Abstract
Trypanosoma brucei, unicellular parasites causing human sleeping sickness and animal nagana, have a great impact on the socio-economic environment of sub-Saharan Africa. The dynamics of the parasite are still poorly understood. We have characterized 14 polymorphic di-, tri-, and tetranucleotide microsatellite loci with perfect repeats (only one motif) exhibiting between 5 and 16 alleles in T. brucei isolates from all over Africa and from all described subspecies. The microsatellites will be useful in addressing population genetic questions in T. brucei to better understand the population structure and spread of this important parasite.
Keywords: Trypanosoma, microsatellites, population genetics, co-infection, cross-amplification, Kinetoplastid
Trypanosoma brucei, a protozoan parasite transmitted by the bite of tsetse flies (Glossina spp.), causes human sleeping sickness and animal Nagana in Africa. After near-elimination in the 1960's, sleeping sickness has resurged to record heights (Van Nieuwenhove et al., 2001) due to declining control efforts caused by neglect and civil unrest.
Microsatellite loci for T. brucei have been published previously: five microsatellites by Biteau et al. (2000), one by Truc et al. (2002) and a further 180 by MacLeod et al. (in press), which were used to generate a genetic map of the T. brucei genome strain (TREU927/4). Many of these markers, however, do not have perfect repeats (only motif included) and so may not follow a step-wise mutation model, limiting their use for population genetic analyses. And, in the case of the markers used for the genetic map, their variability is unknown. We therefore characterized a set of microsatellite loci with perfect repeats. Loci were identified by extracting all clean di-, tri-, and tetranucleotide repeats in the entire genome (TIGR Trypanosoma brucei genome database, http://www.tigr.org/tdb/mdb/tbdb/, as of Oct. 9, 2004) using Tandem Repeat Finder 3.21 (Benson, 1999). Primers were constructed with Primer3 (Rozen, Skaletsky, 2000). Where loci identified matched those of MacLeod et al. (in press), the same locus names and primers were used (Table 1). Microsatellite loci were amplified using the following PCR profile: 4 min 94°, followed by 35 cycles of: 45 sec 94°, 30 sec TA (Table 1), 45 sec 72°, followed by 7 min 72°. Reactions contained 1× PCR buffer II with MgCl2 (Applied Biosystems), 0.8 mM of each dNTP (Promega), 0.2 μM of each primer, 0.25 U AmpliTaq polymerase (Applied Biosystems). Allele sizes were determined using an ABI3100 Genetic Analyzer (Applied Biosystems) and GeneMapper 3.5 software (Applied Biosystems, 2002). GENEPOP 3.3 (Raymond, Rousset, 1995) was used to calculate observed and expected heterozygosities. Linkage disequilibrium between loci was not assessed because the loci are distributed over 9 of 11 chromosomes and thus in most combinations not physically linked. Furthermore, samples from all over Africa and from all sub-species were assessed to maximize detected allele diversity. Due to the geographical structure thus introduced, linkage disequilibrium is expected without physical linkage.
Table 1.
Characteristics of Trypanosoma brucei microsatellites
| Locus | Chromosome | Primer sequence (5'-3') | Repeat | TA | n | NA | Range (bp) | H0 | HE | Cross amplification |
|---|---|---|---|---|---|---|---|---|---|---|
| TB1/8 | 1 | [FAM]-AGGTTTAGTGCATGTCGGA CCTGTTGTACGGAGGTCA |
(CA) | 53 | 103 | 11 | 97-117 | 0.38 | 0.69 | Teq, Tev, Tv, Ts, Tr, Lm, Ld |
| TB2/19 | 2 | [HEX]-CTGGTGCGTGTAACTGTG GAAGTGAGGACATGCACG |
(AT) | 53 | 24 | 11 | 84-104 | 0.71 | 0.86 | Teq, Tev, Ld, Lm |
| TB2/21 | 2 | [HEX]-CTGTGTGTTGCTTGTTCATA AGTTTAACAGCACTTCCATTT |
(AT) | 53 | 21 | 12 | 80-102 | 0.67 | 0.89 | Teq, Tev, Ld, Lm |
| TB5/2 | 5 | [HEX]-CAACCGAAAGTAAGGGGAAC TCTCGCCTTCTTTGCCC |
(AT) | 60 | 23 | 9 | 83-107 | 0.57 | 0.77 | Teq, Tev, Tc, Ts, Ld, Lm |
| TB6/7 | 6 | [HEX]-AAGCTGACAGGTGGTTGA GAACATGCGTGCGTGTG |
(AT) | 53 | 24 | 12 | 104-136 | 0.50 | 0.84 | Teq, Tev, Ts, Lm |
| TB8/11 | 8 | [FAM]-TGTAGCAGTGGTACGCAC CACCCAACGCATGTAAGC |
(AT) | 53 | 22 | 13 | 97-127 | 0.86 | 0.90 | Teq, Tev, Tc, Ld, Lm |
| TB9/6 | 9 | [HEX]-TGATTCATTGGTTAAGACAGG AATGATAACTGCGGATTACAC |
(AC) | 53 | 24 | 11 | 124-158 | 0.67 | 0.86 | Teq, Tev, Lm |
| TB9/4 | 9 | [HEX]-CAACTGTCATCTCGTTACTT TTCAATTGCCTATCGTTGTG |
(AT) | 53 | 24 | 9 | 101-119 | 0.50 | 0.82 | Tev, Ts, Ld, Lm |
| TB10/5 | 10 | [FAM]-AAAGGCGATATGTTATTATTGA ATTGGGTATACTGTCCCTCA |
(TA) | 60 | 24 | 13 | 79-115 | 0.75 | 0.86 | Tev |
| TB11/12 | 11 | [FAM]-CCTTCACTCTTAAGTGGAAG GTAGCCATTCTGCGTCC |
(AT) | 53 | 23 | 12 | 83-109 | 0.48 | 0.85 | Tev, Ts, Ld, Lm |
| TB11/13 | 11 | [FAM]-CAAGAACTCTGCATTGAGC ATCTGTTGGCGATGGTGA |
(AT) | 53 | 91 | 16 | 125-161 | 0.78 | 0.88 | Teq, Tev |
| Tr301-1 | 1 | [HEX]-CTCCCCTCACTTCCTCACG GTTTGCACATGACAAATAACACACAGG |
(TTA) | 60 | 25 | 10 | 69-108 | 0.56 | 0.85 | Tev, Tc, Tl, Ts, Ld, Lm |
| Tr401-1 | 1 | [HEX]-GTGAAAAACGAAAGGCAACG TGAGTTCAACAATCTTTTATTCC |
(GTGA) | 53 | 106 | 6 | 126-150 | 0.28 | 0.58 | Teq, Tev, Ts, Ld, Lm |
| Tr407-1 | 7 | [HEX]-AACAATATCTGACAATGAGGATGG GTTTAGATGGGTGGAAAGGGTAGG |
(AAAC) | 53 | 76 | 5 | 157-173 | 0.16 | 0.53 | Teq, Tev, Tc, Tl, Ts, Ld, Lm |
Locus, TB1-TB11 as in MacLeod et al. (in press); TA, annealing temperature; n, number of isolates assessed; NA, number of alleles detected in T. brucei; H0, observed heterozygosity; HE, expected heterozygosity; Cross amplification, further species that amplified: Teq, T. equiperdum; Tev, T. evansi; Tc, T. congolense; Tl, T. lewisi; Ts, T. simiae; Tr, T. rangeli; Tv, T. vivax; Ld, Leishmania donovani; Lm, L. major.
We screened between 21 and 106 T. brucei isolates at 41 loci to determine variability. Fourteen loci were highly variable and reliably produced allele patterns consistent with the repeat motif (Table 1). We assessed the potential of our markers to study related species by analyzing one isolate each of T. evansi, T. equiperdum, T. vivax, T. congolense, T. lewisi, T. simiae, T. rangeli, Leishmania donovani, and L. major. Most markers amplified T. evansi and T. equiperdum (the closest relatives of T. brucei) well, and the Leishmania species very weakly. Trypanosoma simiae was amplified by eight markers, the remaining Trypanosoma species by one to four markers (Table 1). Cross-amplification could potentially pose problems in those five markers that amplify T. vivax or T. congolense as these species have geographic and host ranges overlapping with T. brucei. The other species do not occur sympatrically or have very restricted host ranges (Mulligan, Potts, 1970). Genotyping of cultured parasites is unproblematic with all markers because all species survive under different culture conditions. Also, all species are distinguishable morphologically or with species-specific primers (Desquesnes, Davila, 2002) if necessary. The markers did not amplify tsetse flies (Glossina spp.), or a vertebrate host, wildebeest (Connochaetes taurinus).
The presented markers will help reveal the population structure and spread of this important parasite and greatly facilitate the determination of different strains directly in field samples.
Acknowledgements
We thank R. Brun (Basel), P. Grébaut (Montpellier), and W. Gibson (Bristol) for providing trypanosome DNA and the National Science Foundation (DEB-0408083 to OB), the Yale Institute of Biospheric Studies (GC), the Wellcome Trust (grant no. 074732/z/04/z to AML), The Royal Society of Edinburgh (AML) and Tenovus Scotland (AML) for funding.
References
- Applied Biosystems . GeneMapper Software Version 3.0. Applied Biosystems; 2002. [Google Scholar]
- Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Research. 1999;27:573–580. doi: 10.1093/nar/27.2.573. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Biteau N, Bringaud F, Gibson W, Truc P, Baltz T. Characterization of Trypanozoon isolates using a repeated coding sequence and microsatellite markers. Molecular and Biochemical Parasitology. 2000;105:187–202. [PubMed] [Google Scholar]
- Desquesnes M, Davila AMR. Applications of PCR-based tools for detection and identification of animal trypanosomes: a review and perspectives. Veterinary Parasitology. 2002;109:213–231. doi: 10.1016/s0304-4017(02)00270-4. [DOI] [PubMed] [Google Scholar]
- MacLeod A, Tweedie A, McLellan S, et al. The genetic map and comparative analysis with the physical map of Trypanosoma brucei. Nucleic Acids Research. doi: 10.1093/nar/gki980. in press. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mulligan HW, Potts WH. The African trypanosomiases. New York: Wiley-Interscience; 1970. [Google Scholar]
- Raymond M, Rousset F. GENEPOP (Version 1.2): Population genetics software for exact tests and ecumenicism. Journal of Heredity. 1995;86:248–249. [Google Scholar]
- Rozen S, Skaletsky HJ. Primer3 on WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular biology. Totowa, NJ: Humana Press; 2000. pp. 365–386. [DOI] [PubMed] [Google Scholar]
- Truc P, Ravel S, Jamonneau V, N'Guessan P, Cuny G. Genetic variability within Trypanosoma brucei gambiense: evidence for the circulation of different genotypes in human African trypanosomiasis patients in Cote d'Ivoire. Transactions of the Royal Society of Tropical Medicine and Hygiene. 2002;96:52–55. doi: 10.1016/s0035-9203(02)90237-3. [DOI] [PubMed] [Google Scholar]
- Van Nieuwenhove S, Betu-Ku-Mesu VK, Diabakana PM, Declercq J, Bilenge CM. Sleeping sickness resurgence in the DRC: the past decade. Tropical Medicine and International Health. 2001;6:335–341. doi: 10.1046/j.1365-3156.2001.00731.x. [DOI] [PubMed] [Google Scholar]