CD25+ T cells were depleted using anti-CD25 Microbeads (Miltenyi-Biotec, Bergisch-Gladbach, Germany) according the manufacturer's instructions. This procedure leads to complete removal of CD4+/CD25high T cell fractions. Unseparated PBMC and CD25-depleted were seeded at a density of 1·5 × 106 cells/well in a 24-well plate (Corning Life-Sciences, Schiphol-Rijk, the Netherlands) in 1·5 ml complete medium in the presence or absence of HPV16 E6 or E7 peptide-pools (10 µg/ml of each peptide).

After 4 days of incubation, PBMC were harvested, washed and seeded in quadruplicate at a density of 1 × 105 cells/well in a coated ELISPOT-plate (Nunc, Silent-screen, Rochester, NY, USA) with an IFN-γ catching antibody (IFN-γ ELISPOT assay; Sanquin Research). The assay was performed further according the manufacturer's instructions (Sanquin Research). ELISPOT plates were analysed with a fully automated imaging device (A.EL.VIS, Hanover, Germany). The background in medium control wells was below 10 spots/1 × 105 cells. Specific spots were calculated using criteria similar to other studies [17–19,21]. Specific responses were calculated by subtracting the mean number of spots ±2 s.d. of medium control wells from the mean number of spots of experimental wells. Response against HPV16 E6 or E7 peptide-pools were considered positive when the number of specific spots was ≥ 10/1 × 105 cells and the response in the experimental wells was at least two times the background levels. As a positive control, PBMC were stimulated with a memory recall mix (MRM; kind gift of Dr S. van der Burg, LUMC, the Netherlands), consisting of a mixture of Tetanus toxoid (0·75 LF/ml), Mycobacterium tuberculosis sonicate (2·5 µg/ml) and Candida albicans (0·005%).

Establishing HPV16 status

HPV16 status was established by HPV16-specific polymerase chain reaction (PCR) on DNA isolated from cervical scrapings obtained at the patient's initial visit. The scraped cells were suspended in 5 ml PBS and kept on ice. The HPV16-specific PCR was performed as described previously [21]. HPV16-primers [product 152 base pairs (bp)] were: sense: TGCTAGTGCTTATGCAGCAGCAA, anti-sense: ATTTACTGCAACATTGGTAC.

Statistical analysis

Differences between groups were determined using the Mann-Whitney U-test and χ2 test. Significance was determined as P < 0·05.

Results

Frequencies of CD4+/CD25+ T cells in peripheral blood of healthy controls, patients with CIN and cervical cancer

CD4+/CD25+ and CD4+/CD25high T cells (Fig. 1a,d) were examined in patients with CIN, cervical cancer and healthy controls, using gate-settings as described previously [13,29]. As shown in Fig. 1, CD4+/CD25+ (Fig. 1b,c) and CD4+/CD25high T cells (Fig. 1e,f) were significantly increased in both total PBMC (Fig. 1b,e) and CD4+ T cell fraction (Fig. 1c,f) of patients with CIN and cervical cancer compared to healthy controls.

Fig. 1.

Fig. 1

(a, d) Gate-settings for calculating CD4+/CD25+ and CD4+/CD25high T cell frequencies. Markers to establish CD4+/CD25+ T cell frequencies are set on the isotype control. (b, c) CD4+/CD25+ T cell frequencies in total peripheral blood mononuclear cells (PBMC) (b) and CD4+ T cell population (c). (e, f) CD4+/CD25high T cell frequencies in total PBMC and CD4+ T cell population, respectively. Analysis was performed with PBMC collected before invasive therapy. Differences between groups were analysed using the Mann–Whitney U-test.

Immune phenotype and FoxP3 expression of CD4+/CD25 T cell subsets

CD4+/CD25high T cells of representative CIN patients, cervical cancer patients and healthy controls were characterized further for the expression of CD45RO, GITR, CTLA-4 and CD45RA. The three first molecules are expressed relatively highly and CD45RA is expressed relatively low on Tregs [1–3,9–13,29]. CD4+/CD25high T cells of patients and controls expressed increased levels of CD45RO, CTLA-4 and GITR compared to CD4+/CD25neg T cells (data not shown). Also, as the CD4+/CD25high T cells expressed much lower CD45RA levels than CD4+/CD25neg T cells (data not shown), the CD4+/CD25high T cells of CIN and cervical cancer patients phenotypically resemble Tregs.

The transcription factor FoxP3 is considered to be a specific marker for Tregs [1,32,33]. Therefore, we analysed FoxP3 expression in the CD4+/CD25 T cell subsets (Fig. 2, upper panel). In both healthy controls and cervical cancer patients, the majority of CD4+/CD25high T cells expressed FoxP3, while CD4+/CD25neg T cells and CD4+/CD25low T cells expressed FoxP3 at very low and moderate levels, respectively (Fig. 2, lower panel).

Fig. 2.

Fig. 2

Forkhead box P3 (FoxP3) expression was measured by flowcytometry in CD4+/CD25 subsets of a healthy control and three cervical cancer patients with peripheral blood mononuclear cells collected before invasive therapy. The upper panel shows gate-settings for CD4+/CD25neg, CD4+/CD25low and CD4+/CD25high cells. Within the T cell fractions FoxP3 expression was analysed (lower panel).

Cytokine profiles of CD4+/CD25neg and CD4+/CD25high T cell subsets

In general, Tregs are characterized by low proliferation, low IFN-γ production and robust IL-10 production [1–3,9–13,29]. CD4/CD25neg and CD4+/CD25high T cells were isolated by cell-sorting (Fig. 3a) to study their functionality in vitro.

Fig. 3.

Fig. 3

(a) Gate-settings used for sorting the different CD4+/CD25 T cell populations. White bars represent the CD25neg T cells and the black bars the CD25high T cells. Cell-sorting experiments were performed with peripheral blood mononuclear cells (PBMC) collected before invasive therapy of seven representative controls, 11 representative patients with cervical intraepithelial neoplasia and 12 representative patients with cervical cancer. Proliferation (b) is expressed as dissociations per second (dps; mean ± s.e.m.), interleukin-10 (c) and interferon-γ (d) production as pg/ml (mean ± s.e.m.).

The CD4+/CD25high subset showed a low proliferation rate (Fig. 3b), high levels of IL-10 production (Fig. 3c) and low IFN-γ production (Fig. 3d). The CD4+/CD25neg subset, on the other hand, showed the opposite profile. Although CD4+/CD25high and CD4+/CD25neg cells of cervical cancer patients, on average, produced lower cytokine levels, the cytokine profile of these T cell subsets was similar compared to these subsets in healthy controls and patients with CIN.

Effect of CD25+ T cell depletion on HPV16 E6/E7-specific and general T cell responses

Using IFN-γ ELISPOT analysis, we determined the influence of CD4+/CD25+ T cells on HPV16 E6- and E7-specific T cell responses in patients with cervical cancer.

In vitro, depletion of CD25+ T cells enhanced IFN-γ T cell responses against HPV16 E6 and/or E7 peptide-pools in 50% (five of 10) of the HPV16-DNA+ cervical cancer patients (Table 2; P = 0·05 compared to HPV16neg cervical cancer patients and P = 0·07 compared to the controls). In HPV16neg cervical cancer patients no significant responses against HPV16 E6 and E7 peptide-pools were observed, and in only one healthy control CD25+ T cell depletion enhanced the HPV16 E6-specific T cell response (Table 2).

Table 2.

Effect of CD25+ cell depletion on interferon (IFN)-γ T cell responses against HPV16 E6 and/or E7 in cervical cancer patients and healthy controls.

PBMC CD 25 depleted PBMC


Cervical cancer patients E6 E7 MRM E6 E7 MRM
HPV16 pos
 Patient 1 9 3 38 9 10 88
 Patient 2 0 0 31 0 9 37
 Patient 3 0 1 > 400 0 6 > 400
 Patient 7 0 0 170 0 0 91
 Patient 8 3 2 12 42 16 74
 Patient 12 12 4 39 43 29 56
 Patient 14 1 3 38 7 10 76
 Patient 15 0 0 45 2 0 56
 Patient 19 0 1 39 4 3 157
 Patient 21 7 3 > 400 14 7 > 400
HPV16 neg
 Patient 5 0 0 > 400 0 0 > 400
 Patient 6 0 1 6 0 4 95
 Patient 10 0 0 0 9 0 4
 Patient 11 0 0 102 0 0 167
 Patient 16 1 1 28 0 1 38
Controls
 Control 1 0 1 77 0 0 112
 Control 2 1 1 65 0 3 80
 Control 3 0 1 170 0 2 51
 Control 4 0 0 5 0 0 85
 Control 5 0 0 170 0 0 120
 Control 6 0 1 43 0 0 118
 Control 7 0 10 110 0 0 159
 Control 8 0 2 49 X X X
 Control 9 0 0 78 21 0 79
 Control 10 0 0 > 400 6 0 269

HPV16 E6- and E7-specific T cell responses in patients with cervical cancer and controls as determined by interferon (IFN)-γ enzyme-linked immunospot. The table shows the number of spots per 1 × 105 cells. Shown are the responses in total peripheral blood mononuclear cells (PBMC) and the CD25-depleted PBMC. Specific responses (≥ 10/1 × 105 cells) are indicated in bold type. Analyses were performed with PBMC collected before invasive therapy. MRM: memory recall mix, E6: E6 peptide pool, E7: E7 peptide pool, X: insufficient cells available for analysis.

In a number of HPV16-DNA+, HPV16-DNAneg and control donors, depletion of CD25+ T cells enhanced MRM-specific T cell responses (Table 2). In one patient (patient 7) and three controls (controls 3, 5, 10) depletion of CD25+ T cells caused a decrease of MRM-specific T cell responses. This is probably due to depletion of CD25+ activated memory T cells.

Using standard IFN-γ ELISPOT analysis the total T cell response is measured, not discriminating between CD4+ and CD8+ T cell responses. As Tregs control both CD4+ and CD8+ T cell responses [1–4], we determined if depletion of CD25+ T cells enhances HPV-specific T cell responses of both cell subsets.

All cervical cancer patients thus analysed displayed low, yet detectable CD4+ T cell responses against HPV16 E6 and/or E7 peptide-pools (Table 3). As observed by others [19–22], we also found higher CD4+ and CD8+ T cell responses against the E6 peptide pool compared to the E7 peptide pool (Table 3). Upon depletion of CD25+ cells, the response was enhanced in the CD4+ T cell fraction in three of four patients. Patients 2, 4 and 20 showed CD8 responses against the HPV16 E6 and/or E7 peptide pools. However, in only patient 2 was the E6-specific response enhanced after CD25+ cell depletion. Background IFN-γ production was not enhanced significantly by CD25+ cell depletion. Although the results for the HPV16 E6- and E7-specific CD8+ responses are inconclusive, these results suggest that CD25+ T cells can at least suppress the HPV16 E6- and/or E7-specific CD4+ T cell responses.

Table 3.

Effect of CD25+ cell depletion on antigen-specific interferon (IFN)-γ responses against human papilloma virus (HPV)16 E6 and/or E7 in both CD4+ and CD8+ T cell subsets of HPV16+ cervical cancer patients.

PBMC CD25 depleted PBMC


Cervical cancer patients Neg control E6 pept E7 pept Neg control E6 pept E7 pept
% IFN-y + CD4+ T cells
 Patient 2 0·9 3·4 3·6 1 7·5 4·8
 Patient 4 2·3 7 2·9 2·8 9·2 n.a.
 Patient 20 0·4 2·3 0·6 0·4 4·5 1·6
 Patient 22 0·8 7·1 1·7 1·2 7·8 1·4
%IFN-γ + CD8+ T cells
 Patient 2 0·5 1·4 0·8 0·3 6·3 0·8
 Patient 4 0·8 4·1 1·9 n.a. n.a. n.a.
 Patient 20 0·4 2·1 0·6 0·7 1·7 1
 Patient 22 0·5 0·7 0·3 0·3 0·6 0·3

Human papilloma virus (HPV)16 E6 and E7-specific interferon (IFN)-γ T cell production was measured by intracellular cytokine staining after in vitro expansion for 12 days with peripheral blood mononuclear cells (PBMC) or CD25-depleted PBMC of four HPV16 + cervical cancer patients in the presence of HPV16 E6 or E7 peptide pools. The results are expressed as percentage IFN-γ positive cells within the CD4+ or CD8+ T cell fraction. Positive responses (at least two times the background) are indicated in bold type. Analyses were performed with PBMC obtained before invasive therapy. E6 pept: E6 peptide pool, E7 pept: E7 peptide pool, n.a. insufficient cells available for analysis.

Longitudinal follow-up of CD4+CD25high T cell frequencies in patients with cervical cancer

Longitudinal analyses of CD4+/CD25high T cell frequencies were performed in four healthy controls and 10 cervical cancer patients during and following therapy. In healthy controls the CD4+/CD25high T cell population appeared very stable (Fig. 4a). In two patients with cervical cancer who underwent curative surgery only, with no sign of recurrence for more than 2 years, CD4+/CD25high T cell frequencies showed a modest decline following curative surgery (Fig. 4b,c). CD4+/CD25high T cell frequencies showed strong fluctuation in patients treated with chemoradiation (RCT; Fig. 4d–k). In six patients the CD4+/CD25high T cell frequencies increased after radiochemotherapy (Figs 4d–h, k); in two patients these frequencies remained stable (Fig. 4i,j). After completion of chemoradiation, CD4+/CD25high T cell frequencies did not fall below the levels as measured before chemoradiation in all eight patients.

Fig. 4.

Fig. 4

The figure shows the longitudinal CD4+/CD25high T cell frequencies as a percentage of the CD4+ T cell fraction in four healthy controls (a) and 10 cervical cancer patients (c–k) during and following their therapy. Type of intervention/therapy and remarks about clinical status is mentioned in the figure. EUA: examination under anaesthesia; RCT: radiotherapy combined with chemotherapy.

Discussion

In this study we provide evidence that patients with CIN and cervical cancer have increased CD4+/CD25high Treg frequencies in their peripheral blood compared to healthy controls. Our data show that these CD4+/CD25high T cells, but not CD4+/CD25low T cells, of CIN and cervical cancer patients display all Treg characteristics. The CD4+/CD25high T cells express high levels of CD45RO, GITR and CTLA-4. Furthermore, these CD4+/CD25high T cells produce high levels of IL-10, low levels of IFN-γ and have a low rate of proliferation. Moreover, this subset is highly positive for the Treg-specific marker FoxP3.

It has been shown that in vitro CD25+ T cell depletion enhanced virus-specific CD4+ and/or CD8+ T cell responses [33]. Moreover, in melanoma patients, CD4+/CD25+ Tregs control tumour-specific CD4+ T cell responses [7]. We therefore hypothesized that increased Treg numbers in cervical cancer patients might be responsible for impaired cellular immunity against HPV. Indeed, in vitro, depletion of CD25+ T cells, enhanced HPV16 E6- and/or E7-specific T cell responses in 50% of the HPV16-DNApos cervical cancer patients. This enhancement did not occur in HPV16-DNAneg cervical cancer patients, while only one healthy control showed an enhanced E6-specific T cell response, probably reflecting T cell memory of previous HPV-infection(s). Our results indicate that suppression of HPV16 E6/E7-specific T cell responses by CD25+ cells was at the level of CD4+ and possibly also CD8+ T cells. The increased IFN-γ responses could not be explained by enrichment of responder T cells after CD25+ cell depletion, because relative changes of CD4+ T and CD8+ T cells remained below 4% and 2%, respectively (data not shown).

CD25+ T cell depletion also enhanced T cell responses against MRM in a considerable number of cervical cancer patients and healthy controls. In one patient (patient 7) and three controls (controls 3, 5 and 10), CD25+ T cell depletion resulted in a decrease of the MRM-specific T cell response. In view of the fact that activated memory T cells express increased levels of CD25, this decrease might be due to depletion of activated memory T cells.

The simultaneous increase of HPV16 and MRM-specific T cell responses in HPV16+ cervical cancer patients after CD25+ T cell depletion indicate that suppression of cell-mediated immunity by Tregs in these patients is not antigen-specific. However, our results imply that increased frequencies of Tregs in cervical cancer patients might suppress the immunological control of cervical neoplasia. Insufficient cell numbers were available to characterize further the suppression of general immune responses by Tregs in cervical cancer patients.

Our results regarding suppression of HPV16 E6- and E7-specific T cell responses by CD25+ T cells shed new light on observations of relatively low or impaired HPV-specific cellular immunity in cervical cancer patients [17–23]. In this study we provide evidence that intrinsically these anti-HPV responses exist, but are suppressed by Tregs. Therefore, the observed (low) level of HPV-specific immunity in PBMC of cervical cancer patients [17–23] is most probably an underestimation of the actual HPV-specific T cell numbers.

Malignant cervical tumour cells can produce large amounts of transforming growth factor (TGF)-β [34]. Because TGF-β induces Treg development [35], this might be one of the mechanisms leading to increased Treg levels in cervical cancer patients. However, theoretically, it cannot be ruled out that women developing CIN or cervical cancer display intrinsically increased Treg numbers. If the increased Treg numbers are induced by the cervical tumour only, tumour eradication might lead to a decline in Treg numbers. However, we found only a modest decline of CD4+/CD25high T cell frequencies in the year following curative surgery. Patients treated with chemoradiation showed strong fluctuations but no decrease of their CD4+/CD25high T cell frequencies during and following therapy. Chemoradiation causes tissue damage and apoptosis which may lead to immune activation. As a consequence the number of Tregs might be up-regulated to prevent immune pathology [1–4]. It remains an unanswered question as to whether Tregs are induced or already present in patients with (pre)malignant cervical neoplasia. Therefore, further research will be required to elucidate fully the influence of therapy on Tregs in these patients.

Because E6 and E7 transforming oncoproteins are crucial for transformation and maintenance of the malignant phenotype, they are ideal candidates for tumour-specific cervical cancer immunotherapy [36]. The results presented in this study indicate that the presence of increased Treg numbers is another hurdle to overcome for successful therapeutic immunotherapy, especially when this therapy is given as an adjuvant to chemoradiation. Therefore, immunization strategies should elicit strong anti-tumour immune responses: strong enough to overcome the immunosuppressive state of the patient. Such strong responses have been described for immunizations with a genetic vector derived from Semliki-Forest virus (an alphavirus) expressing HPV16 E6/E7, which could break immune tolerance in HPV-transgenic mice [37].

Another approach could be (temporarily) bypassing suppression of cellular immunity by Tregs during therapeutic immunizations for treatment of (pre)malignant cervical neoplasia. The clinical potential of enhancing anti-tumour immune responses by Treg depletion has been shown recently in patients with metastatic renal carcinoma [38]. However, interfering in Treg-controlled immune responses should be conducted with extreme caution, because of the risk of developing autoimmunity [39].

Acknowledgments

We thank Nening Nanlohy, Klaske 10 Hoor, Harry Klip and Esther Nijhuis for their excellent assistance. T. Daemen, A. G. van der Zee and F. Miedema were supported financially by the Dutch Cancer Society, grant no. RUG 2001–2398; H. W. Nijman was supported financially by the Dutch Cancer Society, grant no. 2002–2678. J. Visser was supported financially by a grant from Maurits en Anna de Kock stichting.

References

  • 1.Sakaguchi S. Naturally arising Foxp3-expressing CD25+ CD4+ regulatory T cells in immunological tolerance to self and non-self. Nat Immunol. 2005;4:345–52. doi: 10.1038/ni1178. [DOI] [PubMed] [Google Scholar]
  • 2.von Boehmer H. Mechanisms of suppression by suppressor T cells. Nat Immunol. 2005;4:338–44. doi: 10.1038/ni1180. [DOI] [PubMed] [Google Scholar]
  • 3.McHugh RS, Shevach EM. The role of suppressor T cells in regulation of immune responses. J Allergy Clin Immunol. 2002;110:693–702. doi: 10.1067/mai.2002.129339. [DOI] [PubMed] [Google Scholar]
  • 4.Mils KH. Regulatory T cells: friend or foe in immunity to infection? Nat Rev Immunol. 2005;4:841–55. doi: 10.1038/nri1485. [DOI] [PubMed] [Google Scholar]
  • 5.Casares N, Arribillaga L, Sarobe P, et al. CD4+/CD25+ regulatory T cells inhibit activation of tumor primed CD4+ T cells with IFN-γ-dependent antiangiogenic activity, as well as long-lasting tumor immunity elicited by peptide vaccination. J Immunol. 2003;171:5931–9. doi: 10.4049/jimmunol.171.11.5931. [DOI] [PubMed] [Google Scholar]
  • 6.Shimizu J, Yamazaki S, Sakaguchi S. Induction of tumor immunity by removing CD25+ CD4+ T cells: a common basis between tumor immunity and autoimmunity. J Immunol. 1999;163:5211–8. [PubMed] [Google Scholar]
  • 7.Nishikawa H, Jager E, Ritter G, Old LJ. CD4+ CD25+ regulatory T cells control the induction of antigen-specific CD4+ helper T cell responses in cancer patients. Blood. 2005;106:1008–11. doi: 10.1182/blood-2005-02-0607. [DOI] [PubMed] [Google Scholar]
  • 8.Curiel TJ, Coukos G, Zou L, et al. Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced survival. Nat Med. 2004;10:942–9. doi: 10.1038/nm1093. [DOI] [PubMed] [Google Scholar]
  • 9.Woo EY, Chu CS, Goletz TJ, et al. Regulatory CD4+ CD25+ T cells in tumors from patients with early-stage non-small cell lung cancer and late-state ovarian cancer. Cancer Res. 2001;61:4766–72. [PubMed] [Google Scholar]
  • 10.Liyanage UK, Moore TT, Joo HG, et al. Prevalence of regulatory T cells is increased in peripheral blood and tumor microenvironment of patients with pancreas or breast adenocarcinoma. J Immunol. 2002;169:2756–61. doi: 10.4049/jimmunol.169.5.2756. [DOI] [PubMed] [Google Scholar]
  • 11.Wolf AM, Wolf D, Steurer M, Gastl G, Gunsilius E, Grubeck-Loebenstein B. Increase of regulatory T cells in the peripheral blood of cancer patients. Clin Cancer Res. 2003;9:606–12. [PubMed] [Google Scholar]
  • 12.Ichihara F, Kono K, Takahashi A, Kawaida H, Sugai H, Fujii H. Increased populations of regulatory T cells in peripheral blood and tumor-infiltrating lymphocytes in patients with gastric and esophageal cancers. Clin Cancer Res. 2003;9:4404–8. [PubMed] [Google Scholar]
  • 13.Ormandy LA, Hillemann T, Wedemeyer H, Manns MP, Greten TF, Korangy F. Increased populations of regulatory T cells in peripheral blood of patients with hepatocellular carcinoma. Cancer Res. 2005;65:2457–64. doi: 10.1158/0008-5472.CAN-04-3232. [DOI] [PubMed] [Google Scholar]
  • 14.Walboomers JM, Jacobs MV, Manos MM, et al. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol. 1999;189:12–9. doi: 10.1002/(SICI)1096-9896(199909)189:1<12::AID-PATH431>3.0.CO;2-F. [DOI] [PubMed] [Google Scholar]
  • 15.Shah KV, Howley PM. Papillomaviruses. In: Fields BN, Knipe DM, Howley PM, editors. Fields virology. Philadelphia: Lippincott-Raven Publishers; 1995. pp. 2077–110. [Google Scholar]
  • 16.Bouwes Bavinck JN, Berkhout RJ. HPV-infections and immunosuppression. Clin Dermatol. 1997;5:427–37. doi: 10.1016/s0738-081x(96)00154-x. [DOI] [PubMed] [Google Scholar]
  • 17.van Poelgeest MI, Nijhuis ER, Kwappenberg KM, et al. Distinct regulation and impact of type 1 T-cell immunity against HPV16 L1, E2 and E6 antigens during HPV16-induced cervical infection and neoplasia. Int J Cancer. 2006;118:675–83. doi: 10.1002/ijc.21394. [DOI] [PubMed] [Google Scholar]
  • 18.de Jong A, van Poelgeest MI, van der Hulst JM, et al. Human papillomavirus type 16-positive cervical cancer is associated with impaired CD4+ T-cell immunity against early antigens E2 and E6. Cancer Res. 2004;64:5449–55. doi: 10.1158/0008-5472.CAN-04-0831. [DOI] [PubMed] [Google Scholar]
  • 19.Welters MJ, de Jong A, van den Eeden SJ, et al. Frequent display of human papillomavirus type 16, E6-specific memory T-helper cells in the healthy population as witness of previous viral encounter. Cancer Res. 2003;63:636–41. [PubMed] [Google Scholar]
  • 20.Youde SJ, Dunbar PR, Evans EM, et al. Use of fluorogenic histocompatibility leukocyte antigen-A*0201/HPV 16, E7 peptide complexes to isolate rare human cytotoxic T-lymphocyte-recognizing endogenous human papillomavirus antigens. Cancer Res. 2000;60:365–71. [PubMed] [Google Scholar]
  • 21.Visser J, van Baarle D, Hoogeboom BN, et al. Enhancement of human papilloma virus type 16, E7 specific T cell responses by local invasive procedures in patients with (pre)malignant cervical neoplasia. Int J Cancer. 2006;118:2529–37. doi: 10.1002/ijc.21673. [DOI] [PubMed] [Google Scholar]
  • 22.Steele JC, Mann CH, Rookes S, et al. T-cell responses to human papillomavirus type 16 among women with different grades of cervical neoplasia. Br J Cancer. 2005;93:248–59. doi: 10.1038/sj.bjc.6602679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Luxton JC, Nath R, Derias N, Herbert A, Shepherd PS. Human papillomavirus type 16-specific T cell responses and their association with recurrence of cervical disease following treatment. J Gen Virol. 2003;84:1063–70. doi: 10.1099/vir.0.18931-0. [DOI] [PubMed] [Google Scholar]
  • 24.Fattorossi A, Battaglia A, Ferrandina G, et al. Lymphocyte composition of tumor draining lymph nodes from cervical and endometrial cancer patients. Gynecol Oncol. 2004;92:106–15. doi: 10.1016/j.ygyno.2003.09.020. [DOI] [PubMed] [Google Scholar]
  • 25.Fattorossi A, Battaglia A, Ferrandina G, et al. Neoadjuvant therapy changes the lymphocyte composition of tumor-draining lymph nodes in cervical carcinoma. Cancer. 2004;100:1418–28. doi: 10.1002/cncr.20130. [DOI] [PubMed] [Google Scholar]
  • 26.Kobayashi A, Greenblatt RM, Anastos K, et al. Functional attributes of mucosal immunity in cervical intraepithelial neoplasia and effects of HIV infection. Cancer Res. 2004;64:6766–74. doi: 10.1158/0008-5472.CAN-04-1091. [DOI] [PubMed] [Google Scholar]
  • 27.Bulkmans NW, Rozendaal L, Snijders PJ, et al. POBASCAM, a population-based randomized controlled trial for implementation of high-risk HPV testing in cervical screening: design, methods and baseline data of 44,102 women. Int J Cancer. 2004;110:94–101. doi: 10.1002/ijc.20076. [DOI] [PubMed] [Google Scholar]
  • 28.Finan MA, DeCesare S, Fiorica JV, et al. Radical hysterectomy for stage IB1 vs IB2 carcinoma of the cervix: does the new staging system predict morbidity and survival? Gynecol Oncol. 1996;62:139–47. doi: 10.1006/gyno.1996.0206. [DOI] [PubMed] [Google Scholar]
  • 29.Baecher-Allan C, Brown JA, Freeman GJ, Hafler DA. CD4+CD25high regulatory cells in human peripheral blood. J Immunol. 2001;167:1245–53. doi: 10.4049/jimmunol.167.3.1245. [DOI] [PubMed] [Google Scholar]
  • 30.Piriou E, van Dort K, Nanlohy NM, van Oers MH, Miedema F, van Baarle D. Loss of EBNA1-specific memory CD4+ and CD8+ T cells in HIV-infected patients progressing to AIDS-related non-Hodgkin lymphoma. Blood. 2005;106:3166–74. doi: 10.1182/blood-2005-01-0432. [DOI] [PubMed] [Google Scholar]
  • 31.Roncador G, Brown PJ, Maestre L, et al. Analysis of FOXP3 protein expression in human CD4+CD25+ regulatory T cells at the single-cell level. Eur J Immunol. 2005;35:1681–91. doi: 10.1002/eji.200526189. [DOI] [PubMed] [Google Scholar]
  • 32.Hori S, Nomura T, Sakaguchi S. Control of regulatory T cell development by the transcription factor Foxp3. Science. 2003;299:1057–61. doi: 10.1126/science.1079490. [DOI] [PubMed] [Google Scholar]
  • 33.Aandahl EM, Michaelsson J, Moretto WJ, Hecht FM, Nixon DF. Human CD4+ CD25+ regulatory T cells control T-cell responses to human immunodeficiency virus and cytomegalovirus antigens. J Virol. 2004;78:2454–9. doi: 10.1128/JVI.78.5.2454-2459.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sheu BC, Lin RH, Lien HC, Ho HN, Hsu SM, Huang SC. Predominant Th2/Tc2 polarity of tumor-infiltrating lymphocytes in human cervical cancer. J Immunol. 2001;167:2972–8. doi: 10.4049/jimmunol.167.5.2972. [DOI] [PubMed] [Google Scholar]
  • 35.Rao PE, Petrone AL, Ponath PD. Differentiation and expansion of T cells with regulatory function from human peripheral lymphocytes by stimulation in the presence of TGF-beta. J Immunol. 2005;174:1446–55. doi: 10.4049/jimmunol.174.3.1446. [DOI] [PubMed] [Google Scholar]
  • 36.Frazer IH. Prevention of cervical cancer through papillomavirus vaccination. Nat Rev Immunol. 2004;4:46–54. doi: 10.1038/nri1260. [DOI] [PubMed] [Google Scholar]
  • 37.Riezebos-Brilman A, Regts J, Freyschmidt EJ, Dontje B, Wilschut J, Daemen T. Induction of human papilloma virus E6/E7-specific cytotoxic T-lymphocyte activity in immune-tolerant, E6/E7-transgenic mice. Gene Ther. 2005;12:1410–4. doi: 10.1038/sj.gt.3302536. [DOI] [PubMed] [Google Scholar]
  • 38.Dannull J, Su Z, Rizzieri D, et al. Enhancement of vaccine-mediated antitumor immunity in cancer patients after depletion of regulatory T cells. J Clin Invest. 2005;115:3623–33. doi: 10.1172/JCI25947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wei WZ, Jacob JB, Zielinski JF, et al. Concurrent induction of antitumor immunity and autoimmune thyroiditis in CD4+ CD25+ regulatory T cell-depleted mice. Cancer Res. 2005;65:8471–8. doi: 10.1158/0008-5472.CAN-05-0934. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES