Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2003 Sep;77(18):10088–10098. doi: 10.1128/JVI.77.18.10088-10098.2003

Restriction of Amino Acid Change in Influenza A Virus H3HA: Comparison of Amino Acid Changes Observed in Nature and In Vitro

Katsuhisa Nakajima 1,*, Eri Nobusawa 1, Ken Tonegawa 2, Setsuko Nakajima 1
PMCID: PMC224596  PMID: 12941919

Abstract

We introduced 248 single-point amino acid changes into hemagglutinin (HA) protein of the A/Aichi/2/68 (H3N2) strain by a PCR random mutation method. These changes were classified as positive or negative according to their effect on hemadsorption activity. We observed following results. (i) The percentage of surviving amino acid changes on the HA1 domain that did not abrogate hemadsorption activity was calculated to be ca. 44%. In nature, it is estimated to be ca. 39.6%. This difference in surviving amino acid changes on the HA protein between natural isolates and in vitro mutants might be due to the immune pressure against the former. (ii) A total of 26 amino acid changes in the in vitro mutants matched those at which mainstream amino acid changes had occurred in the H3HA1 polypeptide from 1968 to 2000. Of these, 25 were positive. We suggest that the majority of amino acid changes on the HA protein during evolution might be restricted to those that were positive on the HA of A/Aichi/2/68. (iii) We constructed two-point amino acid changes on the HA protein by using positive mutants. These two-point amino acid changes with a random combination did not inhibit hemadsorption activity. It is possible that an accumulation of amino acid change might occur without order. (iv) From the analysis of amino acids participating in mainstream amino acid change, each antigenic site could be further divided into smaller sites. The amino acid substitutions in the gaps between these smaller sites resulted in mostly hemadsorption-negative changes. These gap positions may play an important role in maintaining the function of the HA protein, and therefore amino acid changes are restricted at these locations.


Influenza virus has a remarkable ability in escaping host defense mechanisms by altering its antigenic character, especially through changes in its hemagglutinin (HA) protein. The molecular mechanisms by which viruses alter their antigenic character are an important subject of study since they ultimately control the epidemics of influenza. From analyses of natural and laboratory-selected antigenic variants, four to five antigenic sites on the HA protein have been identified with H3N2 (29, 31). Plotkin et al. (19) claimed that multiantigenic regions have changed in recent H3 epidemic strains. Wang et al. (30) suggested sequential amino acid changes at antigenic sites of the H3 strains. Supporting this possibility, we showed how the 1993 and 1994 antigenic variant viruses of H3 subtype appeared from the 1991 virus by analyzing human sera with a chimeric protein method (14). Our recent studies focusing on the amino acid changes in natural isolates of H3 subtype have led to the following observations. (i) The second and the third sequential mutations occurred at the same residues after 1982. (ii) Most of these sequential mutations were observed in a small portion of the antigenic sites of the HA1 domain. Bush et al. (1) and Suzuki and Gojobori (27) stressed positive selection for some amino acid residues in the H3 HA. These results seem to explain the accumulation of amino acid changes in restricted regions. Both et al. (4) reported that antigenic changes of the H3 viruses might be limited in order that the HA structure be maintained. Nevertheless, H3 influenza virus still causes major epidemics. Comparison of the amino acid sequences of HA protein among 15 serotypes revealed the existence of strongly conserved positions (16, 22). For instance, cysteine residues in the HA1 region were conserved, and a one-point amino acid change in this region resulted in the loss of hemadsorption activity. However, the number of conserved positions is quite limited, and the entire HA1 region seems to be able to change amino acids freely. Therefore, the question arises as to the evolution of the H3HA protein in terms of future amino acid substitutions, that is, whether amino acid changes in H3HA will be restricted or not or whether the accumulation of amino acid changes will proceed with some order or not. Amino acid changes in natural isolates have been analyzed extensively (1-3, 6, 19, 27). However, we know a little of the characteristics of the changes on the H3HA molecule with evolution. For instance, at some antigenic sites there exist positions that change amino acids two or three times, while at others there has been no change at all. We do not know whether this can be explained as chance or as the restriction of amino acid change. Further experimental analysis is needed to determine which amino acid changes are allowed and which are prohibited. This information should increase our understanding of the evolution of the H3HA molecule. We introduced random one-point amino acid changes on the A/Aichi/2/68(A/Aichi/68) HA protein by a PCR mutation method (10) and assayed hemadsorption activity of the mutant HAs in order to estimate the viability of the H3HA protein resulting from these amino acid changes and to determine which changes are allowed during evolution of the H3HA protein.

MATERIALS AND METHODS

HA cDNA.

HA cDNAs of A/Aichi/68 and A/Sydney/5/97 (A/SD/97) viruses were cloned and inserted into pME18S expression vector by using EcoRI and XbaI sites (12).

