Skip to main content
PMC home page
Neoplasia (New York, N.Y.) logoLink to Neoplasia (New York, N.Y.)
. 2008 Mar;10(3):235–243. doi: 10.1593/neo.07929

FK506 Binding Protein Mediates Glioma Cell Growth and Sensitivity to Rapamycin Treatment by Regulating NF-κB Signaling Pathway1

Wei Jiang *, Simona Cazacu *, Cunli Xiang *, Jean C Zenklusen †, Howard A Fine †, Michael Berens ‡, Brock Armstrong ‡, Chaya Brodie *, Tom Mikkelsen *
PMCID: PMC2259453  PMID: 18320068

Abstract

FK506 binding protein 5 (FKBP5) belongs to a family of immunophilins named for their ability to bind immunosuppressive drugs, also known as peptidyl-prolyl cis-trans isomerases, and also with chaperones to help protein folding. Using glioma cDNA microarray analysis, we found that FKBP5 was overexpressed in glioma tumors. This finding was further validated by real-time reverse transcription-polymerase chain reaction and Western blot analysis. The roles of FKBP5 in glioma cells were then examined. We found that cell growth was suppressed after FKBP5 expression was inhibited by short interfering RNA transfection and enhanced by FKBP5 overexpression. Electrophoretic mobility shift assay showed that nuclear factor-kappa B (NF-κB) and DNA binding was enhanced by FKBP5 overexpression. The expression level of I-kappa B alpha and phosphorylated NF-κB was regulated by the expression of FKBP5. These data suggest that FKBP5 is involved in NF-κB pathway activation in glioma cells. In addition, FKBP5 overexpression in rapamycin-sensitive U87 cells blocked the cells' response to rapamycin treatment, whereas rapamycin-resistant glioma cells, both PTEN-positive and -negative, were synergistically sensitive to rapamycin after FKBP5 was knocked down, suggesting that the FKBP5 regulates glioma cell response to rapamycin treatment. In conclusion, our study demonstrates that FKBP5 plays an important role in glioma growth and chemoresistance through regulating signal transduction of the NF-κB pathway.

ntroduction

FK506 binding proteins (FKBPs) belong to a family of immunophilins that were named for their ability to bind immunosuppressive drugs. FK506 binding proteins have peptidyl-prolyl isomerase (PPIase) activity; that is, they produce cis-trans-isomerization of prolyl bonds in different states of a target protein, which is important for protein folding [1,2]. FK506 binding proteins can associate with chaperones and constitute a major part of the receptor complexes [3]. The PPIase activity of FKBPs can be inhibited by FK506 and rapamycin. The most well-known FKBP family member is FKBP12, a small peptide with single FKBP domain and a molecular size of 12 kDa. FKBP12 is involved in multiple biologic processes. One of the most well-known processes is binding to rapamycin and forming a complex with mammalian target of rapamycin (mTOR) to mediate phosphatidylinositol 3-kinase/Akt/mTOR downstream signal transduction, which is the major mechanism for applying rapamycin in tumor treatment [3].

FK506 binding protein 5 (FKBP5) is a 51-kDa FK506 binding protein with PPIase activity, also named as FKBP51. Human FKBP5 was first cloned from a HeLa cell cDNA library [4]. Different from small FKBPs that are enriched in neurons throughout the central and peripheral nervous systems [5], FKBP5 protein was not able to be identified in brain tissue using Western blot analysis [6], and the mRNA level of FKBP5 detected by Northern blot assay was relatively low in human brain tissue [4].

FKBP5 contains two FKBP domains at N-terminus and three tetratricopeptide repeats (TPR) motifs. The C-terminal region of FKBP5, along with the TPR motifs, contributes to heat shock protein HSP90/HSP70 binding [7,8]. The dynamic formation of heterocomplexes with HSP90 and FKBP5/FKBP52 is required for modulating the translocation of steroid receptors, such as progesterone and glucocorticoid receptors to nucleus [9,10]. FKBP5 was also demonstrated to bind with calcineurin through C-terminal domain including TPR motifs of FKBP5. This interaction is independent of calcium, calmodulin, and drug [11]. Studying the map of tumor necrosis factor-alpha/nuclear factor-kappa B (NF-κB) signal transduction, FKBP5 was found to associate with mitogen-activated protein kinase kinase kinase 1 (MAP3K1), mitogen-activated protein kinase kinase kinase 7 (MAP3K7), inhibitor of nuclear factor κ-B kinase α subunit (IKKα), inhibitor of nuclear factor κ-B kinase ɛ subunit (IKKɛ), and C-rel proto-oncogene protein (cRel) [12]. FKBP5 exerts peptidyl-prolyl isomerase activity that catalyzes the isomerization of peptidyl-prolyl imide bonds in an α subunit of the IKK kinase complex and is required for IKK function [12]. FKBP5 was also found to be essential for drug-induced NF-κB activation in leukemia and vascular smooth muscle cells [13,14]. These findings suggest that FKBP5 plays a crucial biologic role in cells.

The majority of studies on the biologic function of FKBP5 were focused on lymphocytes, although FKBP5 has been found in many tissues [4,6]. FKBP5 mRNA was detected in glioma cell line U251 cells by reverse transcription-polymerase chain reaction (RT-PCR) [15], and melanoma cells [16]; however, the expression, biologic function, and molecular mechanisms of FKBP5 in tumor cells, especially brain tumors, are not well known. In this paper, we report the association of FKBP5 expression levels with glioma grade, as well as explore possible functions of FKBP5 in glioma. We used RNA interference technique to knock down the expression of FKBP5 in glioma cells and demonstrated that FKBP5 expression mediated survival of glioma cells as well as glioma cell response to rapamycin treatment.

Materials and Methods

Materials

Monoclonal anti-FKBP51 antibody was purchased from BD Biosciences (San Jose, CA). Polyclonal anti-I-kappa B alpha (IκBα) antibody was purchased from Cell Signaling Technology (Beverly, MA). silMPORTER siRNA/plasmid DNA transfection reagent was purchased from Upstate Inc. (Charlottesville, VA). LightShift Chemiluminescent Electrophoretic Mobility Shift Assay (EMSA) kit was purchased from Pierce (Rockford, IL). A Nuclear Extraction Kit was obtained from Chemicon International (Temecula, CA). FKBP5 cDNA was purchased from OriGene (Rockville, MD).

Glioma Cells

The glioma cell lines, A172, U87, U251, LN18, LNZ308, LN443, and LN229, purchased from American Type Culture Collection (Manassas, VA), were grown on tissue culture dishes in medium consisting of DMEM containing 10% fetal calf serum, 2 mM glutamine, 50 U/ml penicillin, and 0.05 mg/ml streptomycin.

Tumor Samples

Glioma tumor samples from 192 patients were obtained from the Glioma Biorepository at Henry Ford Hospital, Detroit, MI. All tumor samples were obtained with written consent in accordance with institutional guidelines. Tumor histologies included 81 glioblastomas multiforme (GBMs), 49 oligodendrogliomas, 28 astrocytomas, 11 mixed gliomas, and 21 nontumor brain tissues obtained from epilepsy surgery. All tissues had been flash frozen and stored at -80°C.

Microarray Construction

We used an array, constructed at the Neuro-Oncology Branch of the National Cancer Institute (NCI)/National Institute of Neurological Disorders and Stroke (NINDS), containing the 28,896 Research Genetics cDNAs (15,935 of them have been sequence-verified) and an additional 5664 Cancer Genome Anatomy Project sequenceverified cDNAs obtained through data mining of the Cancer Genome Anatomy Project databases. The clones we selected were those related to genes that had previously been described as potentially important for cancer or glioma development, such as genes involved in invasion, angiogenesis, and transformation. We also selected a series of clones that have been previously shown to be highly over- or underexpressed in the glioma Serial Analysis and Gene Expression database. Finally, we incorporated a number of cDNA clones that were obtained by screening approximately 20 glioma cDNA libraries for highly represented and/or unusual transcripts. The arrays were printed using a microarrayer (OmniGrid; GeneMachines, San Carlos, CA) on poly-llysine-coated glass slides.

RNA Preparation and Microarray Experiments

Total RNA was isolated using TRIzol (Life Technologies, Rockville, MD) according to the manufacturer's instructions. The RNA was further purified using RNeasy Mini kit (Qiagen Inc., Valencia, CA). Total RNA was then linearly amplified one round as previously described [17]. Amplified RNA (1 µg) was reverse-transcribed and labeled directly with Cy3-dUTP and Cy5-dUTP using a cDNA labeling kit according to the manufacturer's instructions (Amersham Inc., Piscataway, NJ). Tissue sample RNA was labeled with Cy5, and Universal Human Reference RNA (Stratagene, La Jolla, CA) was labeled with Cy3. Labeled cDNAs were hybridized to the 34,561-feature glass cDNA microarrays overnight at 42°C with 25% formamide. The arrays were scanned on a microarray scanner (GenePix 4000A; Axon Instruments, Foster City, CA) to generate TIFF images. A microarray analysis software (GenePix Pro 3.0; Axon Instruments) was used to measure fluorescence signals. All of the array data were deposited in the NCI/Center for Information Technology microarray database (http://nciarray.nci.nih.gov/).

Short Interfering RNA Transfection

siRNA duplexes were synthesized and purified by Dharmacon (Lafayette, CO). We used a pool of four FKBP5 siRNA duplexes, which were also obtained from Dharmacon. Transfection of siRNAs was done using 100 nM FKBP5 or scrambled control siRNAs and silMPORTER kit (Upstate Inc.) according to the manufacturer's instructions. FKBP5 protein levels were determined using Western blot analysis.

Preparation and Transfection of FKBP5 and Mutant Plasmid

cDNA of FKBP5 was purchased from OriGene. FKBP5 was cloned into the pEGFP plasmid and served as a template vector for the site-directed mutagenesis. The FK1 domain of FKBP5 (FD67/68DV) was mutated using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) and the following primers: sense, (5′) CAAAGGAAAATTGTCAAATGGAAAGAAGGATGTTTCCAGTCATGATAGAAATGAACC (3′); antisense, (5′) GGTTCATTTCTATCATGACTGGAAACATCCTTCTTTCCATTTGACAATTTTCCTTTG (3′). The mutation was confirmed by DNA sequencing.

Cells were transfected either with the control vectors or with the different FKBP5 expression vectors by electroporation using the Nucleofector device (Amaxa Biosystems, Germany). Transfection efficiency using nucleofection was about 80% to 90% as we reported previously [18,19].

Electrophoretic Mobility Shift Assay

DNA:NF-κB binding was analyzed by using EMSA kit that was purchased from Pierce. Nuclear fractions of FKBP5 overexpression and control U87 or U251 cells were isolated using a Nuclear Extraction Kit purchased from Chemicon International. The isolation and analysis procedures followed the protocols for the kits. The following DNA fragments have been synthesized for EMSA analysis of DNA: NF-κB protein binding.

Biotin-labeled: AGTTGAGGGGACTTTCCCAGGC;

Nonlabeled for competition: AGTTGAGGGGACTTTCCCAGGC;

Nonlabeled mutant for competition control: AGTTGAGGCGACTTTCCCAGGC.

Rapamycin Treatment

After FKBP5 and control siRNA-transfected A172 cells were grown in DMEM with 10% FBS for 48 hours, rapamycin was added to media to a final concentration of 100 ng/ml. Cells were grown in DMEM with or without rapamycin for 24 hours and then were collected for Western blot and apoptosis analysis.

Apoptosis Assay

Vybrant Apoptosis Assay Kit #9, purchased from Molecular Probes-Invitrogen Detection Technologies (Eugene, OR), was used to conduct an apoptosis assay. Briefly, FKBP5 and scrambled control siRNA-transfected A172 cells were grown in DMEMwith 10% FBS. Cells were harvested on day 3. Floating cells were collected by centrifugation at 4000 rpm for 5 minutes. Attached cells were trypsinized and inactivated in DMEM with 10% FBS and centrifuged at 1200 rpm for 5 minutes. Cells were washed with 1x annexin-binding buffer and resuspended at a concentration of 1 x 106 cells/ml in 1x annexin-binding buffer. Cell suspension (100 µl) was incubated with 5 µl of annexin-V-allophycocyanin (APC) and 1 µl of 1 µM green staining working solution (SYTOX; Molecular Probes-Invitrogen Detection Technologies) at 37°C in an atmosphere of 5% CO2 for 15 minutes before flow cytometric analysis (FACSCalibur; Becton-Dickinson, San Jose, CA).

Cell Growth Analysis

A day before transfection, A172 cells (1 x 105) in 500 µl were plated onto 12-well plates. FKBP5 and control siRNA were transfected using the silMPORTER kit from Upstate Inc. Cell number was counted on days 3, 4, and 5 of transfection. On the day of the assay, 50 µl of 10 mM EDTA was added to each well and incubated at 37°C for 2 minutes. We applied 450 µl of 1x PBS to suspend the cells and cell suspension was collected in a 5-ml tube. Five hundred microliters of 1x PBS was added to the cells remaining in the well and collected in the same tube. The cell suspension was kept on ice and then counted for 20 seconds using a flow cytometer and microscope with Trypan Blue staining. To analyze the effect of FKBP5 overexpression on the cell growth, FKBP5-overexpressed or control U87 cells (5 x 104) were plated in a 24-well plate. Cells grew in DMEM/10% FBS/500 µg/ml G418 media for up to 4 days. Cell numbers were counted on days 1 and 4 using a microscope and Trypan Blue staining.

Western Blot Analysis

Cell lysates were collected in radioimmunoprecipitation buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, and 0.1% SDS) with protease inhibitors (Roche, Nonenwald, Germany). Electrophoresis was performed on 10% SDS-PAGE gel (Bio-Rad, Hercules, CA) and transferred onto PVDF Plus membrane using the Bio-Rad Mini-Protean II transfer system.

RNA Extraction

Total RNA was isolated from nontumor brain tissues (i.e., from epilepsy surgeries and postmortem from patients with causes of death other than brain disease) and brain tumor samples (i.e., glioblastomas, astrocytomas and oligodendrogliomas) using an RNeasy Lipid Tissue Mini RNA Isolation Kit (Qiagen Science, MD) following the manufacturer's instructions. The quality of the RNA samples was determined by measuring the absorbance of RNA samples at 260 nm as well as by electrophoresis through agarose gels and staining with ethidium bromide. The 18S and 28S RNA bands were visualized under ultraviolet lighting.

Reverse Transcriptional Reaction

Reverse transcription of RNA was done in a final volume of 20 µl containing 13 RT-PCR buffer (500 mM each of deoxynucleotide triphosphate, 3 mM MgCl2, 75 mM KCl, 50 mM Tris-HCl, pH 8.3), 10 U RNasin RNase inhibitor (Promega Corp.,Madison,WI), 10 mM DTT, 50 U Superscript II RNase H2 reverse transcriptase (Life Technologies, Inc., Gaithersburg, MD), 1.5 mM random hexamers (Pharmacia, Uppsala, Sweden), and 1 µg of total RNA. The samples were incubated at 20°C for 10 minutes and 42°C for 30 minutes, and reverse transcriptase was inactivated by heating at 99°C for 5 minutes and cooling at 5°C for 5 minutes.

Real-Time PCR Amplification

All PCR reactions were performed using a real-time RT-PCR system (ABI Prism 7000 Sequence Detection System; Perkin-Elmer Applied Biosystems). Primers for the FKBP5 gene were chosen with the assistance of the computer program, Vector NTI (InforMax Corporation, Invitrogen Life Science Software, Frederick, MD). We conducted BLASTN searches against ref_Seq_rna to confirm the total gene specificity of the nucleotide sequences chosen for the primers and the absence of DNA polymorphisms. To avoid amplification of contaminating genomic DNA, the two primers were placed in two different exons. For each PCR run, 8 µl of 30-fold diluted cDNA was mixed with 2 µl of primer mixture (10 µM/primer) and 10 µl of Platinum SYBR Green qPCR SuperMix UDG with ROX (#11744; Invitrogen) on ice. The thermal cycling conditions consisted of an initial denaturation step at 95°C for 4 minutes, 45 cycles at 95°C for 30 seconds, 60°C for 30 minutes, and 70°C for 1 minute, and finished with incubation at 72°C for 7 minutes.

Statistical Analysis

The results are presented as the mean ± SD. Data were analyzed using analysis of variance and Student's t test to determine the level of significance between the different groups.

Results

Expression of FKBP5 in Glioma

FKBP5 is distributed in many human tissues, including kidney, liver, heart, ovary, etc., but not in brain, lung, and colon [6]. Employing microarray analysis, we found that FKBP5 expression was highly upregulated in glioma specimens and its expression level correlated with glioma grade (Figure 1A). For example, the median level of FKBP5 of GBM (grade IV glioma tumor) was much higher than that found in lower-grade tumors, such as astrocytoma (grade II or III) and oligodendroglioma (grade II). To verify the microarray results, we randomly picked samples from a tumor bank. Using real-time RT-PCR and Western blot analysis, we further confirmed the overexpression of FKBP5 at bothmRNA and protein levels in glioma specimens (Figure 1, B and C). Moreover, statistical analysis of patient survival showed that the expression of FKBP5 correlated with overall GBM patient survival rates (Figure 1D); that is, the GBM patients with high levels of FKBP5 had shorter survival than those with intermediate levels. Moreover, we examined FKBP5 expression in glioma cell lines at both RNA and protein levels using real-time RT-PCR and Western blot analysis. Figure 1, E and F, shows that FKBP5 is expressed in different glioma cell lines, and the expression level of FKBP5 varies in the different cell lines.

Figure 1.

Figure 1

Open in a new tab

FKBP5 expression is upregulated in glioma tumor and expression of FKBP5 in GBM patients correlates with overall survival. (A) Microarray analysis was conducted with glioma tumor samples from 192 patients, including 87 GBMs, 49 oligodendrogliomas, 28 astrocytomas, 11 mixed gliomas, and 21 nontumor brain tissues obtained from epilepsy surgery. (B) Real-time PCR analysis validated the microarray data. The P value of GBM versus nontumor samples is less than 0.01, and the P value of oligodendrogliomas versus nontumor samples is less than 0.05. (C) Protein expression of FKBP5 in GBM and oligodendroglioma specimens was analyzed by Western blot analysis. The image analysis of FKBP5 protein bands versus β-actin shows that FKBP5 was highly expressed in GBM specimens compared to oligodendroglioma specimens. (D) Probability of GBM patient survival and FKBP5 expression level. The yellow line indicates the survival of GBM patients with intermediate levels of FKBP5 mRNA (i.e., FKBP5 expression in the tumors falls within the two-fold change compared to the nontumor samples) in specimens; the red line indicates the survival of GBM patients with high levels of FKBP5 mRNA (i.e., the threshold for FKBP5 upregulation was two-fold or more) in specimens; and the blue line indicates the overall GBM patient survival rate. The number of patients with upregulated FKBP5 expression in the group is 74, whereas the number of patients with intermediate levels of FKBP5 is 13, and no tumor showed downregulation of FKBP5 expression (i.e., two-fold or less). The t test analysis showed that the P value between the intermediate and upregulated levels is less than 0.01. (E) mRNA level of FKBP5 in glioma tumor cell lines was analyzed by real-time PCR. (F) Protein expression of FKBP5 in glioma tumor cell lines was detected by Western blot analysis using 10% SDS-PAGE.

Influence of FKBP5 on Glioma Cell Growth

We chose A172 cells for our experiments because the Western blot analysis and real-time RT-PCR data showed that this cell line expresses relatively high levels of FKBP5 mRNA and protein. To examine the function of FKBP5 in glioma cells, we used the RNA interference technique to knock down the expression of FKBP5 in A172 cells. The realtime RT-PCR analysis showed that more than 80% of FKBP5 mRNA was knocked down by siRNA transfection (Figure 2A). Western blot assay confirmed the depletion of FKBP5 protein expression in these cells (shown in Figure 2B). Cell growth analysis showed that cell growth was significantly suppressed after FKBP5 siRNA had been transfected for up to 5 days (Figure 2C). In contrast, we overexpressed FKBP5 protein in U87 cells that have very low levels of endogenous FKBP5 (shown in Figure 1, E and F). Figure 2D showed that overexpression of FKBP5 enhanced glioma cell U87 growth dramatically. Therefore, we conclude that FKBP5 expression helps regulate glioma cell growth.

Figure 2.

Figure 2

Open in a new tab

FKBP5 expression mediates glioma tumor cell growth. (A) mRNA expression of FKBP5 was analyzed with real-time PCR after siRNA was transfected into A172 cells for 3, 4, and 5 days. (B) Protein expression, after siRNA vectors were transfected in A172 cells for 3 and 5 days, or FKBP5 was overexpressed in U87 cells for 4 days, was analyzed by Western blot using 10% SDS-PAGE. (C) A172 cell growth was analyzed at 3 and 5 days after siRNA transfection. The statistical analysis showed that the P value between the FKBP5-depleted and control cells is less than 0.01. (D) U87 cell growth was analyzed after GFP vector or GFP-FKBP5 vector was transfected into U87 cells for 4 days. The P value for the cell numbers at day 4 of GFP-FKBP5.overexpressed cells versus GFP cells is less than 0.01.

Depletion of FKBP5 Induces Glioma Cell Apoptosis and FKBP5 Regulates Signal Transduction of NF-κB Pathway

An apoptosis assay was conducted using annexin-V staining. Apoptotic cells were stained by APC-conjugated annexin-V. Depletion of FKBP5 induced apoptosis in A172 cells (Figure 3A).

Figure 3.

Figure 3

Open in a new tab

Depletion of FKBP5 expression induces glioma cell apoptosis, and expression of FKBP5 mediates IKBα expression and DNA binding ability of NF-κB proteins. (A) Cell apoptosis was analyzed using Vybrant Apoptosis Assay Kit #9 (Molecular Probes) after FKBP5 protein was knocked down for 3 days. The kit contains recombinant annexin-V conjugated to APC, and SYTOX Green nucleic acid stain. The SYTOX Green dye is impermeable to live cells and apoptotic cells, but stains dead cells with an intense green fluorescence by binding to cellular nucleic acids. After staining, apoptotic cells show red fluorescence and very little green fluorescence, dead cells show a higher level of green and red fluorescence, and live cells show little or no fluorescence. (B) Western blot anti-IκBα was used to examine the effect of FKBP5 expression on IκBα expression in glioma cells. FKBP5 was depleted in A172 cells by RNAi, but overexpressed in U87 cells by transfection of FKBP5 plasmid. Total cell lysate of A172 was collected after FKBP5 or control siRNA were transfected for 3 days, whereas the total cell lysate of U87 was collected after transfection for 48 hours. Proteins were separated on 10% SDS-PAGE and transferred to the PVDF membrane. The blots were stained with anti-IκBα antibody and anti-β-actin antibody. (C) EMSA assay was used to examine the effect of FKBP5 expression on the DNA binding ability of NF-κB proteins in glioma cells. U87 or U251 cells were transfected with control plasmid or FKBP5 plasmid for 48 hours. Nuclei fractions of transfected U87 or U251 cells were isolated using Nuclear Extraction Kit (Cat # 2900; Chemicon). EMSA assay was conducted with LightShift Chemiluminescent EMSA Kit (Cat #20148; Pierce). Two controls were included in the assay. Lane 5 shows a positive DNA and protein binding and shift of the biotin-EBNA DNA. Lane 6 demonstrates that the signal shift observed in Lane 5 can be prevented by competition from excess nonlabeled DNA.

FKBP5 was found to be essential for NF-κB pathway activation in melanoma and leukemia [13,16]. NF-κB consists of heterodimers from five different proteins, i.e., p50, p65, Rel-B, cRel, and p52. These dimers are trapped in the cytoplasm through a noncovalent interaction with one specific protein inhibitor (e.g., IκBα, IκBβ, or IκBɛ). In response to a variety of specific signals, these inhibitors are phosphorylated by the IKK kinase complex and are subsequently degraded by the proteasome. When IKK kinase activity is inhibited, these inhibitors are not phosphorylated, and the expression of these inhibitors will be accumulated. Tumor necrosis factor-alpha treatment showed that IκBα became more stable when cells became apoptotic [20]. To test whether FKBP5 expression mediates the signal transduction of NF-κB in glioma tumors, we examined the expression of IκBα and phosphorylated-Rel A (p65) in both FKBP5-depleted and FKBP5-overexpressed cells. Shown in Figure 3B, the IκBα expression level was higher in FKBP5-depleted A172 cells than control cells, whereas lower in FKBP5-overexpressed U87 cells than control cells, suggesting that expression of FKBP5 mediates the stability of IκBα. Meanwhile, real-time RT-PCR data showed that the mRNA level of IκBα was not regulated by FKBP5 expression (data not shown), suggesting that FKBP5 does not regulate transcription of IκBα. The expression level of phosphorylated NF-κB (Ser536) was also regulated by the expression of FKBP5; that is, phosphorylation of NF-κB was enhanced by FKBP5 depletion but inhibited by FKBP5 overexpression (Figure 3B). In addition, EMSA results (Figure 3C) showed that DNA: NF-κB proteins interaction in glioma cells was enhanced by the overexpression of FKBP5. These results together indicate that NF-κB activation in the glioma cells is mediated by the expression of FKBP5.

FKBP5 Modulates Glioma Cell Response to Rapamycin Treatment through Regulating Signaling Transduction of NF-κB Pathway

Rapamycin is an inhibitor of FKBPs, including FKBP5 and FKBP12, the latter forming a complex with rapamycin and mTOR to inhibit mTOR downstream signals. To understand the consequences of rapamycin's inhibiting properties on FKBP5, we hypothesized that depletion of FKBP5 would block the effect of rapamycin on glioma cell proliferation. To test this hypothesis, we treated glioma cells depleted of FKBP-5 using siRNA with 100 ng/ml rapamycin. We observed that FKBP5 depletion actually sensitized the cells to rapamycin (Figure 4A).

Figure 4.

Figure 4

Open in a new tab

FKBP5 expression regulates cell sensitivity to rapamycin treatment through the signal transduction of NF-κB pathway. (A) The percentage of apoptotic cells was analyzed using Vybrant Apoptosis Assay Kit #9 (Molecular Probes). Glioma cells A172, LN18, and LN229 were transfected with FKBP5 or control siRNA for 3 days before 100 nM rapamycin was added into the medium for 48 hours of incubation. Cells (both floating and attached cells) were collected in annexin-V staining buffer. Then the cells were stained with recombinant annexin-V conjugated to APC, and SYTOX Green nucleic acid stain. After staining, apoptotic cells were analyzed by flow cytometer. (B) Expression of PTEN was analyzed by Western blot analysis using 10% SDS-PAGE. (C) 1000 nM of rapamycin was applied to treat U87 GFP, U87 GFP-FKBP5, U87 GFP-FKBP5 mut67 cells as well as U87 GFP and U87 GFP-FKBP5 cells that were pretreated with 100 µg/ml SN50, for 2 days. Cell growth both with and without rapamycin treatment was analyzed by counting cells using a hemacytometer. The percentage of cell growth was calculated by dividing the cell number with the cell number of nontreated U87-GFP cells. The P value for the cell numbers of nontreated cells versus treated cells is less than 0.05, with the exception of U87 GFP-FKBP5. overexpressed cells. (D) Total cell lysates of U87 GFP-FKBP5 or U87 GFP-FKBP5 mutant67 were coimmunoprecipitated against anti-GFP antibody at 4°C overnight. Western blot analysis was performed with anti-IKKα, anti-HSP90, and anti-FKBP5 antibody after proteins were separated on 10% SDS-PAGE.

The percentage of apoptotic cells in control siRNA-transfected A172 cells (i.e., which were reported to be rapamycin-resistant cells) was not significantly regulated by rapamycin treatment. When treating FKBP5-depleted A172 cells with 100 ng/ml rapamycin, however, we found that cell death was augmented by 15%.

Cell sensitivity to rapamycin treatment was found to relate to phosphatase and tensin homolog on chromosome ten (PTEN) status. It has been reported that cancer cells with aberrant PTEN alleles are more sensitive to rapamycin treatment than those with wild-type PTEN [21]. To further test whether the effect of FKBP5 on modulating rapamycin resistance is dependent on PTEN status, we treated LN18 and LN229 glioma cells that expressed wild-type PTEN (shown in Figure 4B) with rapamycin after cells were transfected with scrambled control siRNA or FKBP5 siRNA for 48 hours. FKBP5 depletion induced cell apoptosis in the LN18 and LN229 cells by 29% and 13%, respectively, and the apoptosis of FKBP5-depleted cells was further enhanced by rapamycin treatment by about 19.3% and 27.1%, respectively (Figure 4A). However, rapamycin treatment did not significantly induce apoptosis in the controltransfected cells. Taken together, these data suggest that the effect of FKBP5 on cell sensitivity to rapamycin treatment was independent of PTEN status.

To further validate that expression of FKBP5 mediates cell response to rapamycin treatment, we overexpressed FKBP5 in U87, the most sensitive glioma cell line that responds to rapamycin treatment (IC50 ≈ 1000 nM), to examine the response of FKBP5-overexpressed U87 to rapamycin treatment. Cell growth analysis (Figure 4C) showed that about 50% of cell growth of control vector-transfected U87 cells was suppressed by rapamycin treatment, whereas no cell growth was suppressed by rapamycin treatment when wt-FKBP5 was overexpressed in U87 cells. These data further support the findings that FKBP5 mediates glioma cell sensitivity to rapamycin treatment.

The peptidyl-prolyl isomerase activity in FKBP5 protein was found to catalyze the isomerization of peptidyl-prolyl imide bonds in the α subunit of the IKK kinase complex and is required for IKK function [12]. Barent et al. [22] have shown that the double-point mutant FD67DV in the PPIase domain of FKBP5 was able to disrupt FKBP5 PPIase activity by 90% and to avoid potential artifacts associated with FK506.

Residues Phe and Asp in the FKBP (PPIase) domain are highly conserved residues throughout the FKBP family, and the corresponding positions in FKBP12 are required for PPIase activity [23,24]. Importantly, this double mutation does not alter the FKBP5 interaction with progesterone receptor or HSP90 [22]. Therefore, we adopted this mutation in our experiment to test the effect of FKBP5 on NF-κB signal transduction. Coimmunoprecipitation data (shown in Figure 4D) suggested that mutating the FK1 domain of FKBP5 did not interrupt the interaction of HSP90 and FKBP5 but dramatically regulated the interaction of IKKα and FKBP5. Cell response to rapamycin treatment (Figure 4C) showed that overexpression of FKBP5 mutant 67 did not alter U87 cell response to rapamycin treatment, although overexpression of wt-FKBP5 significantly inhibited U87 cell response to rapamycin treatment, suggesting that interaction of FKBP5 and IKK plays an important role in glioma cell sensitivity to rapamycin treatment.

Using NF-κB inhibitor SN50 to block NF-κB pathway, we further verified the effect of FKBP5 and the signal transduction of NF-κB pathway on glioma cell sensitivity to rapamycin treatment. In this experiment, U87 GFP or U87 GFP-FKBP5 cells were pretreated with NF-κB inhibitor SN50 for 30 minutes and then treated with rapamycin. Cell growth analysis (Figure 4C) showed that cell growth of U87 GFP or U87 GFP-FKBP5 that was treated with SN50 and rapamycin was not significantly modulated by FKBP5 expression, indicating that blocking the NF-κB signal abolished the effect of FKBP5 on the cell response to rapamycin. Taken together, these results suggest that FKBP5 is upstream protein of NF-κB pathway and can regulate signal transduction of the NF-κB pathway, and that glioma cell response to rapamycin treatment can be regulated by FKBP5 expression through signal transduction of the NF-κB pathway.

Discussion

FKBP5 was initially identified by studying the FK506 complex and its binding proteins [25]. Subsequent studies revealed that FKBP5 bound to HSP90 and associated with steroid receptors to form nuclear receptors [3]. Studies also demonstrated that FKBP5 transcript levels in lymphocytes were glucocorticoid-inducible [26,27], but the function and expression of FKBP5 in cancer cells was little known. Expression of FKBP5 was only identified in prostate specimens [28] and melanoma cell lines [16]. To the best of the authors' knowledge, there are no published studies about the expression of FKBP5 in glioma tumors. An examination of the tissue distribution of FKBP5 found that expression of FKBP5 in brain tissue was not detectable by Western blot analysis [6]. Employing microarray assay, we showed that FKBP5 was highly expressed in glioma specimens compared to nontumor specimens. Our RT-PCR and Western blot assay data validated the microarray findings. Owing to the lack of a robust antibody for FKBP5 immunohistochemistry, we analyzed FKBP5 expression in primary tumor culture using western blot analysis as well as RT-PCR of FKBP5 mRNA in GBM xenografts in nude rats using human-specific primers. Both analyses have previously shown FKBP5 expression in glioma cells (data not shown). These results together suggest that FKBP5 is expressed in glioma cells both in vitro and in vivo.

When immunophilin FKBP5 combines with FK506, it can inhibit calcineurin [29]. FKBP5 was also found to be associated with heat shock proteins HSP70/HSP90, MAP3K1, MAP3K7, IKKα/CHUK (conserved helix-loop-helix ubiquitous kinase), IKK., and cRel [12, 30]. As a consequence of these interactions, FKBP5 may play a novel role in cell survival, proliferation and differentiation. Overexpressing FKBP5 in UT7/Mpl cells showed that FKBP5 enhanced antiapoptotic property. Using the siRNA approach to knock down the expression of FKBP5 in glioma cells, we found that glioma cells became apoptotic and cell growth was suppressed, whereas cell growth was enhanced by FKBP5 overexpression. Studying the phosphorylation of NF-κB p65 and DNA-NF-κB binding, we found that FKBP5 regulated the signaling transduction of NF-κB pathway.

Rapamycin (sirolimus) is a macrolide antibiotic produced by Streptomyces hygroscopicus, which is currently used as an immunosuppressive drug to prevent renal graft rejection [31]. In addition to inhibiting the isomerase activity of FKBPs [3], rapamycin can bind to FKBP12, form a complex with mTOR, and inhibit mTOR, thereby preventing further phosphorylation of p70S6K, 4E-BP1 and, indirectly, other proteins involved in transcription, translation, and cell cycle control [31,32]. For its properties of inhibiting mTOR signal transduction, rapamycin becomes a promising anticancer therapeutic agent. Preclinical studies [21,33,34] showed that the loss of PTEN function conferred an increased sensitivity to mTOR inhibitors. Herein, we demonstrated that depletion of FKBP5 augmented glioma cell sensitivity to rapamycin treatment, and the synergy was independent of PTEN status. A recent study on the signal transduction of mTOR and NF-κB demonstrated that overexpressing mTOR in endothelial cells inhibited NF-κB activity [35]. This study further showed that rapamycin treatment blocked mTOR downstream signals in phosphatidylinositol 3-kinase/Akt/mTOR pathway by inhibiting the phosphorylation of p70S6K protein, but enhanced NF-κB activity and its nuclear translocation [35]. These findings indicated that rapamycin resistance might be attributed, at least partly, to the survival signals induced by NF-κB activation in rapamycin treatment. FKBP5 has been shown to exert peptidyl-prolyl isomerase activity that catalyzed the isomerization of peptidyl-prolyl imide bonds in the α subunit of the IKK kinase complex and to be required for IKK function as well as NF-κB activation and translocation [12,13]. Several studies [13,14,16], including our own, have demonstrated that depletion of FKBP5 expression in tumor cells can enhance the expression of IκBα. It is reasonable to assume that the depletion of FKBP5 can consequently abrogate the survival signal of rapamycin-induced NF-κB activation. This notion was confirmed by interrupting FKBP5-IKK interaction using the FKBP5 mutant, in which we found that overexpression of FKBP5 mutant restored U87 sensitivity to rapamycin treatment. Because we have demonstrated that the effect of FKBP5 on rapamycin treatment is PTEN-status .independent, our results offer a promising strategy to improve the treatment of rapamycin-resistant glioma tumors in the clinic.

Our combined studies on the expression and function of FKBP5 in glioma cells demonstrate that FKBP5 plays a crucial role in glioma cell survival, growth and proliferation. Apoptotic synergy induced by the depletion of FKBP5 in rapamycin treatment suggests that FKBP5 may play a significant role in modulating rapamycin resistance, and this implies that modulating FKBP5 activity may improve the sensitivity of rapamycin-resistant cells to rapamycin treatment. Studying the FKBP5-mediated signal transductions will reveal ways to develop new drugs specifically targeting the immunophilin and consequently targeting rapamycin resistance in glioma cells.

Footnotes

1

Supported in part by the National Institutes of Health (NIH) grant CA095809 (T.M.), as well as the Intramural Research Program of the NIH,National Cancer Institute, Center for Cancer Research.

References

  • 1.Galat A. Peptidylproline cis-trans-isomerases: immunophilins. Eur J Biochem. 1993;216:689–707. doi: 10.1111/j.1432-1033.1993.tb18189.x. [DOI] [PubMed] [Google Scholar]
  • 2.Fruman DA, Burakoff SJ, Bierer BE. Immunophilins in protein folding and immunosuppression. FASEB J. 1994;8:391–400. doi: 10.1096/fasebj.8.6.7513288. [DOI] [PubMed] [Google Scholar]
  • 3.Schiene-Fischer C, Yu C. Receptor accessory folding helper enzymes: the functional role of peptidyl prolyl cis/trans isomerases. FEBS Lett. 2001;495:1–6. doi: 10.1016/s0014-5793(01)02326-2. [DOI] [PubMed] [Google Scholar]
  • 4.Nair SC, Rimerman RA, Toran EJ, Chen S, Prapapanich V, Butts RN, Smith DF. Molecular cloning of human FKBP51 and comparisons of immunophilin interactions with Hsp90 and progesterone receptor. Mol Cell Biol. 1997;17:594–603. doi: 10.1128/mcb.17.2.594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Steiner JP, Dawson TM, Fotuhi M, Glatt CE, Snowman AM, Cohen N, Snyder SH. High brain densities of the immunophilin FKBP colocalized with calcineurin. Nature. 1992;358:584–587. doi: 10.1038/358584a0. [DOI] [PubMed] [Google Scholar]
  • 6.Baughman G, Wiederrecht GJ, Chang F, Martin MM, Bourgeois S. Tissue distribution and abundance of human FKBP51, and FK506-binding protein that can mediate calcineurin inhibition. Biochem Biophys Res Commun. 1997;232:437–443. doi: 10.1006/bbrc.1997.6307. [DOI] [PubMed] [Google Scholar]
  • 7.Young JC, Obermann WM, Hartl FU. Specific binding of tetratricopeptide repeat proteins to the C-terminal 12-kDa domain of hsp90. J Biol Chem. 1998;273:18007–18010. doi: 10.1074/jbc.273.29.18007. [DOI] [PubMed] [Google Scholar]
  • 8.Cheung-Flynn J, Roberts PJ, Riggs DL, Smith DF. C-terminal sequences outside the tetratricopeptide repeat domain of FKBP51 and FKBP52 cause differential binding to Hsp90. J Biol Chem. 2003;278:17388–17394. doi: 10.1074/jbc.M300955200. [DOI] [PubMed] [Google Scholar]
  • 9.Wochnik GM, Ruegg J, Abel GA, Schmidt U, Holsboer F, Rein T. FK506-binding proteins 51 and 52 differentially regulate dynein interaction and nuclear translocation of the glucocorticoid receptor in mammalian cells. J Biol Chem. 2005;280:4609–4616. doi: 10.1074/jbc.M407498200. [DOI] [PubMed] [Google Scholar]
  • 10.Botos J, Xian W, Smith DF, Smith CL. Progesterone receptor deficient in chromatin binding has an altered cellular state. J Biol Chem. 2004;279:15231–15239. doi: 10.1074/jbc.M309718200. [DOI] [PubMed] [Google Scholar]
  • 11.Li TK, Baksh S, Cristillo AD, Bierer BE. Calcium- and FK506-independent interaction between the immunophilin FKBP51 and calcineurin. J Cell Biochem. 2002;84:460–471. doi: 10.1002/jcb.10026. [DOI] [PubMed] [Google Scholar]
  • 12.Bouwmeester T, Bauch A, Ruffner H, Angrand PO, Bergamini G, Croughton K, Cruciat C, Eberhard D, Gagneur J, Ghidelli S, et al. A physical and functional map of the human TNF-alpha/NF-kappa B signal transduction pathway. Nat Cell Biol. 2004;6:97–105. doi: 10.1038/ncb1086. [DOI] [PubMed] [Google Scholar]
  • 13.Avellino A, Romano S, Parasole R, Bisogni R, Lamberti A, Poggi V, Venuta S, Romano MF. Rapamycin stimulates apoptosis of childhood acute lymphoblastic leukemia cells. Blood. 2005;106:1400–1406. doi: 10.1182/blood-2005-03-0929. [DOI] [PubMed] [Google Scholar]
  • 14.Giordano A, Avellino R, Ferraro P, Romano S, Corcione N, Romano MF. Rapamycin antagonizes NF-{kappa}B nuclear translocation activated by TNF-{alpha} in primary vascular smooth muscle cells and enhances apoptosis. Am J Physiol Heart Circ Physiol. 2006;290:H2459–H2465. doi: 10.1152/ajpheart.00750.2005. [DOI] [PubMed] [Google Scholar]
  • 15.Tanaka K, Fujita N, Higashi Y, Ogawa N. Neuroprotective and antioxidant properties of FKBP-binding immunophilin ligands are independent on the FKBP12 pathway in human cells. Neurosci Lett. 2002;330:147–150. doi: 10.1016/s0304-3940(02)00755-3. [DOI] [PubMed] [Google Scholar]
  • 16.Romano MF, Avellino R, Petrella A, Bisogni R, Romano S, Venuta S. Rapamycin inhibits doxorubicin-induced NF-kappaB/Rel nuclear activity and enhances the apoptosis of melanoma cells. Eur J Cancer. 2004;40:2829–2836. doi: 10.1016/j.ejca.2004.08.017. [DOI] [PubMed] [Google Scholar]
  • 17.Marko NF, Frank B, Quackenbush J, Lee NH. A robust method for the amplification of RNA in the sense orientation. BMC Genomics. 2005;6:27. doi: 10.1186/1471-2164-6-27. (online journal) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Okhrimenko H, Lu W, Xiang C, Hamburger N, Kazimirsky G, Brodie C. Protein kinase C-epsilon regulates the apoptosis and survival of glioma cells. Cancer Res. 2005;65:7301–7309. doi: 10.1158/0008-5472.CAN-05-1064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Okhrimenko H, Lu W, Xiang C, Ju D, Blumberg PM, Gomel R, Kazimirsky G, Brodie C. Roles of tyrosine phosphorylation and cleavage of protein kinase Cdelta in its protective effect against tumor necrosis factor-related apoptosis inducing ligand-induced apoptosis. J Biol Chem. 2005;280:23643–23652. doi: 10.1074/jbc.M501374200. [DOI] [PubMed] [Google Scholar]
  • 20.Weaver KD, Yeyeodu S, Cusack JC, Jr, Baldwin AS, Jr, Ewend MG. Potentiation of chemotherapeutic agents following antagonism of nuclear factor kappa B in human gliomas. J Neurooncol. 2003;61:187–196. doi: 10.1023/a:1022554824129. [DOI] [PubMed] [Google Scholar]
  • 21.Shi Y, Gera J, Hu L, Hsu JH, Bookstein R, Li W, Lichtenstein A. Enhanced sensitivity of multiple myeloma cells containing PTEN mutations to CCI-779. Cancer Res. 2002;62:5027–5034. [PubMed] [Google Scholar]
  • 22.Barent RL, Nair SC, Carr DC, Ruan Y, Rimerman RA, Fulton J, Zhang Y, Smith DF. Analysis of FKBP51/FKBP52 chimeras and mutants for Hsp90 binding and association with progesterone receptor complexes. Mol Endocrinol. 1998;12:342–354. doi: 10.1210/mend.12.3.0075. [DOI] [PubMed] [Google Scholar]
  • 23.Aldape RA, Futer O, DeCenzo MT, Jarrett BP, Murcko MA, Livingston DJ. Charged surface residues of FKBP12 participate in formation of the FKBP12-FK506-calcineurin complex. J Biol Chem. 1992;267:16029–16032. [PubMed] [Google Scholar]
  • 24.Fischer S, Michnick S, Karplus M. A mechanism for rotamase catalysis by the FK506 binding protein (FKBP) Biochemistry. 1993;32:13830–13837. doi: 10.1021/bi00213a011. [DOI] [PubMed] [Google Scholar]
  • 25.Wiederrecht G, Hung S, Chan HK, Marcy A, Martin M, Calaycay J, Boulton D, Sigal N, Kincaid RL, Siekierka JJ. Characterization of high molecular weight FK-506 binding activities reveals a novel FK-506-binding protein as well as a protein complex. J Biol Chem. 1992;267:21753–21760. [PubMed] [Google Scholar]
  • 26.U M, Shen L, Oshida T, Miyauchi J, Yamada M, Miyashita T. Identification of novel direct transcriptional targets of glucocorticoid receptor. Leukemia. 2004;18:1850–1856. doi: 10.1038/sj.leu.2403516. [DOI] [PubMed] [Google Scholar]
  • 27.Vermeer H, Hendriks-Stegeman BI, van der Burg B, van Buul-Offers SC, Jansen M. Glucocorticoid-induced increase in lymphocytic FKBP51 messenger ribonucleic acid expression: a potential marker for glucocorticoid sensitivity, potency, and bioavailability. J Clin Endocrinol Metab. 2003;88:277–284. doi: 10.1210/jc.2002-020354. [DOI] [PubMed] [Google Scholar]
  • 28.Febbo PG, Lowenberg M, Thorner AR, Brown M, Loda M, Golub TR. Androgen mediated regulation and functional implications of fkbp51 expression in prostate cancer. J Urol. 173:1772–1777. doi: 10.1097/01.ju.0000155845.44729.ba. [DOI] [PubMed] [Google Scholar]
  • 29.Baughman G, Wiederrecht GJ, Campbell NF, Martin MM, Bourgeois S. FKBP51, a novel T-cell-specific immunophilin capable of calcineurin inhibition. Mol Cell Biol. 1995;15:4395–4402. doi: 10.1128/mcb.15.8.4395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Scammell JG, Denny WB, Valentine DL, Smith DF. Overexpression of the FK506-binding immunophilin FKBP51 is the common cause of glucocorticoid resistance in three New World primates. Gen Comp Endocrinol. 2001;124:152–165. doi: 10.1006/gcen.2001.7696. [DOI] [PubMed] [Google Scholar]
  • 31.Vignot S, Faivre S, Aguirre D, Raymond E. mTOR-targeted therapy of cancer with rapamycin derivatives. Ann Oncol. 2005;16:525–537. doi: 10.1093/annonc/mdi113. [DOI] [PubMed] [Google Scholar]
  • 32.Vogt PK. PI 3-kinase, mTOR, protein synthesis and cancer. Trends Mol Med. 2001;7:482–484. doi: 10.1016/s1471-4914(01)02161-x. [DOI] [PubMed] [Google Scholar]
  • 33.Neshat MS, Mellinghoff IK, Tran C, Stiles B, Thomas G, Petersen R, Frost O, Gibbons JJ, Wu H, Sawyers CL. Enhanced sensitivity of PTEN-deficient tumors to inhibition of FRAP/mTOR. Proc Natl Acad Sci USA. 2001;98:10314–10319. doi: 10.1073/pnas.171076798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Grunwald V, DeGraffenried L, Russel D, Friedrichs WE, Ray RB, Hidalgo M. Inhibitors of mTOR reverse doxorubicin resistance conferred by PTEN status in prostate cancer cells. Cancer Res. 2002;62:6141–6145. [PubMed] [Google Scholar]
  • 35.Minhajuddin M, Fazal F, Bijli KM, Amin MR, Rahman A. Inhibition of mammalian target of rapamycin potentiates thrombin-induced intercellular adhesion molecule-1 expression by accelerating and stabilizing NF-kappa B activation in endothelial cells. J Immunol. 2005;174:5823–5829. doi: 10.4049/jimmunol.174.9.5823. [DOI] [PubMed] [Google Scholar]

Articles from Neoplasia (New York, N.Y.) are provided here courtesy of Neoplasia Press

RESOURCES