Regulation of Expression of Cellulosomal Cellulase and Hemicellulase Genes in Clostridium cellulovorans

Abstract

The regulation of expression of the genes encoding the cellulases and hemicellulases of Clostridium cellulovorans was studied at the mRNA level with cells grown under various culture conditions. A basic pattern of gene expression and of relative expression levels was obtained from cells grown in media containing poly-, di- or monomeric sugars. The cellulase (cbpA and engE) and hemicellulase (xynA) genes were coordinately expressed in medium containing cellobiose or cellulose. Growth in the presence of cellulose, xylan, and pectin gave rise to abundant expression of most genes (cbpA-exgS, engH, hbpA, manA, engM, engE, xynA, and/or pelA) studied. Moderate expression of cbpA, engH, manA, engE, and xynA was observed when cellobiose or fructose was used as the carbon source. Low levels of mRNA from cbpA, manA, engE, and xynA were observed with cells grown in lactose, mannose, and locust bean gum, and very little or no expression of cbpA, engH, manA, engE, and xynA was detected in glucose-, galactose-, maltose-, and sucrose-grown cells. The cbpA-exgS and engE genes were most frequently expressed under all conditions studied, whereas expression of xynA and pelA was more specifically induced at higher levels in xylan- or pectin-containing medium, respectively. Expression of the genes (cbpA, hbpA, manA, engM, and engE) was not observed in the presence of most soluble di- or monosaccharides such as glucose. These results support the hypotheses that there is coordinate expression of some cellulases and hemicellulases, that a catabolite repression type of mechanism regulates cellulase expression in rapidly growing cells, and that the presence of hemicelluloses has an effect on cellulose utilization by the cell.

The major components of plant cell walls are cellulose, hemicellulose, and lignin, with cellulose being the most abundant component, followed by hemicelluloses. Cellulose consists of long polymers of β-1,4-linked glucose units and forms a crystalline structure, whereas the structure of hemicelluloses is more variable. Hemicelluloses include xylan consisting of β-1,4-linked xylose units, glucomannans consisting of β-1,4-linked glucose and mannose units, and arabinans and galactans in which the main chain sugars include arabinose and galactose, respectively. The cellulolytic bacteria produce a set of enzymes (called cellulosomes) which synergistically hydrolyze crystalline cellulose and hemicelluloses to smaller oligosaccharides and finally to monosaccharides (6, 7, 13, 15, 16, 18, 33, 36).

Clostridium cellulovorans, an anaerobic, mesophilic, and spore-forming bacterium, is one of the most efficient cellulolytic organisms (30). The cellulases and hemicellulases [we will abbreviate these two terms together as (hemi-)cellulases] produced by C. cellulovorans have been studied extensively. Several cellulases (family 5 and 9 endoglucanases and a family 48 exoglucanase), a mannanase, a xylanase, and a pectate lyase have been characterized (6, 16, 18, 33). The genes encoding a cluster of cellulosomal subunits, i.e., the gene cbpA encoding a scaffolding protein, the gene exgS encoding exoglucanase (18), the genes engH, engK, and engM encoding endoglucanases, the gene hbpA encoding a hydrophilic domain and a cohesin (31), and the gene manA encoding a mannanase (28), have been cloned and sequenced. The gene engE encoding an endoglucanase (34), the gene xynA encoding a xylanase (16), and the gene pelA encoding a pectate lyase are not linked to the gene cluster (6, 29, 32), although they are cellulosomal enzymes.

Since plant polysaccharides are the most abundant renewable biomass, cellulolytic microorganisms play a very major role in carbon turnover in nature. It is important to understand how bacteria regulate expression of the various hydrolytic enzymes in order to produce optimal enzyme mixtures for the degradation of different plant materials. Expression of the cellulase genes of C. cellulovorans has been studied at the protein level (8, 17, 22). Only a few studies concerning regulation of the (hemi-)cellulases of C. cellulovorans have been carried out (1, 9). Therefore, many fundamental questions still remain to be answered at the transcriptional level, such as whether the expression of the different (hemi-)cellulases is coordinately regulated by a shared mechanism and whether a low level of constitutive expression of (hemi-)cellulases occurs under all conditions. Preliminary evidence indicated that constitutive synthesis of cellulosome components occurred when cells were grown in the presence of glucose (22). Mechanisms of true induction or repression have not been studied in depth. For these reasons, we have addressed some of the questions related to (hemi-)cellulase gene expression in C. cellulovorans in this paper.

MATERIALS AND METHODS

Bacterial strain and growth conditions.

C. cellulovorans ATCC 35296 was used as the source of genomic DNA and total RNA. The organism was grown under strictly anaerobic conditions at 37°C in round-bottom flasks containing a previously described medium (28, 30), which included either di- or monomeric sugars (fructose, glucose, mannose and galactose, lactose, maltose, sucrose, and cellobiose; 0.5%, wt/vol) or polymeric sugars (microcrystalline cellulose [Avicel], locust bean gum, xylan, and pectin; 1%, wt/vol). Avicel was purchased from FMC Corporation. Locust bean gum, xylan (birch wood), and pectin (apples) were purchased from Sigma.

Bacterial protein determination.

The determination of cell mass in cultures grown with cellobiose, cellulose, locust bean gum, pectin, and xylan was based on bacterial-protein estimation as described by Bensadoun and Weinstein (3; see also reference 5). A 500-μl aliquot was centrifuged for 10 min at 13,000 × g. The pellets were washed with 500 μl of sodium phosphate buffer (50 mM, pH 7.0) and incubated with 400 μl of sodium deoxycholate (2%) for 20 min. One hundred microliters of trichloroacetic acid (24%) was added to the suspension, which was centrifuged at 13,000 × g for 10 min. The protein concentration was measured by using the BCA Compat-Able protein assay kit (Pierce) with bovine serum albumin as the standard.

Nucleic acid isolation.

Chromosomal DNA of C. cellulovorans was isolated by using a genomic DNA purification kit (Promega) according to the manufacturer's instructions. Total RNA was extracted from C. cellulovorans broth cultures by using an RNeasy kit (QIAGEN) with the additional step of treatment with RNAlater RNA stabilization reagent (Ambion), and RNase-free DNase (Promega) according to the manufacturers' instructions.

Northern blot analysis.

RNA samples (up to 20 μg) were denatured in RNA sample buffer (250 μl of formamide, 83 μl of 37% [wt/vol] formaldehyde, 83 μl of 6× loading dye [Promega], 50 μl of 10× morpholine propanesulfonic acid [MOPS] buffer [20 mM MOPS, 5 mM sodium acetate, 1 mM EDTA {pH 7.0}], and 34 μl of distilled water) at 65°C for 10 min and separated through 1% agarose gels in MOPS buffer with 17% (vol/vol) formaldehyde. DNA probes were synthesized by PCR by using specific oligonucleotides derived from the C. cellulovorans sequence as a template (Table 1). The probes were nonradioactively labeled by random priming by using digoxigenin (DIG) High Prime (Roche). To add the correct amount of probe to a hybridization, serial dilutions (0.05 to 10 pg) of each probe were spotted on a nylon membrane and labeling sensitivity (amount of labeled DNA per spot) was determined. RNA was transferred overnight to a positively charged nylon membrane (Roche) by capillary transfer by using 20× standard saline/citrate (0.3 M NaCl plus 0.03 M sodium citrate, pH 7). Hybridization was carried out for 16 to 20 h at 50°C in DIG Eazy Hyb buffer solution (Roche). Washing of the membrane and detection of specific transcripts on the blots were carried out by using the DIG luminescent detection kit (Roche) and its protocol.

TABLE 1.

PCR primers used for amplification of reverse transcripts and synthesis of gene-specific probes

Gene	Enzyme encoded	5′ primer	3′ primer	GenBank accession no. (reference[s])
cbpA	Cellulose binding protein	ATGCAAAAAAAGAAATCGCTG	GGTTGATGTTGGGCTTGCTGTTTC	M73817 (29)
engH	Endoglucanase H	GGTGAAACAACAGCGACTCCAACA	GCCCCAAGAATCCATCCAAGCTAA	U34793 (20, 35)
hbpA	Hydrophobic protein A	AGTATTGGCGTAGTAGTTGCAGGC	GTGCGTTATCGGTGAAAGCTCCAA	AF132735 (32, 35)
manA	Mannanase A	AGATGCTGAATTGAAGGCGGCAGA	CTCCACTCCACTTCATACTTGCAC	AF132735 (32, 35)
engM	Endoglucanase M	ATGATGGAGTAGAGGGAAGATGGG	GCGTTCAGCATAAGGCATCGTT	AF132735 (32, 35)
engE	Endoglucanase E	TACTGATGACTGGGCTTGGATGAG	GTTGCTTTCGCTGCTGC	AF105331 (34)
xynA	Xylanase	TGTTAGCCTCTTCTGC	GATTCCAAGTGCCATAGC	AF435978 (18)
pelA	Pectate lyase A	TGATGCACCAAAAACAGCGC	CAGTAGAAGAGCATCAAGCC	AF105330 (33)
engF	Endoglucanase F	TGGTCTACAATGGTTTCCTGGG	GCATCATTCGTTACTCCACC	U37056 (27)
arfA	α-l-arabinofurasnosidase	ATGGAGGATTTTGGGTTGGG	TCGGTGACTCTCCATC	AY128945 (16)

RNA slot blot analysis.

Total RNAs were diluted into appropriate concentrations with water, followed by the addition of two times the volume of the RNA sample buffer. After being incubated for 10 min at 65°C to denature the RNA, the samples were applied to a positively charged nylon membrane (Roche) by using a Hybri-slot apparatus (Gibco-BRL) and the membrane was baked for 30 min at 120°C under vacuum. Filters were hybridized with specific probes as described for the Northern blot analyses.

RT-PCR analysis.

Reverse transcriptase (RT) reactions were performed with total RNA by using a commercially available reverse transcription system (Promega) with slight modifications to the recommended protocol. RT reactions were performed in a final volume of 20 μl, which contained 5 mM MgCl₂, 1× RT buffer (10 mM Tris-HCl [pH 9. 0], 50 mM KCl, and 0.1% Triton X-100), 1 mM (each) deoxynucleoside triphosphates, 1 U of recombinant RNasin RNase inhibitor, 15 U of avian myeloblastosis virus reverse transcriptase, 0.25 μM oligonucleotide primer, and 10 μg of substrate RNA. The reaction mixtures were incubated at 42°C for 60 min, and reactions were terminated by heating the mixtures at 95°C for 5 min, followed by incubation on ice for 5 min. The cDNA products were then amplified in 25-μl PCR mixtures by using 2.5 μl of the RT reaction mixture as the template.

RESULTS

Relative expression levels of (hemi-)cellulase genes at different growth phases.

To determine whether the (hemi-)cellulase genes are regulated coordinately, changes in the expression levels of several (hemi-)cellulase genes were monitored during the cultivation of C. cellulovorans on either cellulose or cellobiose as the sole carbon source. RNA was prepared from the culture at different stages of growth. The RNA was subjected to Northern blot analyses using probes that were specific to the cbpA-exgS, engE, xynA, pelA, arfA, and engF genes. These genes represent major subunits (cbpA-exgS and engE) (8, 20, 29, 34), one of the hemicellulase genes (xynA) (18), and the pectate lyase gene (pelA) (33). Two noncellulosomal genes, engF (27) and the α-l-arabinofuranosidase gene arfA (16), were also tested as control-endoglucanase genes.

A semiquantitative measure of the level of cbpA mRNA, using DIG-labeled probes and RNA isolated at different times during cell growth, was obtained by Northern blot analysis (Fig. 1A and B). The intensities of the bands were close approximations of their relative abundance. The levels of cbpA mRNA increased simultaneously from early to middle exponential phase and dramatically decreased during the early stationary phase when the cells were grown on cellobiose (Fig. 1A and B, lanes 1 through 5). As with cbpA gene expression, the cells contained high levels of engE, xynA, and engF mRNAs during most of the exponential growth phase, with the level being the highest at the middle of the exponential phase (Fig. 1A and B). Cellobiose clearly induced the expression of the (hemi-)cellulase genes after a rather short lag period. Reduced expression was observed at a later stage of growth, but the arfA mRNA level increased when the cells reached the stationary growth phase (Fig. 1A and B, lane 5). The arfA transcript was also observed at the end of the stationary phase (Fig. 1A and B, lane 8). Cellobiose did not induce the expression of pelA during the entire growth phase (Fig. 1B).

FIG. 1.

Relative levels of (hemi-)cellulase transcripts at different growth phases on cellobiose culture. (A) C. cellulovorans growth curve. (B) Northern blot analyses were conducted with 5-μg concentrations of RNA isolated from C. cellulovorans cultures grown on 0.5% cellobiose as the sole carbon source. The numbers of the lanes correspond to the numbers over the growth curve points shown in panel A. Ethidium bromide staining of rRNA is shown as a loading control. (C) The different DIG-labeled probes were prepared (each from 1 μg of template) by random primed labeling (see Materials and Methods). Dilutions (0.05 to 5 pg) of each probe were spotted on a nylon membrane, and labeling sensitivity (amount of labeled DNA per spot) was determined in order to use similar amounts of each probe.

In addition, a similar analysis of Northern blots of cultures grown on 1% cellulose showed the highest levels of expression of cbpA, engE, xynA, and engF at the middle of the exponential phase (Fig. 2A and B). Thereafter, the expression levels decreased markedly as the cells entered the stationary phase. After further incubation (190 h), the transcripts were hardly detectable. However, for arfA expression, the highest level of transcripts was observed from late-exponential-phase cells (Fig. 2A and B, lane 6). In RNA from the early stationary and late stationary growth phases, the arfA transcript was clearly observed (Fig. 2A and B, lanes 7 and 8). With the pelA probe, very weak hybridization signals were observed only during the late exponential phase (Fig. 2A and B, lane 6). Furthermore, when cultured on pectin and xylan, the growth pattern was similar to that of cells grown on cellulose (data not shown). The close correlation between the time course of transcription of cbpA, engE, and xynA supports the idea that cellulase and hemicellulase genes are produced simultaneously for plant cell wall degradation.

FIG. 2.

Relative levels of (hemi-)cellulase transcripts at different growth phases on cellulose culture. (A) Growth curve of C. cellulovorans. (B) Northern blot analyses were conducted with 5-μg concentrations of RNA isolated from C. cellulovorans cultures grown on 1% cellulose as the sole carbon source. The numbers of the lanes correspond to the numbers over the growth curve points in panel A. Ethidium bromide staining of rRNA is shown as a loading control. The probes were labeled to a similar sensitivity, and the labeling sensitivity method corresponds to that described in Fig. 1C.

Induction of (hemi-)cellulase genes in response to di- or monomeric sugars.

To determine whether carbon sources activate (hemi-)cellulase gene transcription, C. cellulovorans cells were grown to exponential phase in medium containing either 0.5% monosaccharide (fructose, glucose, mannose, and galactose), 0.5% disaccharide (lactose, maltose, sucrose, and cellobiose), or 1% polysaccharide (cellulose, locust bean gum, pectin, and xylan) as the sole carbon source. RT-PCR analysis was performed using various primer pairs specific for the cbpA, engH, manA, engE, and xynA transcripts. To ensure that the resulting PCR products were amplified from cDNA instead of contaminating chromosomal DNA, control experiments were performed in which RT was omitted. In these controls, no PCR fragments were detected (data not shown). RT-PCR with RNA from fructose-, lactose-, mannose-, cellobiose- and cellulose-grown cells revealed very similar patterns with all (hemi-)cellulase mRNAs tested (Fig. 3). Fructose and lactose moderately induced expression of cbpA, engH, manA, engE, and xynA (Fig. 3, lanes 2 and 5), while mannose weakly induced cellulase gene transcription (Fig. 3, lane 4). When cellulose and cellobiose were contained in the medium as positive controls, all genes (cbpA, engH, manA, engE, and xynA) were clearly expressed (Fig. 3, lanes 8 and 9). No cDNA (cbpA, engH, manA, engE, and xynA) was detected with RNA isolated from glucose-, galactose-, maltose-, and sucrose-grown cells. The pelA mRNA was not induced from any di- or monosaccharide (Fig. 3).

FIG. 3.

RT-PCR analysis of (hemi-)cellulase transcripts produced in C. cellulovorans grown on different sugars. Total RNA (1 μg) was isolated from C. cellulovorans cultivated on media containing 0.5% monosaccharides (lanes 1 through 4; glucose, fructose, galactose, and mannose), 0.5% disaccharides (lanes 5 through 8; lactose, maltose, sucrose, and cellobiose), or 1% cellulose (lane 9) as the sole carbon source. Primers specific for the cbpA, engH, engE, or xynA genes were used to amplify fragments by PCR. In the negative controls, the reactions were performed in the absence of RT or RNA templates (data not shown).

Induction of (hemi-)cellulase genes in response to polymeric sugars.

The media used to produce cellulosomal (hemi-)cellulases in C. cellulovorans are based on mixtures of plant materials or cellulose (24). The levels of certain (hemi-)cellulases have been reported to be dependent on the growth substrate (6, 17, 22). These materials, particularly the insoluble substrates, tend to interfere with the estimation of cell mass and the isolation of RNA and are often undefined in nature. To study the effect of polymeric substrates on the relative expression of (hemi-)cellulases in greater detail, RNAs from C. cellulovorans grown on four different insoluble polysaccharides were selected for study on the basis of their gene products and their target substrates (i.e., cellulose and CbpA, locust bean gum and ManA, pectin and PelA, and xylan and XynA). The probe fragments were amplified by PCR with specific primers to obtain fragments of similar length from each gene, and these were labeled to provide a similar sensitivity in order to allow comparison of the relative expression levels of the (hemi-)cellulase genes studied (Fig. 4C).

FIG. 4.

RNA slot blot analysis of the expression of cbpA, manA, xynA, and pelA genes in C. cellulovorans grown on the different polysaccharides. Total RNA (50 and 500 ng) (A) and total protein (B) were isolated from C. cellulovorans cultivated on media containing 1% cellulose (48-h culture, panel A, lane C), 1% locust bean gum (18-h culture, panel A, lane M), 1% pectin (18-h culture, panel A, lane P), or 1% xylan (18-h culture, panel A, lane X) as the sole carbon source. The gene-specific probes used are indicated on the left of panel A. The different DIG-labeled probes were prepared (each from 1 μg of template) by random primed labeling (see Materials and Methods). Dilutions (0.1 to 10 pg) of each probe were spotted on a nylon membrane, and labeling sensitivity (amount of labeled DNA per spot) was determined in order to use similar amounts of the probes (C).

Significant expression of many genes (cbpA, manA, xynA, and/or pelA) was observed when cells grew on the polymeric substrates (Fig. 4A). In the presence of cellulose, cbpA and manA transcripts were strongly induced (Fig. 4A, lane C). Although cellulose induced the xynA gene, the level of expression of xynA was higher in cells cultured on xylan (Fig. 4A, lane X). Very few pelA transcripts were found with the cellulose-grown culture. Although the cell mass on locust bean gum (galactomannan)-containing medium was the highest (Fig. 4B, lane M), the transcription of all tested genes was low (Fig. 4A, lane M). Pectin was clearly observed to stimulate the expression of pelA transcripts (Fig. 4A, lane P). Pectin is also an inducer for cellulase genes such as cbpA and engE (Fig. 5). Both the 8-kb (cbpA-exgS) and 12-kb (cbpA-exgS-engH-engK) transcripts from the cbpA gene cluster were present (Fig. 5, lane 1) (9). Relatively, many fewer pelA transcripts were detected, however, when the bacterium was cultured on cellulose, locust bean gum, or xylan (Fig. 4A, lane P). These results indicated that polymeric substrates generally induced polymer-specific degrading enzymes, but interestingly, pectin and xylan did induce a number of cellulase genes.

FIG. 5.

Northern hybridization of C. cellulovorans RNA. Total RNA was isolated from cells grown in the presence of 1% pectin as the sole carbon source. RNA (10 μg) was subjected to electrophoresis through 1.5% formaldehyde gels and transferred to nylon membranes, which were subsequently hybridized with the DIG-labeled cbpA (lane 1-2), engH (lane 2)-, engE (lane 3)-, and pelA (lane 4)-specific probes. The ovals represent full-length specific transcripts. The sizes of the RNA markers (M) are indicated at the left in bases.

Glucose repression of (hemi-)cellulase gene expression.

It was reported previously that synthesis of cellulosomes was reduced when glucose was used as the growth substrate (4, 22). To determine whether glucose acts by repressing transcription of (hemi-)cellulase genes, we performed Northern blot analysis with intragenic probes derived from cbpA, manA, and engE. Glucose (final concentration, 0.25%) was added to actively growing cellulose (final concentration, 0.5%) cultures at 68 h of cultivation, when the cellulolytic system of this bacterium was being actively produced. Total cellular RNA was isolated from cells grown in cellulose-containing medium before and after addition of glucose. An increase in the cell mass was observed immediately after addition of the glucose, indicating that the bacteria started growing at the expense of glucose (Fig. 6A). cbpA, manA, and engE gene expression was almost completely repressed in cellulose cultures after addition of glucose until the culture was incubated for 10 h at 37°C (Fig. 6B). However, the cbpA, engE, and manA transcripts were detected at low levels again after 10 h of incubation (Fig. 6B, lane 5). Thus, cellulase transcription was repressed when glucose was present but was derepressed upon exhaustion of glucose in the medium. This is the first transcriptional analysis that reports that soluble carbohydrates cause a rapid repression of cellulose-inducible systems of C. cellulovorans.

FIG. 6.

Growth curve (A) showing the time course of cbpA, manA, and engE transcription during growth of C. cellulovorans on cellulose medium with subsequent glucose supplementation ([graphic]) and without glucose supplementation ([graphic]), as determined by Northern blot analysis (B). Total RNA (5 μg) was isolated from cells grown on 1% cellulose medium without additional glucose (lanes 1 and 2) or supplemented with 0.5% glucose (lanes 3 through 5) and hybridized to specific probes. The number of the band in panel B corresponds to the number on the C. cellulovorans growth curve in panel A. The probes were labeled to a similar sensitivity, and the labeling sensitivity method corresponds to that described in Fig. 4C.

Di- or monomeric sugar repression of (hemi-)cellulase gene expression.

In order to confirm the existence of a repressive effect of additional di- or monomeric sugars other than glucose on the (hemi-)cellulolytic system of C. cellulovorans, the cells were grown to exponential phase in 1% cellulose-containing medium. Subsequently, 0.5% monosaccharides (fructose, glucose, mannose, and galactose) and 0.5% disaccharides (lactose, maltose, sucrose, and cellobiose) were added to fully induced cellulose-based cultures (final concentration, cellulose to added carbon, 2:1 [wt/wt], 0.5 to 0.25% [wt/wt]). We also tested 1 mM sophorose and 1% cellulose as controls. A significant reduction in the cellulase transcripts was observed after the sugar addition in most cases, in contrast to the transcription level in the cellulose control (Fig. 7B and C). When cellulose media were supplemented with glucose, lactose, or sucrose, the level of cellulase gene expression (i.e., cbpA, manA, and engE) was greatly reduced after 1 h of incubation, although the inclusion of cellobiose, fructose, galactose, maltose, mannose, or sophorose in cellulose medium did not repress the synthesis of these mRNAs as much (Fig. 7C, left panel). In addition, the cbpA and engE transcripts were detected at low levels at 1 h of incubation and increased after 7 h of incubation (Fig. 7C, right panel). A similar analysis using RT-PCR, a less quantitative measure but with relatively high sensitivity on low levels of mRNAs, showed the same pattern of (hemi-)cellulase transcription after 7 h of incubation (Fig. 7B). No significant change in xynA and pelA transcription was detected before or after addition of carbon compounds under all conditions tested (Fig. 7B and C). The total cell protein concentration in the culture on all carbon sources tested was not significantly different (Fig. 7A).

FIG. 7.

Effect of added di- or monosaccharides on (hemi-)cellulase transcription in cellulose medium, as determined by RT-PCR analysis and RNA dot blot analysis. The numbers of the bars on the graph (A) correspond to different sugars (1 through 10: glucose, fructose, galactose, mannose lactose, maltose, sucrose, cellobiose, sophorose, and cellulose) and to the numbers of the bands in RT-PCR analysis (B) and RNA dot blot analysis (C). Total protein and total RNA (1 μg) was isolated from cells grown in 1% cellulose medium at 1 and 7 h of incubation after supplementation with 0.5% monosaccharides (panels B and C, lanes 1 through 4: glucose, fructose, galactose, and mannose), 0.5% disaccharides (panels B and C, lanes 5 through 8: lactose, maltose, sucrose, and cellobiose), 1 mM sophorose (panels B and C, lane 9) and 1% cellulose (panels B and C, lane 10). The probes for RNA dot blot analysis (C) were labeled to a similar sensitivity, and the labeling sensitivity method corresponds to that described in Fig. 4C.

Polymeric carbon compound repression of (hemi-)cellulase gene expression.

These studies were carried out to determine the effects of hemicellulose polymers and pectin on cellulose degradation. The repressing or inducing action of additional polysaccharides on (hemi-)cellulase gene expression was shown by addition of polysaccharides to fully induced cellulose-based mid-log-phase cultures (final concentration, cellulose to additional carbon, 1:1 [wt/wt], 0.5 to 0.5%). The responses of cbpA, manA, xynA, and pelA transcriptions to added carbon sources on cellulose culture were analyzed by RNA slot blotting (Fig. 8A) after an additional 18 and 32 h of incubation (Fig. 8B). The growth rates indicate that cells grew most rapidly on mannan, pectin, and xylan in decreasing fashion upon addition of these polymers to the cellulose culture (Fig. 8B). Upon addition of locust bean gum (mannan) or xylan to cellulose cultures, cbpA transcription was repressed upon an additional 18 h of incubation and derepressed after 36 h of incubation (Fig. 8A, lanes M and X). Addition of pectin repressed cbpA transcription only slightly. Although the locust bean gum (galactomannan) is a favored substrate for mannanase (ManA) (32), the addition of mannan depressed manA transcription after an additional 18 h of incubation (Fig. 8A, lane M). However, manA transcription was clearly detected again after 36 h of incubation. On the other hand, the data showed that the supplemented xylan induced xynA after both 18- and 36-h incubation periods (Fig. 8A, lane X). Low pelA transcription was detected in medium supplemented with pectin at 18 and 36 h (Fig. 8A, lane P). These results indicated that the presence of hemicellulosic polymers could differentially affect genes for the utilization of cellulose.

FIG. 8.

Effect of added polysaccharides on (hemi-)cellulase transcription in cellulose medium, as determined by RNA dot blot analysis. Total RNA (1 μg) (A) and total protein (B) were isolated from cells grown in 20 ml of 1% cellulose medium supplemented with 20 ml of 1% cellulose (panels A and B, lane C), locust bean gum (panels A and B, lane M), pectin (panels A and B, lane P), or xylan (panels A and B, lane X). The probes were labeled to a similar sensitivity, and the labeling sensitivity method corresponds to that described in Fig. 4C.

DISCUSSION

For investigation of the expression pattern of (hemi-)cellulase genes, mRNA was isolated from cells from continuous cultures taken at various time points. The data demonstrate general and specific regulatory patterns in expression of (hemi-)cellulase genes by C. cellulovorans, including features of their relative expression levels under different culture conditions, i.e., various carbon sources and growth phases. For instance, cellulose and cellobiose induced the transcription of most of the (hemi-)cellulase genes (i.e., cbpA-exgS-engH-engK, manA, engE, and xynA) and the time course of each (hemi-)cellulase gene transcription was approximately the same in all cases. This is the first report at the transcriptional level that the (hemi-)cellulase genes in a clostridial (hemi-)cellulolytic system that included cbpA-exgS (9), engEi, and xynA are coordinately expressed when various substrates such as cellobiose and cellulose are used (Fig. 1 and 2). It was also found that the expression of the noncellulosomal cellulase gene, engF, was regulated just as other cellulosomal cellulase genes were regulated (Fig. 1 and 2). However, through visual inspection of Northern blot analysis (Fig. 1 and 2), the time courses of endoglucanase gene expression (engE and engF) were thought to be greatly different from those of the noncellulosomal α-l-arabinofurasnosidase gene arfA. Cellulose and hemicellulose are closely associated in nature, and it appears that C. cellulovorans has a mechanism(s) to ensure efficient utilization of both types of polymers. These results suggest that a common regulatory mechanism may exist at the transcriptional level for (hemi-)cellulase induction by cellulose and cellobiose. A cellulose metabolite such as cellobiose or a derivative of cellobiose may act as an inducer and may bind to a receptor protein in a signal transduction pathway, and this pathway may then lead to cellulase induction.

Significant expression of most of the genes was observed with polysaccharide substrates such as cellulose, pectin, and xylan, followed by moderate levels with other substrates such as cellobiose and fructose. Low levels of (hemi-)cellulase mRNAs derived from cells grown with lactose, mannose, and locust bean gum (mannan) were observed, and little or no expression was detected with cells grown on glucose, galactose, maltose, and sucrose. These results give a general picture of the potential for (hemi-)cellulase expression when cells are grown on different carbon sources. It was thought that cellulase expression would not occur on carbon sources that promoted rapid growth but would be stimulated by polysaccharides that were difficult to degrade (14, 24). It is noteworthy that expression of cbpA-exgS and engE was especially strong under all conditions tested. The relative transcript levels of the different cellulase genes were comparable to the amounts of the specific proteins produced in the culture medium. This finding is in accordance with previous data on optimization of enzyme production, which showed that the highest CbpA, ExgS, and EngE activity levels were present when cells were grown on cellulose (8, 20, 22). In the general model for the induction of cellulase and hemicellulase expression, a sensor enzyme is constitutively expressed which hydrolyzes cellulose and/or hemicellulose into oligosaccharides that enter the bacterium and activate the expression of the (hemi-)cellulase genes (31, 35). The present observations indicate that (hemi-)cellulase genes in C. cellulovorans are expressed constitutively at low levels but are induced to express at higher levels in the presence of certain polysaccharides, such as cellulose. It has been reported that a basal constitutive level of cellulosomal proteins was synthesized when the cells were grown with glucose or cellobiose (4, 22). These cellulases were secreted into the extracellular culture medium at a very low rate over a long period of incubation (2, 6, 22). These results are not contradictory to our present transcriptional analyses, since it is difficult to analyze the extremely low levels of transcripts (e.g., fewer than 10 strands of mRNA per cell) by methods such as Northern blotting or RT-PCR. The constitutive level of (hemi-)cellulase expression is therefore very low. This type of result has also been reported for other glucose catabolite-repressed systems where proteins were detected but their mRNAs could not be detected (12, 21). Our results indicated that certain carbon sources induced high levels of expression of one gene or a set of genes, whereas the effect on expression of other genes was weak or insignificant. This pattern varied depending on the carbon source. Although being a general inducing compound for (hemi-)cellulases, cellulose induced expression of the cellulase genes, such as cbpA and engE, most strongly. This may be an effect caused by cellobiose, other oligosaccharides, or derivatives of cellobiose that are formed in the cell. The expression of hemicellulase genes (manA and xynA) in cellulose-based medium could be induced by cellulose or by certain contaminants in the commercial preparations of cellulose (10). Xylan especially caused expression of the hemicellulase genes, such as xynA and manA, and was the most potent carbon source for induction of the xylanase gene (xynA). On the other hand, although cellulose and xylan did not act as inducers for the pectate lyase A gene, pectin definitely induced pelA gene expression. Thus, these results indicated that certain polymeric substrates were capable of activating specific genes.

The induction and repression of cellulases by mixed substrates of cellulosic and hemicellulosic sugars reported here is interesting. In the degradation of lignocellulosic substrates by microorganisms, it has been established that the first growth phase is developed at the expense of hemicelluloses and that the cellulase system is developed in a second stage (11, 19). It is feasible that the products of certain hemicellulose degradation, especially locust bean gum, could act as repressors of the cellulolytic system at high concentrations and that as their concentrations drop to low levels, the cellulolytic system is derepressed. This could explain the rapid pattern of growth on hemicelluloses and the sequence of enzyme production of hemicellulases and cellulases. This fact also supports the idea of an interrelationship between the systems regulating (hemi-)cellulases in this bacterium. The observed repression of cellulases by high glucose and cellobiose concentrations is similar to that found for other cellulolytic bacteria (23, 26). However, hemicellulose repression of the cellulolytic activity of cellulose cultures has not been reported previously. This might indicate a hierarchical relationship between the systems regulating cellulases and hemicellulases which would be particularly important in the degradation of complex lignocellulosic materials in nature.

Certain di- or monosaccharides (i.e., fructose, lactose, and cellobiose) induced expression of (hemi-)cellulase genes in C. cellulovorans. The cellulolytic bacteria like C. thermocellum were reported to produce cellulases when grown with soluble carbon sources such as fructose, glucose, and cellobiose (25). Nevertheless, the usual pattern observed with C. cellulovorans was the lack of expression of (hemi-)cellulases in the presence of the easily metabolizable mono- or disaccharides such as glucose, and a catabolite repression-type mechanism seems to exist which mediates control of expression of various genes encoding different extracellular hydrolases as well as the scaffolding protein.