Random mutations introduced into the HA cDNA.

pME18S HA (A/Aichi/68) (1 ng) was amplified by the PCR method with rTaq (Takara Shuzo,Tokyo, Japan) by using two pairs of primers: primers pME(−) and HA(+) and primers pME(+) and HA(−). Their sequences were as follows: pME(−), CCTGTACGGAAGTGTTACTT; pME(+), TTCAGGTTCAGGGGGAGGTG; HA(+), ATAATGAGGTCAGATGCACC (A/Aichi/68; positions 847 to 866), and HA(−), GGTACATTCCGCATCCCTGTTGC (A/Aichi/68; positions 1019 to 997). Amplification by PCR was carried out for 30 cycles. The amplified products were purified by gel electrophoresis with 1% agarose. Products purified after one round of PCR were diluted to 0.2 ng. Second- and third-round PCRs were performed under the same conditions. PCR products PCR1, PCR2, and PCR3 with the primer pair pME(+)-HA(−) were digested with EcoRI and NdeI, and those with the primer pair pME(−)-HA(+) were digested with XbaI and NdeI. These fragments were ligated to the counterpart of A/Aichi/68 HA cDNA. The term pME18S HA (0/n) indicates that the HA1 region was derived from the original HA, and the HA2 region was derived from a PCR n product. pME18S HA (n/0) indicates the reverse. Six colonies were isolated from each plate. The first-round PCR did not induce any mutations; the second-round PCR induced none in three clones, one in two clones, and two in one clone, and the third-round PCR resulted in none in two clones, one in one clone, two in one clone, and three in two clones. Therefore, the second- and third-round PCR products were mainly used in the present experiments to isolate single-point mutants of the HA gene.

Site-directed mutagenesis.

Site-directed mutagenesis was carried out by using a PCR mutagenic procedure. The mutant primers for 91 and 91(−) were TGAAAGCTTTGCVGCGTTCAACGAAAGG (positions 328 to 305, V = A, C, or G), TGAAAGCTTTGDTGCGTTCAACGAAAGG (positions 328 to 305, D = A, T, or G), and TGAAAGCTTCCTGCGTTCAACGAAAAGG (positions 328 to 305). The PCR products from pME18S HA (A/Aichi/68) with 91(−) and pME(+) were digested with EcoRI and HindIII and then ligated into pME18SHA. The mutant primer for 156(E/K) was CCGCTGCAGTTGACCAAATCAGGAAG. PCR products from pME18SHA(156E) with pME(−) and 156(E/K) were digested with HincII and EcoRI and ligated into pME18S HA.

In order to create the following mutants, EarI sites were added to the primers. PCR products characterized as (−) and pME(−) and as (+) and pME(+) were ligated by using EarI sites as described previously (15). Primer sets for creating cleavage sites at amino acid residues were as follows: for 156, (i) GCGCTGCAGCTCTTCATCAGGAAGCACATA(+) and CCGCTGCAGCTCTTCCTGATTSGGTCAACCAGTTCAG(−) and (ii) CCGCTGCAGCTCTTCCTGATBTGGTCAACAGTTCAG(−) and CCGCTGCAGCTCTTCCTGARTTGGTCAACCAGTTCAG(−); for 190D, GCGAAGCGAAGCTTCTCTTCAAGACCAAACCAGC(+) and GCGCTGCAGCTCTTCTCTTGGTCGTGCT(−); for 260L, GCGAAGCTTCTCTTCCAAATTGCGCACTGG(+)-GCGCTGCAGCTCTTCTTTTGAAAATAACCC(−); for 276N, GCGAAGCTTCTCTTCGATAACTGTATTTC(+) and GCGCTGCAGCTCTTCGTATCAATAGGTGC(−); for SD79S, GCGGAATTCCTCTTCTGGCTCCCAAAATAA(+) and GCGAAGCTTCTCTTCAGCCATCACAATGAG(−); for SD134R, GCGAAGCTTCTCTTCGAATAGAACAAGCTA(+) ANDGCGCTGCAGCTCTTCCATTCTGAGCGACTC(−); and for SD136N, GCGAAGCTTCTCTTCGAATGGAACAAACTATGC(+) and GCGCTGCAGCTCTTCCATTCTGAGCGACTC(−). The EarI recognition sites are underlined.

Two-point amino acid change on the HA.

Among one-point mutants obtained by PCR methods, we used mutant cDNAs in which the amino acid positions were matched to those of mainstream amino acid change during evolution of H3HA from A/Aichi/68. Amino acid position 144 changed early, and then we chose 144HAcDNA and prepared (144+x)HA mutants. For “x” HA mutants, we used mutant cDNAs of the 54, 57, 62, 78, 82, 157, 173, 188, 207, and 262 positions. These were digested with EcoRI and HindIII (for positions 54, 57, 62, 78, and 82) or HincII and XbaI (for positions 157, 173, 188, 207, and 262), and these fragments were ligated to counterpart of 144HAcDNA.

Hemadsorption assay of the HA cDNAs.

Transfection was performed as described previously (12). Briefly, each cDNA (200 ng) in minimal essential medium alone (MEM0) was incubated with Lipofectamine for 15 min at room temperature. COS cells (at 0.5 × 105 cells on a 18-mm coverglass that had been prepared 18 h earlier) were washed with MEM0. The DNA and Lipofectamine mixture was added to the cells, which were then incubated for 6 h at 37°C. The medium was changed to MEM containing 10% fetal calf serum (MEM10), and the cells were further incubated for 42 to 46 h at 37°C. The medium was changed to MEM0 4 h before the assay. The MEM0 was removed, and 0.5% chicken red blood cells (CRBCs) were added to the culture, which was then incubated for 15 min at room temperature. Unadsorbed CRBCs were washed out with MEM0 and then examined under an optical microscope.

Immunofluorescent staining of the HA protein expressed on COS cells.

After transfection of each cDNA, the medium was changed to MEM10, followed by further incubation for 42 to 46 h at 37°C. The cells were then fixed with ethanol-acetone (1:1) at 4°C for 15 min or 4% formaldehyde at room temperature for 20 min. Indirect immunofluorescent staining was performed with diluted rabbit sera raised against A/Aichi/68 virus (prepared by M. Ueda and A. Sugiura) and fluorescein isothiocyanate (FITC)-labeled anti-rabbit goat antiserum (Cappel Products; ICN Pharmaceuticals, Inc.).

Fusion assay.

Fusion assay was performed as described previously (17). At 40 h posttransfection, the medium was removed. After the cells were washed with phosphate-buffered saline (PBS), trypsin acetylated from bovine pancreas (Sigma) at 10 μg/ml in PBS was added, and incubation was carried out at 37°C for 30 min. Cells were then washed with PBS and incubated with HEPES buffer (20 mM morpholineethanesulfonic acid and 20 mM HEPES in PBS adjusted to pH 5.0) at 37°C for 60 to 100 s. After removal of the HEPES buffer, 2 ml of MEM5 was added. Cells were further incubated for 5 to 6 h at 37°C and then observed under an optical microscope.

Three-dimensional modeling.

Amino acid positions on the HA structure were drawn by using the RasMol v2.6 program and positioning data of the 1HGG.pdb.

RESULTS

Hemadsorption activity of mutated HA proteins.

The PCR regions of isolated clones of pME18SHA (n/0) and (0/n) were sequenced, and the hemadsorption activity of the cells expressing these pME18S HAs was determined. The PCR regions included no mutations, silent mutations, or nonsense mutations in the coding region. The HA cDNAs with no mutations or silent mutations did not affect the hemadsorption activity, but those with nonsense mutations resulted in the inhibition of hemadsorption. To assess the hemadsorption activity, two assays were independently carried out. Hemadsorption was determined to be positive if 10 to 60% of cells hemadsorbed CRBCs, and determined to be negative if no cells adsorbed CRBCs. An FITC assay of the expressed HA proteins which did not exhibit hemadsorption activity was carried out with polyclonal antibody against the A/Aichi/2/68 virus. Twenty to forty percent of the transfected cells were stained and then divided into two groups according to the fluorescence distribution. In one group, HA proteins were dispersed uniformly throughout the cytoplasm (Fig. 1A), while in another group these proteins appeared mainly around the nucleus (Golgi) or endoplasmic reticulum (ER) (Fig. 1B). In the former group, FITC staining was detected on the cell surface when the cells were fixed with formalin (Fig. 1C), but in the latter group staining on the cell surface was not observed (Fig. 1D). In terms of hemadsorption activity, the defective HA protein could be divided in two groups. One form had a defect that prevented its migration from the ER or Golgi to the cell surface, whereas the other form was able to reach the cell surface but did not show hemadsorption activity, suggesting that a conformational change had occurred around the receptor-binding site.

FIG. 1.

FIG. 1.

Distribution of HA protein that did not show hemadsorption activity. After transfection of mutant HAs which were incapable of hemadsorption, cells were fixed with ethanol-acetone or 4% formamide as described in Materials and Methods. pME18SHA(2/0)#101-transfected cells were fixed with ethanol-acetone (A) or 4% formamide (C), and pME18SHA(2/0)#34-transfected cells were fixed with ethanol-acetone (B) or 4% formamide (D). In panel B, the open triangle indicates staining of the perinuclear region, and the solid triangle indicates staining of ER.

Comparison of amino acid substitution between HA1 and HA2 regions.

We obtained 248 mutants of A/Aichi/68 with a one-point amino acid change. The numbers of changed positions were 5 in the signal peptide, 146 in the HA1 domain, and 70 in the HA2 domain (Fig. 2). For 32 positions, there was more than one amino acid change (Table 1). For different amino acids observed at the same position, the amino acids from the first isolated mutants are shown in Fig. 2. The mutated sites covered the entire region of the HA cDNA. Regarding the HA1 domain, 78 mutants were negative for hemadsorption activity and 68 were positive. With respect to the HA2 domain, 26 mutants were negative but 44 were positive. Among the HA1 mutants that were negative for hemadsorption, 40% were observed on the cell surface, while 60% were retained in the Golgi. On the other hand, 50% of the HA2 mutants that were negative for hemadsorption appeared on the cell surface. We assayed the fusion activity of the HA2 mutants; however, we could not find any mutation affecting fusion under the conditions employed in the present study (described in Materials and Methods).

FIG. 2.

FIG. 2.

Single amino acid substitutions and their effect on hemadsorption activity. HA proteins changed by a single amino acid, which were derived from the HA gene of A/Aichi/68, were analyzed by hemadsorption activity and cellular location, as described in Materials and Methods. Substituted amino acids are shown under the sequence using the one-letter system. Red letters indicate a negative change, and green letters indicate a positive change. The location of the HA of these single HA mutants is also shown under the substitution. An “s” indicates that the mutant HA had moved to the cell surface mainly, and “g” or “e” indicates that the mutant HA remained mainly in the Golgi or ER, respectively.

TABLE 1.

Changed positions and hemadsorption activity of mutant HAa

Activity and position aa
Hemadsorption activity Activity and position aa
Hemadsorption activity
Original Changed Original Changed
Same activity
    −11 K N Positive
L Positive
    −1 I V Positive
T Positive
    6 N K Positive
D Positive
    24 T A Negative
I Negative
    43 V I Positive
A Positive
    52 C R Negative
S Negative
    58 I M Negative
T Negative
    68 D G Negative
V Negative
    76 C S Negative
R Negative
    91 S G Positive
R Positive
N Positive
I Positive
T Positive
C Negative
    120 F Y Negative
S Negative
    125 F L Positive
Y Positive
    133 N Y Negative
K Negative
    136 S C Negative
N Negative
    156 K I Negative
E Negative
N Negative
Q Negative
    170 N D Negative
I Negative
    182 V A Positive
I Positive
    185 P L Negative
S Negative
    191 Q H Negative
R Negative
    205 S F Positive
T Positive
    264 K R Positive
E Positive
    281 C Y Negative
S Negative
    286 G R Negative
E Negative
    294 F L Negative
S Negative
    315 K R Positive
E Positive
Opposite activity
    28 T S Positive
A Negative
    36 V N Positive
A Negative
    51 I T Positive
M Negative
    54 N S Positive
D Negative
    104 D G Negative
N Positive
    230 I V Positive
T Negative
    300 I M Negative
N Positive
a

aa, amino acid(s).

Among natural isolates, the number of changes in amino acids in the HA1 domain has been observed to be about threefold greater than that seen in the HA2 domain. For example, when the A/Aichi/2/99 strain was compared to strain A/Aichi/68, changes were noted at 17% of the amino acid positions in the HA1 domain but at only 6% of the positions in the HA2 domain. The present experiments showed that the high rate of amino acid change in HA1 did not affect the flexibility of the HA1 domain compared to that of the HA2.

Effect of amino acid positions and species.

We found 32 positions at which more than one species of amino acid had been substituted (Table 1). Changes at 25 of these positions allowed the mutants to have same characteristics with respect to HA function despite the difference in the substituted amino acid, but changes at 7 positions resulted in an opposite expression of function. Two residues (i.e., residues 91 and 156) were the sites of multiple amino acid changes as a result of site-directed mutagenesis. The amino acid change at position 91 from Ser to Arg, Gly, Asn, Thr, or Ile did not abolish hemadsorption activity, whereas that from Ser to Cys did. Cys plays an important role in maintaining the structure of the HA protein by means of S-S bonds, especially in the HA1 domain (24). The amino acid change at position 156 from Lys to Glu, Asn, Gln, or Ile resulted in the loss of hemadsorption activity. These results suggested that the effect on hemadsorption activity of an amino acid change on the HA protein primarily depends on the position rather than the species of substituted amino acid.

Comparison of substituted amino acids in the HA protein between mutants obtained in vitro and natural isolates.

Possible mainstream amino acid changes in the H3HA polypeptide of A/Aichi/68 to A/Panama/99 are shown in Fig. 3. Mainstream amino acid changes are assigned to those that became fixed in most of the subsequent isolated strains (21). Strain-specific amino acid changes are shown on the side branch (amino acid positions are not shown). An asterisk or double asterisks after amino acid residues indicates the second or the third amino acid changes at the same positions, respectively. It is evident that amino acid changes in the HA1 domain continuously increased in number with time. However, after 1982, there have been the second and the third sequential amino acid changes at the same residues. For in vitro mutants, negative and positive positions, characterized as such by their ability to induce a negative or positive change, respectively, are indicated on the chart of mainstream amino acid changes with green circles for positive positions and red circles for negative positions. On comparing the natural isolates and in vitro mutants, the amino acid changes were not the same at some positions; however, most positive positions (22 of 26 [88%]) were included among the natural isolates. Of the four negative changes, the substituted amino acid at 156 was the same in in vitro mutants as in natural isolates, but those at positions 190, 260, and 276 had different substitutions. We introduced site-directed mutations at these sites as in natural isolates, and the mutated HAs were then capable of hemadsorption. Therefore, it was suggested that most amino acid changes that had occurred with evolution were limited to the positive changes on the HA protein of A/Aichi/68.

FIG. 3.

FIG. 3.

Possible mainstream amino acid changes of the H3 HA1 from 1968 to 2000. Possible mainstream amino acid changes are shown from A/Aichi/2/68 to A/Panama/2007/99. The numbers on the right side of the mainstream line indicate positions that underwent the second (✽) and the third (✽✽) amino acid changes. The number symbol (#) indicates the changed amino acids of positions 190, 260, and 276 that were different compared to those in Fig. 2. Site-directed mutagenesis was carried out at these sites as described in the text. The position of A/Panama/2007/99 was determined by analyzing many strains isolated during 1999 and 2002.

Amino acid substitution at 156.

We found that an amino acid change at residue 156 from Lys to Glu resulted in the loss of hemadsorption activity of the HA protein. This residue has been described as a changeable position, as determined by egg adaptation (8), as is also the case in natural isolates (13). To confirm the characteristics of this mutant HA, back mutation from Glu to Lys was carried out. As a result, the back mutant HA recovered hemadsorption activity. Furthermore, among the possible amino acid changes by one base mutation at residue 156, we changed from Lys to Gln, Ile, and Asn by site-directed mutagenesis (Table 1). All mutant HA proteins remained in the Golgi and were not observed on the cell surface. Even though most amino acid changes in evolution were limited to those which were positives on the HA protein of A/Aichi/68 as described in the previous section, certain substitutions on the HA molecule promoted a further amino acid change that had been restricted in the original HA protein.

Amino acid substitution at 190.

After 1992 and 1993 seasons, human influenza H3 virus isolated in MDCK cells can no longer agglutinate CRBCs but agglutinates human or goose red blood cells (RBCs) (12, 18). Nobusawa et al. (18) found that a change in amino acid residue 190 from Glu to Asp is responsible for the change of the receptor specificity using HA cDNA of A/Aichi/51/92. However, an amino acid change from Glu to Asp at residue 190 of HA of A/Aichi/68 did not inhibit hemadsorption activity with CRBCs. Therefore, we suggest that multiple amino acid changes on the HA of A/Aichi/68 strain are necessary to change the receptor specificity.

Does accumulation of amino acid changes occur with some order?

In order to get the information whether an accumulation of amino acid changes occur with some order or not, we introduced two-point amino acid changes into HA of A/Aichi/68. Amino acid positions were selected to be observed in mainstream amino acid change, as shown in Fig. 3. Amino acid substitution at position 144 was observed early in mainstream amino acid changes. Therefore, we introduced an additional one-point amino acid change into the 144HA protein as described in Materials and Methods. Figure 4 shows that any additional amino acid changes on the 144 HA did not affect the hemadsorption activity.

FIG. 4.

FIG. 4.

Two-point amino acid substitutions and their effect on hemadsorption activity. These two-point amino acid-substituted HA cDNAs were constructed as described in Materials and Methods. Transfection and hemadsortion assays were as described in Materials and Methods. After incubation of transfected COS cells with CRBCs, cells were washed with PBS. Adsorbed RBCs were measured by determining the absorbance at 540 nm after disruption of these cells with 100 μl of water. The results are shown for vector, 144HA, and (144+x)HA.

Fine structure of antigenic sites.

Table 2 shows the amino acids at antigenic sites substituted during H3HA evolution displayed in Fig. 3. Negative and positive amino acid positions, observed in in vitro mutant HAs, are also presented. Antigenic site A was divided into three smaller subsites: 121 to 126 (A1), 131 to 137 (A2), and 142 to 146 (A3). Amino acid substitutions at residues 127 to 130 and 138 to 141 were not found in the mainstream amino acid changes. Negative changes were observed at residues 120 (vicinity of A1), 130 (between A1 and A2), 139 and 140 (between A2 and A3), and 148 and 151 (after A3). In the A2 site, residues 134 and 136 underwent negative changes. Substitutions at these positions were not found with the mainstream amino acid changes in the natural isolates. Similarly, antigenic site B was divided into B1 and B2 sites. All amino acid changes at residues 152 and 153 in the vicinity of the B1 site and at residue 185 (between B1 and B2) constituted negative changes. In the B1 site, residue 156 displayed a negative change, but the same change at this position was observed in the natural isolates. Residue 156 was as discussed above. Antigenic site C was divided into two sites: residues 53 to 54 (C1) and residues 275 to 278 (C2). Residues 51 (in the vicinity of C1) and 58, 59, and 61(after C1) displayed negative changes. Residues 281 and 282 (after C2) also had negative changes. As reported previously (15), humans might not be able to raise antibodies to antigenic site D (ca. 200 to 215 amino acid positions), which was determined by using mouse monoclonal and mouse-specific antibodies (28). Therefore, we did not consider antigenic site D. Antigenic site E was divided into two sites: residues 62 to 63 (E1) and 78 to 83 (E2). Residues 61 (vicinity of E1); 68, 70, 71, and 76 (between E1 and E2); and 85, 86, 87, and 88 (after E2) displayed negative changes. The amino acid change at residue 79 in the E2 site was not found in the mainstream amino acid changes of natural isolates. As described later, insertion of an amino acid change at position 79 on the HA protein of A/Sydney/97 did not result in hemadsorption activity.

TABLE 2.

Amino acid substitutions in antigenic sites

Antigenic site and finding(s) Amino acid positions and frequencya
Site A A1
A2
A3
    Changed position(s) 121 122 124 126 131 133 135 137 142 143 144 145 146
    Frequency of changes 1 1 2 1 1 3 1 2 1 1 3 2 1
    Negative position(s) 120 127 130 134 136 139 140 148 151 152 153
    Positive position(s) 121 125 128 131 133 135 144 146 147
Site B B1
B2

    Changed position(s) 155 156 157 158 159 160 163 188 189 190 192 193 196 197
    Frequency of changes 2 1 1 2 1 1 1 1 3 1 2 2 2 2
    Negative position(s) 152 153 156 185 190 191
    Positive position(s) 155 157 159 165 188 190 193 198
Site C C1
C2

    Changed position(s) 53 54 57 275 276 277 278
    Frequency of changes 1 1 1 1 2 1 2
    Negative position(s) 58 59 61 276 281 282
    Positive position(s) 53 54 56 57 276 278
Site E E1
E2

    Changed position(s) 62 63 78 82 83
    Frequency of changes 2 1
    Negative position(s) 61 68 70 71 76 79 85 86 87 88
    Positive position(s) 62 65 78 81 82
a

The amino acid residues and frequency of changes on the mainstream changes in Fig. 3 are shown. The negative and positive changes in Fig. 2 are also included. Positive changes of 190 and 276 are described in the text and in the legend for Fig. 3.

Negatively changed positions around antigenic sites locate inner part of the HA molecule.

Fig. 5 shows a three-dimensional structure of the HA monomer that includes antigenic sites. The green coloring shows positions observed in the natural isolates, and the red coloring indicates positions at which the changes were negative, as shown in Table 2. The other amino acid residues are shown in white. For antigenic site A, green positions are located over the red and white positions, but red is used under the green or white positions, to indicate a negative change in the inner portion of the HA molecule. For site B, negative positions are located at the inner portion of the molecule except for position 140. Position 156 is located on the surface; positions 152, 153, and 185 are found in the inner portion; and position 190 is located relatively close to the interior. For site C, negative changes at residues 61, 281, and 282 are within the inner portion. Residues 58 and 59 are located close to the surface. For site E, negative positions are shown within the inner portion of the molecule except for 79, which is located on the surface but just under the amino acid position at 82. From analysis of the three-dimensional structure, negative positions around or within the inner portion of part of the antigenic determinant sites were found to be located at the interior of the HA molecule.

FIG. 5.

FIG. 5.

Fine structure of antigenic sites. Observed amino acid positions in natural isolates (green) and negatively changed positions (red) in Table 2 are shown on a three-dimensional structure of the HA monomer.

Amino acid substitutions on the HA protein of A/Sydney/97.

As described earlier, negative changes were found even in antigenic determinant sites but were not among the mainstream amino acid changes of the H3HA polypeptide. The question is whether amino acid at these positions remain unalterable in recent HA molecules or whether they are now open to the possibility of change, as at position 156. We chose positions 79, 134, and 136 on the HA1 domain. Site-directed mutations were introduced at these positions on the HA molecule of A/Sydney/97 virus, but no hemadsorption activity was observed (data not shown).

DISCUSSION

We isolated 248 single-amino-acid mutant HAs and analyzed them according to their hemadsorption activity and cellular localization. Changes in the mainstream amino acids of the HA2 domain were observed to be about a third of those in the HA1 domain of the natural isolates. The characteristics of the HA2 domain structure are known to be different from those of the HA1 domain (32). Homology in amino acid sequences of the HA2 domain among 15 HA serotypes was higher than that of the HA1 domain (16, 22). Common amino acid positions among the 15 serotypes included 13% in the HA1 domain and 30% in the HA2 domain. We assumed that amino acid changes in the HA1 domain afforded more flexibility in maintaining the functions of the HA protein than did those in the HA2 domain. However, our experiments showed that the high rate of amino acid change in the HA1 domain can be explained simply by a difference in the immune pressure. We did not perform a comparative analysis of HA1 and HA2 mutants in terms of the effective factors for fusion, a process in which the HA2 domain play a more important role than HA1 domain. We checked half of the HA2 mutants for fusion activity without finding any aberrations. Therefore, the target size of the region responsible for fusion might be small. Furthermore, Nobusawa et al. (17), using an HA protein expression system, found that several amino acid changes in the HA fusion domain did not affect fusion activity. Therefore, it is not likely that amino acid changes were more restricted on HA2 than on HA1.

There have been controversial reports concerning antibodies against the HA2 domain (5, 9, 20, 25, 26). Styk et al. (25) reported that human convalescent-phase sera had higher titers in the binding to HA2 than to HA1. In addition, Qiu et al. (20) showed with immunoblot analysis that human convalescent-phase sera contained higher levels of antibodies that bound to HA2 than to HA1. On the other hand, Cox and Brokstad (5) showed that, after vaccination, antibodies were detected to the HA1 subunit but hardly any to the HA2 subunit. We have previously presented evidence that acute and convalescent-phase sera from eight children, admittedly a very small group, did not contain antibodies that bound to the HA2 domain (15). Many monoclonal antibodies against HA2 domain did not have hemagglutination inhibition activity (15); therefore, if antibody against HA2 domain exists, the immune pressure might be very limited.

About half of the mutants with negative changes were retained in the Golgi and did not move to the cell surface. We did not find anything suggestive of the factors responsible for the migration from the Golgi to the cell surface. One-point amino acid mutants remained mainly in Golgi and were only rarely found in the ER. However, in the case of two-point amino acid mutants, amounts found in the ER increased (data not shown). Therefore, we suppose that HA protein with a little conformational change is retained in the Golgi and that with a large conformational change accumulates in the ER.

Twenty-three percent of the nucleotide changes in the coding region failed to result in an amino acid replacement (23). The extent of these changes might not be restricted. Synonymous changes occurring in the HA1 region of the H3HA gene were calculated to be ca. 43% (from the sequence data of Nakajima et al. [13, 14]). It is estimated that surviving amino acid changes from all possible amino acid changes in the HA1 domain in nature were 39.6% [i.e., (1 − 0.43)/(0.77 × 0.43/0.23)]. From our experiments, positive random amino acid changes in the HA1 domain constituted ca. 44% of the total. We did not check the fusion activity of all mutants, but we had difficulty in finding any mutants that had lost this activity. Therefore, viability of the HA mutants with amino acid changes can be estimated to be close to 44%, when immune pressure does not exist. The difference in viability as a result of amino acid change between natural isolates and in vitro mutants may represent immune pressure against the HA protein.

From the analysis of possible structural evolution of the H3 HA since 1968, each antigenic site was divided into smaller parts. Our experiments showed that gaps between portions of each antigenic site were negative with respect to hemadsorption. From analysis of the three-dimensional structure, we determined that negative positions surrounding or internal to the antigenic sites are located at the interior of the HA molecule.

The question is whether amino acids at these positions are still unchangeable in recent HA molecules or whether they can now undergo substitution, as at position 156. We introduced three amino acid changes in A/Sydney/97 HA that were characterized as negative for the A/Aichi/68 HA. Site-directed mutations were introduced at positions 79, 134, and 136 on the HA molecule of A/Sydney/97 virus, but no hemadsorption activity was observed. However, it is necessary to get more data on amino acid substitutions in a recent strain in order to determine whether the negative and positive changes observed on the HA of A/Aichi/2/68 will restrict amino acid substitutions on HAs of future strains.

After 1992 and 1993 seasons, human influenza H3 virus isolated in MDCK cells no longer agglutinates CRBCs but agglutinates human or goose RBCs. Nobusawa et al. (18) found that this characteristic is not related to SAα2,3Gal and SAα2,6Gal specificity and that a change in amino acid residue 190 from glutamic acid to asparatic acid is responsible, as determined in studies with HA cDNA of A/Aichi/51/92. We compared the hemadsorption activity of mutant 190 E/D of A/Aichi/68 with goose RBCs and CRBCs. Mutant 190 E/D of A/Aichi/68 showed weak hemadsorption with CRBCs compared to wild-type HA (data not shown). A similar change of receptor specificity was also observed with the H1N1 virus (11). Morishita et al. (12) found that four amino acid changes from A/USSR/99/77 strain and one amino acid change from A/Yamagata/120/86 strain were responsible for the loss of hemadsorption activity with CRBCs. Therefore, multiple amino acid changes in the A/Aichi/2/68 HA are necessary to change the receptor specificity.

We thought some amino acid changes, even if they did not affect hemadsorption activity, might affect the structure. The distortion of the HA structure from the accumulation of structural change caused by the increase of number of amino acid changes might be moderated by some regulation during the accumulation of amino acid changes. However, two-point amino acid changes on the HA revealed that the amino acid change from position 144 was not regulated. Therefore, in this experiment we did not find any suggestive data about the regulation of the accumulation of amino acid changes on the HA protein. However, the HA structures of A/Aichi/68 and of recent isolates might not be the same because some chimeric HA proteins between A/Aichi/68 and A/SD/97 inhibited hemadsorption activity (data not shown). Therefore, amino acid changes of more than two points should be analyzed to obtain further information about the regulation of the the accumulation of amino acid change during evolution.

As shown in Fig. 3, glycosylation sites were accumulated with evolution. Glycosylation might affect the structure of HA (7); however, in the present study, we did not analyze glycosylation sites.

Acknowledgments

This work was supported in part by a scientific research grant from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.

REFERENCES

  • 1.Bush, R. M., C. A. Bender, K. Subbarao, N. J. Cox, and W. M. Fitch. 1999. Predicting the evolution of human influenza A. Science 286:1921-1925. [DOI] [PubMed] [Google Scholar]
  • 2.Bush, R. M., W. M. Fitch, C. A. Bender, and N. J. Cox. 1999. Positive selection on the H3H3 hemagglutinin gene of human influenza virus A. Mol. Biol. Evol. 16:1457-1465. [DOI] [PubMed] [Google Scholar]
  • 3.Bush, R. M., C. B. Smith, N. J. Cox, and W. M. Fitch. 2000. Effects of passage history and sampling bias on phylogenetic reconstruction of human influenza A evolution. Proc. Natl. Acad. Sci. USA 97:6974-6980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Both, G. W., M. J. Sleigh, N. J. Cox, and A. P. Kendal. 1982. Antigenic drift in influenza H3 hemagglutinin from 1968 to 1980: multiple evolutionary pathways and sequential amino acid changes at key antigenic sites. J. Virol. 48:52-60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cox, R. J., and K. A. Brokstad. 1999. The postvaccination antibody response to influenza virus proteins. APMIS 107:289-296. [DOI] [PubMed] [Google Scholar]
  • 6.Fitch, W. H., R. M. Bush, C. A. Bender, and N. J. Cox. 1997. Longterm trends in the evolution of H(3)HA1 human influenza type A. Proc. Natl. Acad. Sci. USA 94:7712-7718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Gallagher, P. J., J. M. Henneberry, J. F. Sambrook, and M. J. Gething. 1992. Glycosylation requirement for intracellular transport and function of the hemagglutinin of influenza virus. J. Virol. 66:7136-7143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Katz, J. M., C. W. Naeve, and R. G. Webster. 1987. Host cell-mediated variation in H3N2 influenza viruses. Virology 156:386-395. [DOI] [PubMed] [Google Scholar]
  • 9.Kuo, Y. C., J. S. Oxford, and G. C. Schild. 1978. Immunological studies with the HA1 and HA2 polypeptides of influenza A virus haemagglutinin. Exp. Cell Biol. 46:338-354. [DOI] [PubMed]
  • 10.Kok, R. G., D. M. Young, and L. N. Ornston. 1999. Phenotypic expression of PCR-generated random mutations in a pseudomonas putida gene after its introduction into an Acinetobacter chromosome by natural transformation. Appl. Environ. Microbiol. 65:1675-1680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Morishita, T., S. Kobayashi, T. Miyake, Y. Ishihara, S. Nakajima, and K. Nakajima. 1993. Host-specific hemagglutination of influenza A (H1N1) virus. Microbiol. Immunol. 37:661-665. [DOI] [PubMed] [Google Scholar]
  • 12.Morishita, T., E. Nobusawa, K. Nakajima, and S. Nakajima. 1996. Studies on the molecular basis for loss of the ability of recent influenza A(H1N1) virus strains to agglutinate chicken erythrocytes. J. Gen. Virol. 77:2499-2506. [DOI] [PubMed] [Google Scholar]
  • 13.Nakajima, S., K. Nakamura, F. Nishikawa, and K. Nakajima. 1991. Genetic relationship between the HA genes of type A influenza viruses isolated in off-season and later epidemic seasons. Epidemiol. Infect. 106:383-395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Nakajima, S., F. Nishikawa, K. Nakamura, and K. Nakajima. 1995. Analysis of influenza A virus infection in children in Japan during 1983-91. Epidemiol. Infect. 115:591-601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Nakajima, S., E. Nobusawa, and K. Nakajima. 2000. Variation in response among individuals to antigenic sites on the HA protein of human influenza virus may be responsible for the emergence of drift strains in the human population. Virology 274:220-231. [DOI] [PubMed] [Google Scholar]
  • 16.Nobusawa, E., T. Aoyama, Y. Suzuki, Y. Tateno, and K. Nakajima. 1991. Comparison of complete amino acid sequences and receptor-binding properties among 13 serotypes of hemagglutinins of influenza A viruses. Virology 182:475-485. [DOI] [PubMed] [Google Scholar]
  • 17.Nobusawa, E., R. Hishida, M. Murata, K. Kawasaki, S. Ohnishi, and K. Nakajima. 1995. The role of acidic residues in the “fusion segment” of influenza A virus hemagglutinin in low-pH-dependent membrane fusion. Arch. Virol. 140:865-875. [DOI] [PubMed] [Google Scholar]
  • 18.Nobusawa, E., H. Ishihara, T. Morishita, K. Sato, and K. Nakajima. 2000. Change in receptor-binding specificity of recent human influenza A viruses (H3N2): a single amino acid change in hemagglutinin altered its recognition of sialyloligosaccharides. Virology 278:587-596. [DOI] [PubMed] [Google Scholar]
  • 19.Plotkin, J. B., J. Dushoff, and S. A. Levin. 2002. Hemagglutinin sequence clusters and the antigenic evolution of influenza A virus. Proc. Natl. Acad. Sci. USA 99:6263-6268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Qiu, D., G. A. Tannock, R. D. Barry, and D. C. Jackson. 1992. Western blot analysis of antibody responses to influenza virion proteins. Immunol. Cell Biol. 70:181-191. [DOI] [PubMed] [Google Scholar]
  • 21.Raymond, F. L., A. J. Caton, N. J. Cox, A. P. Kendal, and G. G. Brownlee. 1986. The antigenicity and evilution of influenza H1 haemagglutinin from 1950-1957 and 1977-1983: two pathways from one gene. Virology 148:275-287. [DOI] [PubMed] [Google Scholar]
  • 22.Rome, C., N. Zhou, J. Suss, J. Mackenzie, and R. G. Webster. 1996. Characterization of a novel influenza hemagglutinin, H15: criteria for determination of influenza A subtypes. Virology 217:508-516. [DOI] [PubMed] [Google Scholar]
  • 23.Schulz, G. E., and R. H. Schirmer. 1979. Principles of protein structure, p. 165-169. Springer, New York, N.Y.
  • 24.Seagal, M. S., J. M. Bye, J. F. Sambrook, and M. J. Gething. 1992. Disulfide bond formation during the folding of influenza virus hemagglutinin. J. Cell Biol. 118:227-244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Styk, B., G. Russ, and K. Polakova. 1979. Antigenic glycopolypeptides HA1 and HA2 of influenza virus haemagglutinin. III. Reactivity with human convalescent sera. Acta Virol. 23:1-8. [PubMed] [Google Scholar]
  • 26.Styk, B., G. Russ, and K. Polakova. 1979. Antigenic glycopolypeptides HA1 and HA2 of influenza virus haemagglutinin. IV. Immunogenic properties of separated haemagglutinin glycopolypeptides. Acta Virol. 23:9-20. [PubMed] [Google Scholar]
  • 27.Suzuki, Y., and T. Gojobori. 1999. A method for detecting positive selection at single amino acid sites. Mol. Biol. Evol. 16:1315-1328. [DOI] [PubMed] [Google Scholar]
  • 28.Tonegawa, K., E. Nobusawa, K. Nakajima, T. Kato, T. Kutsune, K. Kuroda, T. Shibata, Y. Harada, A. Nakamura, and M. Itoh. 2003. Analysis of epitope recognition of antibodies induced by DNA immunization against hemagglutinin protein of influenza A virus. Vaccine 21:3118-3125. [DOI] [PubMed] [Google Scholar]
  • 29.Underwood, P, A. 1982. Mapping of antigenic changes in the haemagglutinin of Hong Kong influenza (H3N2) strains using a large panel of monoclonal antibodies. J. Gen. Virol. 62:153-169. [DOI] [PubMed] [Google Scholar]
  • 30.Wang, M. L., J. J. Skehel, and D. C. Wiley. 1986. Comparative analysis of the specificities of anti-influenza hemagglutinin antibodies in human sera. J. Virol. 57:124-128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wiley, D. C., I. A. Wilson, and J. J. Skehel. 1981. Structural identification of the antibody-binding sites of Hong Kong influenza hemagglutinin and their involvement in antigenic variation. Nature 289:373-378. [DOI] [PubMed] [Google Scholar]
  • 32.Wilson, I. A., J. J. Skehel, and D. C. Wiley. 1981. Structure of the haemagglutinin membrane glycoprotein of influenza virus at 3 Å resolution. Nature 289:366-373. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES