Identification of the Transcriptional Targets of FOXP2, a Gene Linked to Speech and Language, in Developing Human Brain

Abstract

Mutations in FOXP2, a member of the forkhead family of transcription factor genes, are the only known cause of developmental speech and language disorders in humans. To date, there are no known targets of human FOXP2 in the nervous system. The identification of FOXP2 targets in the developing human brain, therefore, provides a unique tool with which to explore the development of human language and speech. Here, we define FOXP2 targets in human basal ganglia (BG) and inferior frontal cortex (IFC) by use of chromatin immunoprecipitation followed by microarray analysis (ChIP-chip) and validate the functional regulation of targets in vitro. ChIP-chip identified 285 FOXP2 targets in fetal human brain; statistically significant overlap of targets in BG and IFC indicates a core set of 34 transcriptional targets of FOXP2. We identified targets specific to IFC or BG that were not observed in lung, suggesting important regional and tissue differences in FOXP2 activity. Many target genes are known to play critical roles in specific aspects of central nervous system patterning or development, such as neurite outgrowth, as well as plasticity. Subsets of the FOXP2 transcriptional targets are either under positive selection in humans or differentially expressed between human and chimpanzee brain. This is the first ChIP-chip study to use human brain tissue, making the FOXP2-target genes identified in these studies important to understanding the pathways regulating speech and language in the developing human brain. These data provide the first insight into the functional network of genes directly regulated by FOXP2 in human brain and by evolutionary comparisons, highlighting genes likely to be involved in the development of human higher-order cognitive processes.

Spoken language and written language are uniquely human traits with a significant but complex genetic component. As with other developmental processes, the study of rare Mendelian forms of language or speech disorders provides an efficient means to begin to understand the molecular basis of human speech and language.¹ FOXP2 was identified as involved in speech and language when affected members of the “KE” family were found to carry a mutated allele, and an unrelated individual was found to carry a balanced translocation with a break in FOXP2² (causing speech-language disorder 1 [SPCH1 {MIM 602081}]). Its role in speech and language was reiterated when an additional mutation that caused a truncation of FOXP2 was identified in a family with speech and language deficits.³ Individuals with FOXP2 mutations have dominantly inherited verbal dyspraxia and linguistic and/or grammatical difficulties.^2,4,5 Additionally, patients with FOXP2 mutations have demonstrated developmental abnormalities of the basal ganglia (BG) and inferior frontal cortex (IFC).^6,7 FOXP2 expression overlaps with perisylvian frontal and temporal regions, including the inferior frontal gyrus (Broca’s region), but also extends more broadly to suggest a role in complex sensory motor integration involving auditory vocal learning,^8,9 as well as mirror neuron system function, which is highly evolved in primates and disrupted in autism.^10,11

FOXP2 belongs to a family of proteins that contain a forkhead DNA binding, or “winged helix,” domain, a region responsible for DNA binding that is found in transcription factors.² FOXP2 also contains a transcriptional repression domain including a zinc-finger motif in the N-terminal region¹² and has been shown to interact with the corepressor protein C-terminal binding protein 1.¹³ Foxp1, Foxp2, and Foxp4 have been demonstrated to form hetero- and homotypic dimers that are important for their transcriptional activity.¹³ The expression patterns of FOXP1 and FOXP2 are not identical⁸; therefore, in some cases, the proteins may be forming heterotypic dimers, whereas, in others, they may act alone.¹³ Foxp2, the mouse orthologue of FOXP2, has been proposed to be an important regulator of proximal versus distal epithelial differentiation in the lung, on the basis of in vitro repression of the mouse CC10 promoter and human SP-C promoter.¹² Additionally, other members of the forkhead-box (FOX) family of transcription factors are well established as transcriptional repressors or activators involved in development.^14–16 However, the role of FOXP2 in the brain and its transcriptional targets remain to be elucidated.

Previous analyses of amino acid changes in FOXP2 across species indicate that FOXP2 has undergone accelerated evolution in humans.^17,18 The most parsimonious explanation for the observed acceleration is positive selection of FOXP2 in humans, since there is no evidence of an increase in the mutation rate or purifying selection. Thus, the study of FOXP2 provides a potentially powerful avenue for investigations into the molecular and physical adaptations that allowed for the development of speech and language in humans. Language is a complex trait and necessarily involves the interaction of many genes,¹ some of which may have coevolved. Since FOXP2 is a transcription factor, identification of its transcriptional targets in the brain and the assessment of their evolution would provide an important advance by elucidating the molecular pathways involved and potential evidence of their adaptive evolution.

Here, using chromatin immunoprecipitation (ChIP) followed by hybridization of the precipitated DNA to human promoter arrays (hereafter, “ChIP-chip”), we have identified targets of FOXP2 in vivo in both the BG region and the IFC of the human fetal brain. A subset of ChIP-chip–identified targets were confirmed by ChIP–quantitative PCR, and the functional consequence of FOXP2 binding to target promoters was demonstrated by FOXP2 overexpression in vitro. This study, along with that by Vernes et al.,^{19(in this issue)} provides the first insight into the direct functional targets of FOXP2 during human brain development, as well as a core set of genes for further exploration into the genetic basis of human speech and language.

Material and Methods

Antibody Production

A 15-mer amino acid sequence was chosen from the C-terminal region of FOXP2. A FOXP2 antibody was made against the 14-aa sequence EDLNGSLDHIDSNG (fig. 1) in the C-terminal region of FOXP2. The 14-aa peptide was chosen on the basis of its antigenicity (DNASTAR) and dissimilarity between family members FOXP1 and FOXP4 (fig. 1). Similarity of the amino acid sequence to other proteins was excluded by comparisons with family members FOXP1 and FOXP4, as well as by protein blast (blastp) analysis (BLAST). The peptide was conjugated to keyhole limpet hemocyanin, and rabbits were immunized with the peptide and complete Freund’s adjuvant (Sigma-Genosys). Antibody was purified on an affinity purification column with the peptide (Sigma-Genosys).

Figure 1. .

FOXP2 antibody detection of human brain and lung FOXP2 expression. A, Peptide used as an antigen to create the FOXP2 antibody aligned against the amino acid sequence of FOXP2 and family members FOXP1 and FOXP4. Protein from MRC5 cells transfected with expression vectors containing FOXP2 isoforms I and III and FOXP1 and FOXP4 transcripts were run on an SDS-PAGE gel, were transferred to PVDF membrane, and were hybridized with polyclonal anti-FOXP2 antibody (lanes 1–4). FOXP1 and FOXP4 were also hybridized with protein-specific antibodies (lanes 5 and 6) as a positive control for protein expression. B, FOXP2 isoform I protein immunoprecipitated from lung, BG, and IFC regions run on an SDS-PAGE gel, transferred to PVDF membrane, and hybridized with polyclonal anti-FOXP2 antibody (Ab).

Western-Blot Analysis

MRC5 or SH-SY5Y cells were lysed in hypotonic buffer (10 mM Tris-Cl, 10 mM KCl, 0.1 mM EDTA, and 0.1 mM ethylene glycol tetraacetic acid [EGTA]) and were sonicated briefly. Cell debris was removed by centrifugation. Protein was run on a 7.5% SDS-PAGE gel and was transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was blocked with 5% milk in PBS-Tween for 2 h. The corresponding lanes were then incubated with FOXP2 in-house antibody (1:5,000 dilution), FOXP1 in-house antibody (1:10,000 dilution), FOXP4 ab17726 Abcam antibody (1:1,000 dilution), or FLAG F3165 Sigma antibody (1:10,000 dilution) in 5% milk in PBS-Tween overnight at 4°C. Blots were washed and incubated with 1:10,000 dilution of horseradish peroxidase–conjugated anti-rabbit or anti-mouse secondary antibody (Jackson ImmunoResearch Laboratories) and then were exposed to SuperSignal West Pico Chemiluminescent Substrate (Pierce) in accordance with the manufacturer’s directions.

Tissue Samples

Human tissue samples were obtained from the National Institute of Child Health and Human Development (NICHD) Brain and Tissue Bank for Developmental Disorders under contracts N01-HD-4-3368 and N01-HD-4-3383 (lung = University of Maryland Brain Bank [UMB] number 1926 [18 gestational wk {GW}]; BG = UMB number 1664 [19 GW], UMB number 1888 [19 GW], and UMB number 1876 [20 GW]; IFC = UMB number 638 [16 GW], UMB number 899 [18 GW], and UMB number 1876 [20 GW]). FOXP2 targets in human fetal brain during midgestation (16–20 GW) were investigated because this time corresponds to the peak period of neuronal migration, differentiation, and cortical regionalization and is a time of high FOXP2 expression.^8,9,20

ChIP

ChIP was performed as described elsewhere.²¹ For each experiment, 0.6 g of human tissue was used. Tissue was finely minced in PBS on ice, and the cross-linking reaction was subsequently performed for 15 min at room temperature. Nuclei were isolated, and DNA was sonicated in 1 ml of buffer (1 μM EDTA, 0.5 μM EGTA, and 10 μM Tris-HCl) to DNA fragments that were ∼0.2–1 kb in size. Then, 100 μl of Protein A beads were mixed with 10 μg of FOXP2 antibody overnight. Nuclear lysate was hybridized to the beads overnight. Beads were then washed five times with RIPA buffer (50 mM Hepes, 1 mM EDTA, 0.7% deoxycholic acid, 1% NP-40, and 0.5 M LiCl), and protein-DNA complexes were eluted (50 mM Tris, 10mM EDTA, and 1% SDS) at 65°C for 12 min. The cross-linking reaction was reversed at 65°C overnight (50 mM Tris, 10 mM EDTA, and 1% SDS). The ends of the DNA were blunted with T4 DNA polymerase (New England Biolabs) for 20 min at 12°C. DNA was ligated to annealed linkers (oJW102, GCGGTGACCCGGGAGATCTGAATTC, and oJW103, GAATTCAGATC) at 16°C for 16 h. ChIP and input DNA were amplified by PCR, with 1 mM deoxynucleotide triphosphates, 2 U Taq (Qiagen), and 1 μM oJW102. Cycling conditions were 1 cycle for 5 min at 72°C; 95°C for 2 min; 24 cycles at 95°C for 1 min, 60°C for 1 min, and 72°C for 1 min; and 1 cycle for 5 min at 72°C. For some ChIPs, a second and third round of PCR was performed to obtain enough DNA.

Labeling and Hybridization

A total of 200 ng of purified PCR product was labeled with Cy5 (ChIP DNA) and Cy3 (input DNA) with BioPrime DNA labeling system (Invitrogen) at 37°C for 16 h. Human promoter arrays (Aviva Systems Biology)²² were hybridized with 2 μg of each labeled ChIP and input DNA.

Microarray and Data Analysis

Arrays were scanned on a GenePix 4000B (Molecular Devices), and image analysis was performed with GenePix Pro 6.0. Three independent biological replicates were analyzed for BG and IFC; two independent biological replicates were analyzed for lung. Poor-quality spots were flagged by GenePix Pro 6.0. Background was determined on a spot-by-spot basis. Data analysis was performed using R with Bioconductor²³ packages Limma and Marray. The quality of arrays was determined on the basis of signal plots before normalization. Spots whose signal intensities were twofold greater than the local background were considered present. Median normalization was performed. Data have been deposited into NCBI Gene Expression Omnibus (GEO) and can be accessed with accession number GSE8547.

Gene Ontology (GO) Analysis

Target genes with an M score >0.5 and a P value of >.05 were analyzed using DAVID.^24,25 The Fisher exact test was used, with all array genes as background.

Stable and Transient-Overexpression Cell Lines

cDNA was transcribed from RNA isolated (Qiagen) from human fetal brain by use of the Superscript First-Strand Synthesis System (Invitrogen). FOXP2 was amplified via PCR with forward primer FOXP2-1F(BamHI)+ (5′-aaggatccatgatgcaggaatctgcgac-3′) and reverse primer FOXP2-1R(EcorI)+ (5′-ccgaattcttccagatcttcagataaaggc-3′). FOXP1 was amplified with forward primer Foxp1kozakF (5′-caccatgatgcaagaatctgggac-3′) and reverse primer Foxp1w/otagR (5′-tcactccatgtcctcgtttac-3′). A FOXP4 clone was obtained from Open Biosystems (MHS1010-9204774). Products were cloned into a pEF6/V5-His TOPO TA vector for transient expression in MRC5 cells. MRC5 cells were transiently transfected with linearized clones with Lipofectamine 2000 (Invitrogen) for 24 h. For stable transfection in SH-SY5Y cells, PCR products were cloned into the pCMV-Tag4A vector (Stratagene) with three C-terminal FLAG tags. SH-SY5Y cells were transfected with linearized clones either with the FOXP2 insert or without (vector only) by use of Lipofectamine 2000 (Invitrogen) and were selected for stably transfected cells with 1.428 mg/ml Geneticin (Invitrogen) for >5 d. The antibiotic was removed at least 48 h before harvesting for quantitative PCR experiments. Seven passages of each cell line were used as biological replicates.

Real-Time PCR

RNA was extracted using RNeasy Mini Kit (Qiagen) following the manufacturer's directions. DNA was removed by digestion with RNase-free DNase (Qiagen). A quantity of 1.2–5 μg was used in a reaction to synthesize cDNA with oligo dT primers. Quantitative real-time PCR was performed on an ABI 7900HT (Applied Biosystems) with SDS 2.1 software. The reaction mix contained iTaq SYBR Green Supermix (Bio-Rad) and 0.3 μM of each primer. Cycling conditions were 50°C for 2 min and 95°C for 3 min, followed by 45 cycles at 95°C for 15 s and 58°C for 45 s, and, finally, 95°C for 15 s, 60°C for 20 s, and 95°C for 15 s.

ChIP-PCR

ChIP was done as described above by use of anti-FOXP2 (rabbit polyclonal [Abcam]) or anti-FLAG (mouse monoclonal [Sigma]) antibodies. PCR was performed using either SYBR Green Supermix (Bio-Rad) or Taq (Qiagen) and the following primers: for ANK1, 5′-ccccctccttaggaaacaaa-3′ and 5′-agcccagagttggacatcag-3′; for CALCRL, 5′-tcactctttcccaccttgct-3′ and 5′-gaaacattgccaaactatatgagaa-3′; for CDH1, 5′-ctcgacacccgattcaaagt-3′ and 5′-gcgtgactttggtggaaaac-3′; for LBR, 5′-taaagctgggaggtgctgtc-3′ and 5′-ggctgctgtaggcttgagag-3′; for KCNJ15, 5′-ccagtaggcaaatccttcca-3′ and 5′-ggggatagaaattcgggtgt-3′; for PIR51, 5′-cagtccaagtgcccctatgt-3′ and 5′-ggaactacccacctcacagg-3′; for PPP2R1B, 5′-acaacagaaggcaccattcc-3′ and 5′-ccgctcagactcaaacttcc-3′; for TGM2, 5′-tggctgtgtcaggctgtatc-3′ and 5′-acacagagagcagacgcaga-3′; and, for TNNI1, 5′-tgctggtttcactcagttgg-3′ and 5′-aatgcacacaacaggcacat-3′.

Comparison of Gene-Expression Levels and Estimates of Protein-Sequence Divergence Rates between Humans and Chimpanzees

Gene-expression levels in human and chimpanzee cerebral cortex were determined by combining microarray data from three independent studies.^26–28 To identify probes common to both species, megablast (BLAST) was used to align all probes from the Affymetrix HGU95Av2 microarray to the human genome (build 34) and the chimpanzee draft genome. Any probe without a perfect match in both species (∼1/4) was masked during the calculation of expression values (GCOSv1.2 [Affymetrix]). In addition, only probe sets with six or more matching probes were retained for subsequent analyses (n=11,768 of 12,625 sets). For each array, expression values were scaled to an average intensity of 200 (GCOSv1.2 [Affymetrix]). Two samples, “Hs3_MFG” and “Pt4_FP” from the study of Caceres et al.,²⁶ were identified as outliers and were removed from the analysis. Technical replicates were averaged, followed by biological replicates (i.e., different cortical samples from the same individual). After averaging, there were 11 unique human and 8 unique chimpanzee individuals in the data set (two of the chimpanzees from these studies^26–28 were identical). Quantile normalization²⁶ was then performed, and data were log transformed. Gene-expression levels were compared between the species by use of a Bayesian t test via the “bayesreg” R package, with the settings betaFit = 1, winSize = 101, and conf = 10. Estimated rates of protein-sequence divergence between humans and chimpanzees were obtained from the study of Khaitovich et al.²⁹

Results

The FOXP subfamily of transcription factors have relatively high homology among themselves, so it was important to generate an immunoreagent that would meet the specificity and efficiency requirements of ChIP. We produced a high-affinity FOXP2 polyclonal antibody on the basis of immunization with a relatively divergent region near the C-terminus (fig. 1). Since isoform III does not share the N-terminus with isoforms I and II, this C-terminal moiety provided the additional benefit of permitting detection of all FOX domain–containing isoforms of FOXP2. No cross-reactivity was detected for FOXP1 or FOXP4, and the antibody detected two major FOXP2 isoforms, designated isoform I and III (GenBank accession numbers NP_055306 and NP_683697 or NP_683698) as predicted (fig. 1). A protein of ∼80 kDa was immunoprecipitated from human fetal brain regions and lung (fig. 1). Immunohistochemistical staining of mouse brain by use of this antibody reflects previously described patterns of postmitotic neuronal staining in the cortex and BG (data not shown).²⁰

Identification of Core FOXP2 Targets by In Vivo ChIP-Chip in Fetal Human Brain

Given previous data suggesting adaptive evolution of FOXP2 in humans^17,18 and its involvement in human higher cognitive functions, we were interested in elucidating FOXP2 targets in the human brain. We performed ChIP-chip experiments on human fetal brain during midgestation, which corresponds to the peak period of neuronal migration, differentiation, and cortical regionalization and is a time of high FOXP2 expression.^8,9,20 The two regions we chose, one cortical (IFC) and one subcortical (BG), are part of a parallel-distributed circuitry that, among other functions, is involved in language and speech,^30,31 express high levels of FOXP2 during this period of development,⁸ and are sites of abnormalities in patients with FOXP2 mutations.³² Thus, FOXP2 targets identified within these regions during human brain development would be particularly germane to the understanding of the molecular circuitry involved in the development of these regions and their relationship to speech and language functions. Furthermore, the importance of this period for key aspects of the development of the human cerebral cortex is also highlighted by previous studies that demonstrate key elements of patterning—including brain asymmetry, a structural correlate of language—that occur during this time.^31,33

We used rapidly frozen tissue stored at −80°C, with short postmortem intervals, to optimize the likelihood of detecting regions of DNA bound by FOXP2 (see the “Material and Methods” section). ChIP products from three independent replicates were hybridized onto Aviva Systems Biology cDNA promoter arrays containing ∼6,000 DNA fragments from potential regulatory regions, which were initially validated in the first genomewide ChIP-chip studies (see the “Material and Methods” section).²² Although this is not a whole-genome microarray, it has been validated in several important ChIP studies and provides a very solid cross-section of genes.^34,35 Since no FOXP2 targets had been previously identified, we reasoned that this platform would provide a good cross-section of targets.

We identified 175 targets in BG and 144 targets in IFC, using conservative criteria (see the “Material and Methods” section and table 1). The overlap between the two regions was highly significant, with 24% of IFC genes overlapping with BG genes (hypergeometric probability p<6.767×10^-22). An additional set of genes identified as regionally specific in either BG (141 genes) or IFC (110 genes) were identified (fig. 2). These genes may represent specific regional targets of FOXP2 regulation.

Table 1. .

Summary of Results for All Identified Target Genes^[Note]

			Tissue Detected			BG		IFC		Lung		Evolutionary Significance			TATTT[A/G]T		CAAATT		AAAT
Gene	GenBank Accession Number	Chromosome	BG	IFC	Lung	P	M Score	P	M Score	P	M Score	P	Ka/Ki	Ka/Ks	5′→3′	3′→5′	5′→3′	3′→5′	5′→3′	3′→5′
A2BP1	NM_145892	16	X		X	.0131	.9143	NA	NA	.0359	.7260	NA	NA	NA	0	0	1	1	10	4
ABH	NM_006020	14		X		NA	NA	.0150	.5692	NA	NA	NA	NA	NA	0	0	0	1	10	3
ADAM28	NM_021777	8	X			.0079	1.0674	NA	NA	NA	NA	.0395	.7658	.437	0	0	0	1	9	10
ADMR	NM_007264	12	X			.0387	.6588	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
AKAP6	NM_004274	14		X	X	NA	NA	.0058	.5468	.0246	.8147	NA	NA	NA	0	0	1	0	12	9
AKR7A2	NM_003689	1			X	NA	NA	NA	NA	.0319	.7002	.412	.5579	.4332	0	0	0	0	0	0
AMH	NM_000479	19		X		NA	NA	.0031	.5806	NA	NA	NA	NA	NA	0	0	0	0	1	0
AMY2A	NM_000699	1			X	NA	NA	NA	NA	.0386	.7024	NA	NA	NA	1	1	1	0	7	12
ANK1	NM_000037	8			X	NA	NA	NA	NA	.0175	.6487	NA	NA	NA	0	0	1	0	3	1
ANKTM1	NM_007332	8	X	X		.0460	.7704	.0026	.7532	NA	NA	NA	NA	NA	0	0	1	0	4	3
AOAH	NM_001637	7	X			.0016	1.0052	NA	NA	NA	NA	.021	.3038	.7755	0	0	1	0	9	6
AP1GBP1	NM_007247	17			X	NA	NA	NA	NA	.0243	.5700	NA	NA	NA	1	1	0	1	11	10
APOD	NM_001647	3	X			.0498	.6387	NA	NA	NA	NA	.0001	NA	NA	1	0	0	0	7	14
APPBP1	NM_003905	16		X		NA	NA	.0096	.7178	NA	NA	NA	NA	NA	0	0	1	0	7	4
ASGR1	NM_001671	17		X		NA	NA	.0099	.6434	NA	NA	.0235	NA	NA	0	0	0	0	3	3
ATF6	NM_007348	1			X	NA	NA	NA	NA	.0071	1.0159	NA	NA	NA	0	1	1	2	13	12
ATP1A2	NM_000702	1	X		X	.0473	.6462	NA	NA	.0281	.6642	NA	NA	NA	0	0	2	0	2	2
ATP2C1	NM_014382	3	X			.0335	.7018	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	1	1
ATP5A1	NM_004046	18	X			.0077	.5099	NA	NA	NA	NA	NA	NA	NA	1	0	0	0	6	5
ATP6B1	NM_001692	2			X	NA	NA	NA	NA	.0395	.5274	NA	NA	NA	0	0	0	0	2	0
ATP6H	NM_003945	5		X	X	NA	NA	.0023	.5945	.0190	.5686	NA	NA	NA	0	0	0	0	0	2
ATP6N1A	NM_005177	17		X		NA	NA	.0056	.5537	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
ATP6S1	NM_001183	X			X	NA	NA	NA	NA	.0437	.5208	NA	NA	NA	0	0	0	0	7	5
BET3	NM_014408	1	X		X	.0149	.5926	NA	NA	.0315	.5852	NA	NA	NA	0	0	0	1	4	3
BFSP1	NM_001195	20		X		NA	NA	.0153	.5430	NA	NA	NA	NA	NA	0	0	0	0	3	3
BM-002	NM_016617	13	X			.0055	.6497	NA	NA	NA	NA	NA	NA	NA	1	1	1	0	6	4
BRDG1	NM_012108	4	X		X	.0356	.7008	NA	NA	.0185	.8701	NA	NA	NA	NA	NA	NA	NA	NA	NA
C12ORF2	NM_007211	12			X	NA	NA	NA	NA	.0128	.6040	NA	NA	NA	NA	NA	NA	NA	NA	NA
C12ORF3	NM_020373	12	X			.0220	.6247	NA	NA	NA	NA	NA	NA	NA	1	0	0	0	3	9
C12orf47	NM_016534	12	X			.0064	.8127	NA	NA	NA	NA	NA	NA	NA	0	0	0	1	6	6
C1QA	NM_015991	1	X	X	X	.0099	.7268	.0025	.6873	.0265	.6403	NA	.4237	.791	NA	NA	NA	NA	NA	NA
C20orf24	NM_018840	20	X		X	.0171	.6045	NA	NA	.0223	.6199	NA	NA	NA	0	0	0	0	3	3
C4ST	NM_018413	12		X		NA	NA	.0079	.5435	NA	NA	NA	NA	NA	0	0	0	0	1	4
CA4	NM_000717	17			X	NA	NA	NA	NA	.0112	.6899	.2482	.6937	1.5476	NA	NA	NA	NA	NA	NA
CACNG3	NM_006539	16	X		X	.0164	.9633	NA	NA	.0128	.9116	NA	NA	NA	0	0	0	0	1	3
CALCRL	NM_005795	2	X	X	X	.0415	1.3025	.0010	.8368	.0026	.7912	NA	NA	NA	1	1	1	0	7	11
CBLB	NM_170662	3	X			.0479	.5994	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
hCBWD1	NM_018491	9		X		NA	NA	.0021	.6602	NA	NA	NA	NA	NA	0	1	0	1	12	5
CBWD2	NM_172003	2		X		NA	NA	.0085	.5472	NA	NA	NA	NA	NA	0	0	0	0	0	0
CC1.3	NM_004902	20	X			.0218	.6451	NA	NA	NA	NA	NA	NA	NA	0	0	1	1	2	5
CCK	NM_000729	3			X	NA	NA	NA	NA	.0126	.8671	NA	NA	NA	NA	NA	NA	NA	NA	NA
CCKAR	NM_000730	4	X			.0289	.5102	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	5	2
CCNG2	NM_004354	4	X		X	.0364	.5585	NA	NA	.0265	.6804	NA	NA	NA	0	0	0	0	1	0
CCS	NM_005125	11		X		NA	NA	.0046	.5259	NA	NA	NA	NA	NA	0	0	0	0	0	0
CD5	NM_014207	11	X	X	X	.0220	.9352	.0016	.7112	.0167	.5848	NA	NA	NA	0	0	1	0	9	2
CD7	NM_006137	17	X			.0494	.6252	NA	NA	NA	NA	NA	.7805	1.5375	0	0	0	0	1	2
CDC42BPB	NM_006035	14		X		NA	NA	.0024	.7014	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
CDH5	NM_001795	16			X	NA	NA	NA	NA	.0031	.7681	NA	NA	NA	0	0	0	0	5	4
CEACAM8	NM_001816	19	X			.0132	.6363	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	2	1
CER1	NM_005454	9		X	X	NA	NA	.0009	.7446	.0091	.6421	NA	.5913	1.7308	0	0	0	1	8	7
CGTHBA	NM_012075	16		X		NA	NA	.0033	.5614	NA	NA	NA	NA	NA	1	0	1	0	1	5
CHM-I	NM_007015	13	X	X		.0019	.8620	.0005	1.4095	NA	NA	NA	NA	NA	0	0	0	1	4	2
CKLF	NM_016326	16	X			.0034	.6263	NA	NA	NA	NA	NA	NA	NA	0	0	0	1	2	4
CMAH	D86324	6	X			.0232	.6378	NA	NA	NA	NA	NA	NA	NA	0	0	0	1	8	12
COLQ	NM_005677	3		X	X	NA	NA	.0063	.5571	.0124	.7294	NA	NA	NA	0	1	0	0	8	8
CRH	NM_000756	8	X	X	X	.0184	.8799	.0009	.7169	.0192	.7540	NA	NA	NA	0	1	0	0	5	6
CRIM1	NM_016441	2		X		NA	NA	.0024	.5528	NA	NA	NA	NA	NA	0	0	0	0	0	1
CRSP3	NM_015979	6			X	NA	NA	NA	NA	.0240	.7035	NA	NA	NA	0	0	0	0	2	5
CRTL1	NM_001884	5	X			.0322	.5414	NA	NA	NA	NA	NA	NA	NA	0	1	0	1	4	5
CRYBA4	NM_001886	22			X	NA	NA	NA	NA	.0285	.5111	NA	NA	NA	0	0	1	0	5	5
CRYBB3	NM_004076	22		X		NA	NA	.0062	.5106	NA	NA	.4505	.6762	.6374	0	1	0	0	4	2
CRYGB	NM_005210	2	X		X	.0366	.5356	NA	NA	.0208	.5789	NA	NA	NA	0	0	0	1	6	8
CXADR	NM_001338	21			X	NA	NA	NA	NA	.0263	.6591	.0001	NA	NA	0	0	0	0	1	3
CYB5-M	NM_030579	16	X			.0167	.6880	NA	NA	NA	NA	.0048	NA	NA	0	0	0	0	3	2
CYP21A2	NM_000500	6			X	NA	NA	NA	NA	.0326	.5541	NA	NA	NA	0	0	0	0	3	4
CYP2J2	NM_000775	1	X			.0332	.5021	NA	NA	NA	NA	.0001	.4403	.7101	1	0	0	0	7	3
DAXX	NM_001350	6	X		X	.0102	.8786	NA	NA	.0331	.6247	.0308	NA	NA	0	0	0	0	2	2
DCT	NM_001922	13			X	NA	NA	NA	NA	.0220	.6489	.0331	NA	NA	0	0	0	1	9	5
DEF6	NM_022047	6	X			.0206	.8739	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	1	3
DGKE	NM_003647	17	X	X	X	.0260	.8173	.0001	.8459	.0091	.8624	NA	NA	NA	0	0	0	0	0	1
DIAPH1	NM_005219	5		X		NA	NA	.0054	.5502	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
DISC1	NM_018662	1	X			.0215	.6402	NA	NA	NA	NA	NA	.8117	.3802	0	0	0	0	3	1
DNASE1L2	NM_001374	16		X		NA	NA	.0240	.6027	NA	NA	NA	NA	NA	0	0	0	0	1	1
DPAGT1	NM_001382	11		X		NA	NA	.0087	.5263	NA	NA	.1513	.1004	.5	0	0	0	2	2	4
DPP6	NM_001936	7	X			.0440	.6273	NA	NA	NA	NA	NA	NA	NA	0	0	2	0	16	13
DSS1	NM_006304	7	X		X	.0369	.7390	NA	NA	.0284	.7568	NA	NA	NA	0	1	1	0	9	6
E2-EPF	NM_014501	17			X	NA	NA	NA	NA	.0192	.7032	NA	NA	NA	1	0	0	0	3	5
EBI2	NM_004951	13	X	X	X	.0431	1.5721	.0001	.9837	.0003	1.0850	NA	NA	NA	0	0	3	1	17	18
ECAC1	NM_019841	7	X			.0285	.5386	NA	NA	NA	NA	NA	NA	NA	0	0	1	0	3	4
EDF1	NM_003792	9			X	NA	NA	NA	NA	.0061	.8091	NA	NA	NA	0	0	0	0	4	4
EFEMP2	NM_016938	11	X		X	.0436	.5835	NA	NA	.0171	.6877	NA	NA	NA	0	0	0	0	2	2
EFNB3	NM_001406	17			X	NA	NA	NA	NA	.0158	.6209	.0365	.3821	.8846	0	0	0	0	0	0
EGFL7	NM_201446	9	X		X	NA	.9198	NA	NA	.0137	.9309	NA	NA	NA	0	0	1	0	3	0
EIF4EBP2	NM_004096	10			X	NA	NA	NA	NA	.0163	.7665	NA	NA	NA	0	0	0	0	2	2
EMK1	NM_004954	11	X		X	.0028	.8569	NA	NA	.0425	.5757	NA	NA	NA	0	0	0	0	4	3
EMR2	NM_001784	19	X	X		.0425	.7391	.0079	.5144	NA	NA	.4906	.5098	.6667	0	0	0	0	1	4
EPB41	NM_203342	1	X			.0354	.6121	NA	NA	NA	NA	NA	NA	NA	1	0	0	1	7	16
EPHA2	NM_004431	1	X			.0379	.5563	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	1	0
EPHX2	NM_001979	8	X	X		.0214	.9185	.0018	.6189	NA	NA	.0472	NA	NA	0	0	0	0	1	2
EPOR	NM_000121	19	X	X	X	.0171	.9258	.0263	.5590	.0037	1.1961	.0832	.1999	.5185	1	0	0	0	3	8
ERCC4	NM_005236	16	X			.0115	.5582	NA	NA	NA	NA	.0439	NA	NA	0	0	0	0	3	1
ERO1L	NM_014584	14		X		NA	NA	.0021	.7909	NA	NA	NA	NA	NA	0	0	0	0	10	8
ERO1Lβ	NM_019891	1			X	NA	NA	NA	NA	.0187	.5690	NA	NA	NA	0	0	0	0	2	1
EVC	NM_014556	4		X	X	NA	NA	.0016	.5830	.0181	.6591	NA	NA	NA	0	0	0	0	3	0
FAAH	NM_001441	1			X	NA	NA	NA	NA	.0252	.6041	NA	NA	NA	0	0	0	0	4	3
FACL3	NM_004457	2			X	NA	NA	NA	NA	.0496	.5204	NA	NA	NA	1	0	1	1	5	21
FBXO22	NM_147188	15	X		X	.0454	.6194	NA	NA	.0431	.5989	NA	NA	NA	0	0	0	1	5	6
FBXW2	NM_012164	9	X		X	.0236	.7398	NA	NA	.0182	.6760	NA	NA	NA	0	0	0	1	2	4
FCGR2A	DQ894525	1	X			.0222	.6197	NA	NA	NA	NA	.0008	.7127	2.8529	0	0	0	0	2	2
FGF5	NM_004464	4		X		NA	NA	.0077	.5140	NA	NA	NA	NA	NA	0	1	0	0	3	3
FGF8	NM_006119	10		X		NA	NA	.0085	.5008	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
FGR	NM_005248	1	X			.0283	.5766	NA	NA	NA	NA	NA	NA	NA	0	0	1	0	5	1
FNTB	NM_002028	14			X	NA	NA	NA	NA	.0404	.5170	NA	NA	NA	0	1	0	1	8	3
FOLR1	NM_016725	11	X			.0338	.7973	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	2	5
FSHR	NM_000145	2	X		X	.0278	.7671	NA	NA	.0349	.6176	.339	.5082	.7816	0	0	0	0	7	7
FTH1	NM_002032	11		X	X	NA	NA	.0004	.7659	.0173	.5704	NA	NA	NA	1	0	0	1	11	12
FUBP1	NM_003902	1		X	X	NA	NA	.0009	.7045	.0213	.6357	NA	NA	NA	NA	NA	NA	NA	NA	NA
FY	NM_002036	1			X	NA	NA	NA	NA	.0179	.6230	.0361	NA	NA	NA	NA	NA	NA	NA	NA
G10	NM_003910	7		X		NA	NA	.0057	.8101	NA	NA	.0119	NA	NA	0	0	0	0	2	1
G6PC	NM_000151	17	X		X	.0070	.5722	NA	NA	.0269	.6607	NA	NA	NA	0	0	1	0	7	6
GABBR1	NM_001470	6		X		NA	NA	.0063	.6116	NA	NA	NA	NA	NA	0	0	0	0	1	1
GADD45G	NM_006705	9			X	NA	NA	NA	NA	.0294	.6485	NA	NA	NA	0	0	2	0	6	3
GALR2	NM_003857	17		X		NA	NA	.0057	.5536	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
GALR3	NM_003614	22			X	NA	NA	NA	NA	.0118	.6806	NA	NA	NA	0	0	0	0	1	3
GARS	NM_002047	7	X		X	.0290	.6988	NA	NA	.0181	.6901	NA	NA	NA	0	0	0	0	3	9
GBAS	NM_001483	7	X		X	.0275	.8326	NA	NA	.0254	.5739	NA	NA	NA	0	0	0	0	3	2
GDF5	NM_000557	20	X	X	X	.0416	.9516	.0025	.6273	.0075	.7943	NA	NA	NA	0	1	0	0	5	5
GDF9	NM_005260	5		X		NA	NA	.0027	.7455	NA	NA	NA	NA	NA	0	0	5	1	16	7
GFRA1	NM_005264	10	X		X	.0128	1.0440	NA	NA	.0438	.5414	.0287	NA	NA	0	1	0	0	7	3
GFRA4	NM_022139	20		X		NA	NA	.0027	.7145	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
GIF	NM_005142	11	X		X	.0410	.7947	NA	NA	.0152	.9503	NA	.4007	.7541	NA	NA	NA	NA	NA	NA
GJB2	NM_004004	13	X			.0170	.5045	NA	NA	NA	NA	NA	NA	NA	0	0	1	0	5	5
GLUD1	NM_005271	10			X	NA	NA	NA	NA	.0218	.6532	.0011	NA	NA	0	3	0	0	12	10
GMPS	NM_003875	3		X		NA	NA	.0079	.5831	NA	NA	NA	NA	NA	1	0	1	2	9	16
GNB2L1	NM_006098	5		X		NA	NA	.0099	.5403	NA	NA	NA	NA	NA	1	0	0	0	4	8
GP1BA	NM_000173	17		X		NA	NA	.0026	.8359	NA	NA	NA	NA	NA	0	0	0	0	1	2
GPLD1	NM_001503	6	X			.0134	.5954	NA	NA	NA	NA	.009	.5473	.4088	0	0	1	0	12	7
GPR21	NM_005294	9	X			.0315	.6415	NA	NA	NA	NA	NA	.4147	1.3871	0	0	1	0	7	8
GPR24	NM_005297	22	X			.0383	.6207	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	2	2
GPR75	NM_006794	2	X			.0069	.5032	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	4	5
GRIK1	NM_000830	21	X		X	.0270	.8532	NA	NA	.0181	.7106	.0439	NA	NA	0	0	0	1	6	4
GRO2	NM_002089	4		X	X	NA	NA	.0038	.6167	.0113	.6158	NA	NA	NA	NA	NA	NA	NA	NA	NA
GROS1	NM_022356	1		X		NA	NA	.0041	.5843	NA	NA	NA	NA	NA	0	0	0	0	0	0
HADH2	NM_004493	X	X			.0050	.6023	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	2	1
HAS1	NM_001523	19	X	X	X	.0475	1.3249	.0009	.8220	.0011	.8959	NA	NA	NA	0	0	0	0	7	1
HBQ1	NM_005331	16			X	NA	NA	NA	NA	.0235	.5414	NA	NA	NA	0	0	0	0	7	5
HESX1	NM_003865	3	X		X	.0415	.5856	NA	NA	.0482	.6339	.3485	.5971	75	1	1	0	0	11	15
HEXB	NM_000521	5	X			.0322	.6266	NA	NA	NA	NA	.2235	.6457	.9425	0	0	0	1	1	4
HIVEP1	NM_002114	6			X	NA	NA	NA	NA	.0108	.6495	NA	NA	NA	NA	NA	NA	NA	NA	NA
HOXA6	NM_024014	7	X			.0271	.5207	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	3	2
HOXB5	NM_002147	17		X		NA	NA	.0042	.5741	NA	NA	.0025	NA	NA	1	0	0	0	6	5
HOXB6	NM_156036	17	X		X	.0230	1.1453	NA	NA	.0198	.5892	NA	NA	NA	1	0	0	0	1	6
HOXB7	NM_004502	17	X			.0426	.5147	NA	NA	NA	NA	.2016	.4565	.7049	NA	NA	NA	NA	NA	NA
HSPB7	NM_014424	1			X	NA	NA	NA	NA	.0006	.9824	NA	NA	NA	NA	NA	NA	NA	NA	NA
HXB	NM_002160	9	X		X	.0053	.8143	NA	NA	.0456	.5818	NA	NA	NA	0	0	0	0	4	3
IGLL1	NM_020070	22		X	X	NA	NA	.0004	.7403	.0062	.7784	NA	NA	NA	0	0	0	0	1	1
IK	NM_006083	5		X		NA	NA	.0063	.5097	NA	NA	0	NA	NA	0	0	0	0	2	3
IL4R	NM_000418	16	X		X	.0397	.6960	NA	NA	.0196	.7007	NA	NA	NA	0	0	0	0	3	2
ING4	NM_016162	12	X		X	.0435	.8067	NA	NA	.0355	.8162	NA	NA	NA	1	0	0	0	6	3
INHA	NM_002191	2			X	NA	NA	NA	NA	.0230	.6319	.0123	.4267	.6471	0	1	0	1	3	1
ITGB3	NM_000212	17	X			.0362	.5971	NA	NA	NA	NA	.0164	NA	NA	0	0	0	1	2	1
ITGB4BP	NM_002212	20	X		X	.0280	.6697	NA	NA	.0048	.7917	NA	NA	NA	0	0	0	0	0	1
JMJ	NM_004973	6		X		NA	NA	.0043	.5377	NA	NA	NA	NA	NA	1	0	1	0	4	11
K6HF	NM_004693	12	X	X	X	.0409	.6749	.0041	.5061	.0092	.8341	NA	NA	NA	0	0	0	0	3	1
KCNB1	NM_004975	20	X		X	.0419	.5127	NA	NA	.0184	.6952	NA	NA	NA	0	0	0	0	1	0
KCND1	NM_004979	X	X			.0037	.7040	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	1	1
KCNJ15	NM_004983	21	X	X		.0310	.7042	.0020	.5799	NA	NA	NA	NA	NA	0	0	1	0	9	10
KIAA0026	NM_012286	X	X		X	.0394	.6612	NA	NA	.0045	.9468	NA	NA	NA	0	0	0	0	2	5
KIAA0905	NM_014933	4	X		X	.0094	.5448	NA	NA	.0285	.5473	NA	NA	NA	0	0	1	0	1	3
KIAA0979	NM_015032	13		X		NA	NA	.0038	.5382	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
KIR3DL1	NM_013289	19	X	X	X	.0178	.5990	.0031	.6378	.0067	.7822	NA	NA	NA	0	0	1	0	12	9
KIT	NM_000222	4			X	NA	NA	NA	NA	.0183	.8021	NA	NA	NA	0	0	0	0	1	2
KLHL3	NM_017415	5	X			.0046	.7050	NA	NA	NA	NA	NA	NA	NA	1	0	0	1	1	9
KPNB1	NM_002265	17	X		X	.0067	.8313	NA	NA	.0192	.7568	NA	NA	NA	NA	NA	NA	NA	NA	NA
LBR	NM_002296	1		X	X	NA	NA	.0004	.7878	.0021	.8348	NA	.4127	1.0833	0	0	2	3	12	18
LENEP	NM_018655	1	X			.0191	.5764	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	1	0
LGALS4	NM_006149	19		X		NA	NA	.0025	.6104	NA	NA	NA	NA	NA	1	0	0	0	0	1
LIMD1	NM_014240	3		X		NA	NA	.0043	.5049	NA	NA	NA	NA	NA	0	0	0	1	3	2
LIPG	NM_006033	18		X		NA	NA	.0121	.5269	NA	NA	NA	NA	NA	1	0	0	0	3	1
LOC51152	NM_016181	1	X	X	X	.0111	.8251	.0040	.5132	.0165	.6583	NA	NA	NA	1	0	0	0	1	2
LOC51668	NM_016126	1		X		NA	NA	.0049	.5406	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
LOC55829	NM_018445	15			X	NA	NA	NA	NA	.0414	.5091	NA	NA	NA	0	1	0	0	4	3
LRP3	NM_002333	19		X	X	NA	NA	.0037	.6851	.0164	.7159	NA	NA	NA	NA	NA	NA	NA	NA	NA
LSM4	NM_012321	19	X		X	.0441	.5264	NA	NA	.0133	.6764	NA	NA	NA	0	0	0	0	1	7
LTB	NM_002341	6	X		X	.0256	.8010	NA	NA	.0019	1.0656	NA	NA	NA	0	0	0	0	0	2
LTF	NM_002343	3	X			.0176	.5066	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	3	1
LY64	NM_005582	5		X	X	NA	NA	.0001	.8310	.0102	.7571	NA	NA	NA	0	0	1	0	5	6
LY95	NM_004828	6			X	NA	NA	NA	NA	.0282	.5141	NA	NA	NA	0	0	0	0	0	1
LZLP	NM_013344	11		X		NA	NA	.0027	.5994	NA	NA	NA	NA	NA	0	1	0	1	9	7
MAD	NM_002357	2	X			.0412	.6233	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	0	0
MADH3	NM_005902	15		X	X	NA	NA	.0003	.7307	.0254	.7535	NA	NA	NA	0	0	0	0	1	1
MAP2K3	NM_002756	17	X		X	.0116	.6834	NA	NA	.0272	.5976	.0345	NA	NA	NA	NA	NA	NA	NA	NA
MAPRE3	NM_012326	2		X	X	NA	NA	.0039	.5069	.0177	.7014	NA	NA	NA	0	0	0	1	3	1
MCF2	NM_005369	X		X		NA	NA	.0050	.5946	NA	NA	.0413	NA	NA	2	1	0	1	11	12
MDFI	NM_005586	6	X			.0266	.5077	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	1	3
MEF2C	NM_002397	5	X		X	.0212	.7250	NA	NA	.0267	.8366	NA	NA	NA	0	1	1	0	23	15
MEF2D	NM_005920	1	X	X	X	.0316	.8039	.0005	.7094	.0113	.9174	NA	NA	NA	0	0	0	0	2	1
MEOX1	NM_004527	17	X			.0315	.5022	NA	NA	NA	NA	.0839	.4824	52	0	1	0	2	9	10
MEP1B	NM_005925	18			X	NA	NA	NA	NA	.0209	.6317	NA	NA	NA	0	1	0	1	11	11
MEST	NM_177525	7			X	NA	NA	NA	NA	.0168	.6294	NA	NA	NA	0	0	0	0	0	0
MFAP2	NM_017459	1			X	NA	NA	NA	NA	.0281	.5131	NA	NA	NA	0	0	0	1	7	7
MGST2	NM_002413	4			X	NA	NA	NA	NA	.0101	.6587	.0716	.313	.623	0	1	0	0	5	2
MLANA	NM_005511	9		X		NA	NA	.0072	.5979	NA	NA	NA	NA	NA	1	0	1	0	11	10
MLLT1	NM_005934	19	X		X	.0090	.7103	NA	NA	.0321	.6642	NA	NA	NA	0	0	0	0	0	1
MMP23B	NM_006983	1	X		X	.0423	.7716	NA	NA	.0143	.8810	NA	NA	NA	0	0	0	0	4	1
MPDU1	NM_004870	17			X	NA	NA	NA	NA	.0150	.6057	NA	NA	NA	0	0	0	0	2	1
MPP3	NM_001932	17		X		NA	NA	.0093	.8638	NA	NA	NA	NA	NA	1	1	0	0	3	5
MRAS	NM_012219	3		X	X	NA	NA	.0008	.8490	.0113	.7427	.0137	NA	NA	NA	NA	NA	NA	NA	NA
MSE55	NM_152243	22		X		NA	NA	.0032	.5731	NA	NA	NA	NA	NA	0	0	0	0	0	0
MSLN	NM_013404	16			X	NA	NA	NA	NA	.0220	.6583	NA	.5922	.5	0	0	0	0	0	3
MT1H	NM_005951	16			X	NA	NA	NA	NA	.0439	.5132	NA	NA	NA	0	0	1	0	1	1
MT2A	NM_005953	16			X	NA	NA	NA	NA	.0195	.5782	NA	NA	NA	0	0	0	0	0	2
MTF1	NM_005955	1		X	X	NA	NA	.0127	.5936	.0201	.5506	NA	NA	NA	0	0	0	0	3	0
MTHFD2	NM_006636	2			X	NA	NA	NA	NA	.0143	.5956	NA	NA	NA	0	0	0	0	1	3
NAP1	NM_004851	19		X		NA	NA	.0052	.5228	NA	NA	NA	.7813	.7522	0	1	0	0	6	2
NCF2	NM_000433	1		X		NA	NA	.0038	.5397	NA	NA	.1293	.4255	.8846	0	0	0	1	3	8
NCOA1	NM_003743	2		X		NA	NA	.0304	.7087	NA	NA	NA	NA	NA	0	0	0	0	10	7
NDST4	NM_022569	4	X			.0038	.8242	NA	NA	NA	NA	NA	NA	NA	0	1	1	0	8	7
NDUFA2	NM_002488	5	X			.0331	.7012	NA	NA	NA	NA	.2525	1.6458	1.2958	0	1	0	0	4	1
NDUFB7	NM_004146	19		X		NA	NA	.0054	.5247	NA	NA	NA	NA	NA	0	0	0	2	8	5
NDUFS8	NM_002496	11		X		NA	NA	.0016	.8725	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
NIBAN	NM_052966	1	X			.0286	.6822	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	1	7
NICE-1	NM_019060	1	X	X		.0153	.8528	.0075	.5080	NA	NA	NA	NA	NA	0	0	0	0	3	1
NOS1	NM_000620	12	X	X	X	.0340	1.1315	.0011	.6678	.0100	.6303	NA	NA	NA	1	0	0	0	8	3
NR1H3	NM_005693	11		X		NA	NA	.0031	.5660	NA	NA	NA	NA	NA	0	0	0	0	4	1
NR5A2	NM_003822	1	X			.0081	.7970	NA	NA	NA	NA	NA	NA	NA	1	1	0	1	5	14
NRIP1	NM_003489	21			X	NA	NA	NA	NA	.0337	.5853	NA	NA	NA	1	0	1	0	7	15
NRN1	NM_016588	6	X			.0120	.7757	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	5	4
NTSR1	NM_002531	20	X		X	.0133	.6634	NA	NA	.0383	.6024	NA	NA	NA	0	0	0	0	3	2
NUDT1	NM_002452	7	X		X	.0110	.8431	NA	NA	.0432	.5571	NA	NA	NA	0	0	0	0	1	2
OAS2	NM_016817	12		X		NA	NA	.0038	.6665	NA	NA	NA	NA	NA	0	0	0	0	1	3
OMI	NM_012103	2	X	X	X	.0479	.7194	.0144	.5025	.0132	1.0094	NA	NA	NA	0	0	0	0	1	1
OPN1LW	NM_020061	X			X	NA	NA	NA	NA	.0153	.6269	NA	NA	NA	0	0	0	0	5	0
OR1A1	NM_014565	17			X	NA	NA	NA	NA	.0210	.6286	NA	NA	NA	3	1	0	0	9	13
P115	NM_003715	4	X			.0140	.5315	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	7	5
PAR3	NM_019619	10	X			.0372	.6575	NA	NA	NA	NA	NA	NA	NA	0	1	0	2	10	7
PARG	NM_003631	10			X	NA	NA	NA	NA	.0275	.5181	.0064	NA	NA	0	0	0	0	4	0
PARVA	NM_018222	11	X			.0057	.5302	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	2	2
PAX1	NM_006192	2			X	NA	NA	NA	NA	.0243	.5289	NA	NA	NA	NA	NA	NA	NA	NA	NA
PAX3	NM_000438	11	X	X	X	.0300	1.1898	.0034	.6882	.0010	.9766	.0235	NA	NA	0	0	0	0	2	2
PDX1	NM_003477	21		X	X	NA	NA	.0035	.5188	.0234	.6471	NA	NA	NA	0	1	0	0	2	1
PDXK	NM_003681	3			X	NA	NA	NA	NA	.0187	.6162	.0132	NA	NA	0	0	0	0	0	0
PFKFB4	NM_004567	19	X			.0499	.6651	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	2	0
PGLYRP	NM_005091	11			X	NA	NA	NA	NA	.0262	.6950	NA	1.8051	.5485	1	0	0	0	8	3
PIG11	NM_006034	2	X			.0211	.7178	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	2	0
PIG3	NM_004881	3		X		NA	NA	.0127	.5042	NA	NA	NA	NA	NA	0	0	0	0	4	3
PIK3CB	NM_006219	7	X			.0151	.5663	NA	NA	NA	NA	NA	NA	NA	1	0	1	4	13	19
PILRα	NM_013439	12	X		X	.0358	.6271	NA	NA	.0246	.6280	NA	NA	NA	0	0	0	0	1	1
PIR51	NM_006479	4	X		X	.0130	.8437	NA	NA	.0051	.9570	NA	.404	56	0	0	1	2	6	7
PKIA	NM_000297	8	X			.0456	.5862	NA	NA	NA	NA	NA	NA	NA	0	0	2	0	10	5
PLAA	NM_004253	9			X	NA	NA	NA	NA	.0267	.5389	NA	NA	NA	2	0	0	0	7	16
PLOD3	NM_001084	7		X		NA	NA	.0243	.5394	NA	NA	NA	NA	NA	0	0	0	0	3	2
PLS3	NM_006823	X	X			.0243	.5527	NA	NA	NA	NA	NA	NA	NA	0	0	1	0	3	4
PLU-1	NM_006618	1		X		NA	NA	.0205	.5359	NA	NA	NA	NA	NA	0	0	1	0	5	1
PM5	NM_014287	16	X	X	X	.0227	1.3605	.0012	.7689	.0009	.9788	NA	NA	NA	0	0	1	0	4	3
PMX2B	NM_003924	4	X			.0172	.7359	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	5	8
PNOC	NM_006228	8			X	NA	NA	NA	NA	.0089	.7730	NA	NA	NA	0	0	0	0	1	4
PNR	NM_003967	6			X	NA	NA	NA	NA	.0093	.9334	NA	NA	NA	1	0	0	0	7	14
POLM	NM_013284	7			X	NA	NA	NA	NA	.0241	.5581	NA	NA	NA	NA	NA	NA	NA	NA	NA
POLR2D	NM_004805	2		X		NA	NA	.0053	.6817	NA	NA	NA	NA	NA	0	0	0	0	4	6
PON2	NM_000305	7	X		X	.0319	.7761	NA	NA	.0494	.5680	.0112	NA	NA	1	0	0	0	3	3
POU4F2	NM_004575	4		X		NA	NA	.0104	.5192	NA	NA	NA	NA	NA	0	0	0	0	0	2
POU4F3	NM_002700	5	X	X	X	.0403	.8517	.0012	.6869	.0085	.7370	NA	NA	NA	0	0	1	0	2	1
PPIF	NM_005729	10			X	NA	NA	NA	NA	.0430	.5081	NA	NA	NA	0	0	1	0	2	2
PPP2R1B	NM_181699	11		X	X	NA	NA	.0076	.5880	.0300	.5046	.0366	NA	NA	1	0	0	0	4	2
PPP2R5C	NM_015512	3			X	NA	NA	NA	NA	.0084	.7154	NA	NA	NA	0	0	1	1	6	3
PRAX-1	NM_002700	17	X			.0445	.5316	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	1	0
PRDX5	NM_012094	11		X		NA	NA	.0200	.6032	NA	NA	NA	.4122	.902	0	0	2	0	7	3
PRG4	NM_004758	17	X		X	.0380	.5144	NA	NA	.0390	.5280	.1725	2.4455	.5826	NA	NA	NA	NA	NA	NA
PRH	NM_015893	2	X	X	X	.0202	1.0341	.0009	.7512	.0094	.9816	NA	NA	NA	NA	NA	NA	NA	NA	NA
PRKAR1A	NM_002734	17		X		NA	NA	.0056	.5440	NA	NA	NA	NA	NA	1	0	0	0	3	10
PRND	NM_012409	20		X		NA	NA	.0013	.6788	NA	NA	NA	.7955	.4877	1	0	0	0	3	5
PRSS12	NM_003619	4			X	NA	NA	NA	NA	.0078	1.0619	NA	NA	NA	0	0	0	0	11	14
PRSS8	NM_002773	16	X	X	X	.0299	.7276	.0019	.5939	.0090	.7619	NA	NA	NA	0	0	0	0	1	0
PSA	NM_021154	9			X	NA	NA	NA	NA	.0299	.5052	NA	NA	NA	0	1	0	0	4	0
PSCD4	NM_013385	22	X			.0116	.5300	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	1	3
PSG6	NM_002782	19			X	NA	NA	NA	NA	.0188	.6806	NA	NA	NA	0	0	0	0	3	0
PSMB7	NM_002799	9			X	NA	NA	NA	NA	.0348	.5884	NA	NA	NA	0	0	2	0	2	1
PSME1	NM_006263	14			X	NA	NA	NA	NA	.0160	.5836	NA	NA	NA	0	0	0	0	0	1
PTGER1	NM_000955	19			X	NA	NA	NA	NA	.0024	.8247	NA	NA	NA	0	1	0	0	1	2
PTPRM	NM_002845	18		X		NA	NA	.0130	.5310	NA	NA	NA	NA	NA	0	0	0	0	7	9
PVR	NM_006505	19		X		NA	NA	.0303	.6698	NA	NA	NA	.886	.3417	0	0	0	0	1	1
RAB10	NM_016131	2		X		NA	NA	.0018	.5768	NA	NA	NA	NA	NA	0	0	0	0	0	3
RAB27A	NM_004580	15	X			.0209	.5453	NA	NA	NA	NA	NA	NA	NA	2	0	0	0	6	9
RAB27B	NM_004163	18	X			.0027	.7780	NA	NA	NA	NA	NA	NA	NA	0	0	0	1	5	3
RAB33A	NM_004794	X			X	NA	NA	NA	NA	.0330	.5027	NA	NA	NA	NA	NA	NA	NA	NA	NA
RAB5EP	NM_004703	17			X	NA	NA	NA	NA	.0331	.5354	NA	NA	NA	0	0	0	0	1	5
RAB8B	NM_016530	15	X			.0071	.6620	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	3	3
RAYL	NM_006860	22	X			.0114	.5825	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	1	4
RBP2	NM_004164	3	X			.0320	.5133	NA	NA	NA	NA	NA	.9006	106	0	0	0	0	5	2
RECQL5	NM_004259	17			X	NA	NA	NA	NA	.0041	.7924	NA	NA	NA	1	0	1	0	6	8
RFC1	NM_002913	4		X		NA	NA	.0002	.8516	NA	NA	NA	NA	NA	1	0	0	0	4	4
RNAHP	NM_007372	17	X			.0270	.7921	NA	NA	NA	NA	NA	NA	NA	2	0	0	3	11	15
RNF24	NM_007219	20		X		NA	NA	.0130	.5324	NA	NA	NA	NA	NA	0	0	0	0	0	3
RPL10	NM_006013	X		X	X	NA	NA	.0015	.7964	.0199	.7086	.026	NA	NA	0	0	0	0	1	1
RPL23	NM_000978	17		X		NA	NA	.0120	.5285	NA	NA	NA	NA	NA	0	1	0	0	3	0
RPL8	NM_000973	8	X			.0106	.5005	NA	NA	NA	NA	.0136	NA	NA	0	0	0	0	0	1
RPS6KA2	NM_021135	6	X			.0413	.6324	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	0	0
RQCD1	NM_005444	2	X	X	X	.0385	.7866	.0003	.7407	.0057	1.0475	NA	NA	NA	0	0	0	0	2	5
RRAS	NM_006270	19		X		NA	NA	.0118	.5014	NA	NA	.0468	NA	NA	0	0	0	0	1	1
RRM1	NM_001033	11		X		NA	NA	.0124	.6071	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
RYR3	NM_001036	15		X		NA	NA	.0045	.5486	NA	NA	NA	NA	NA	0	0	0	0	0	0
S100A10	NM_002966	1			X	NA	NA	NA	NA	.0333	.5531	.0219	NA	NA	0	0	0	0	2	1
SCRG1	NM_007281	4	X	X	X	.0245	.8622	.0037	.6126	.0050	.8163	.0001	NA	NA	NA	NA	NA	NA	NA	NA
SDHA	NM_004168	5			X	NA	NA	NA	NA	.0463	.5104	NA	NA	NA	0	0	0	0	2	3
SEMA3B	NM_004636	3	X		X	.0248	.7193	NA	NA	.0272	.5989	.001	NA	NA	0	0	0	0	2	2
SIAT8D	NM_005668	5	X		X	.0308	.6569	NA	NA	.0182	.7220	NA	NA	NA	0	0	0	0	1	3
SIRT6	NM_016539	19	X	X	X	.0455	1.1561	.0007	.7775	.0151	.5832	NA	NA	NA	0	0	0	1	3	4
SKD1	NM_004869	18			X	NA	NA	NA	NA	.0226	.6079	NA	NA	NA	0	0	0	0	2	2
SLC13A2	NM_003984	17			X	NA	NA	NA	NA	.0427	.5468	.299	.4976	.1465	0	0	0	1	1	1
SLC17A3	NM_006632	6	X			.0071	.8426	NA	NA	NA	NA	NA	NA	NA	0	1	1	0	7	5
SLC25A3	NM_002635	12	X		X	.0052	.6005	NA	NA	.0012	1.3485	NA	NA	NA	0	0	0	0	4	2
SLC26A6	NM_022911	3	X		X	.0113	.5554	NA	NA	.0442	.5924	NA	.4473	.6154	0	0	0	0	1	0
SLC28A1	NM_004213	15			X	NA	NA	NA	NA	.0297	.7211	.0178	NA	NA	0	0	0	1	2	3
SLC4A2	NM_003040	7		X		NA	NA	.0075	.5017	NA	NA	NA	NA	NA	1	0	0	0	0	4
SLC4A4	NM_003759	4	X			.0381	.6320	NA	NA	NA	NA	.0023	NA	NA	NA	NA	NA	NA	NA	NA
SLC4A8	NM_004858	12			X	NA	NA	NA	NA	.0064	.6813	NA	NA	NA	0	0	0	0	2	4
SLN	NM_003063	11	X			.0409	.5860	NA	NA	NA	NA	NA	NA	NA	0	1	1	0	10	8
SMOC1	NM_022137	14	X			.0162	.5248	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	2	1
SMTN	NM_006932	22			X	NA	NA	NA	NA	.0157	.6823	NA	NA	NA	0	0	0	0	0	0
SNAP25	NM_003085	5	X		X	.0495	.6919	NA	NA	.0182	.7532	NA	NA	NA	NA	NA	NA	NA	NA	NA
SNCB	NM_003096	5	X		X	.0389	.7511	NA	NA	.0341	.5934	NA	NA	NA	0	0	0	0	2	2
SNRPB2	NM_003092	20		X		NA	NA	.0053	.5351	NA	NA	NA	NA	NA	0	0	0	0	2	5
SNRPG	NM_003096	2	X	X	X	.0259	.7083	.0097	.5847	.0072	.8152	.0008	NA	NA	2	0	0	0	3	7
SNW1	NM_012245	14		X		NA	NA	.0062	.6774	NA	NA	.0095	NA	NA	NA	NA	NA	NA	NA	NA
SOLH	NM_005632	16		X		NA	NA	.0050	.5447	NA	NA	NA	NA	NA	0	0	0	0	0	0
SOX13	NM_005686	1		X		NA	NA	.0033	.5509	NA	NA	NA	NA	NA	0	1	0	0	3	3
STAC	NM_003149	3			X	NA	NA	NA	NA	.0117	.9971	NA	NA	NA	NA	NA	NA	NA	NA	NA
STK11	NM_000455	19		X		NA	NA	.0496	.5056	NA	NA	.002	NA	NA	0	0	0	0	1	1
STX6	NM_005819	1	X		X	.0476	.5889	NA	NA	.0102	.9135	NA	NA	NA	0	0	0	0	3	5
SYK	NM_003177	9		X	X	NA	NA	.0052	.6308	.0008	1.0833	.0001	NA	NA	0	0	0	0	2	2
SYN47	NM_004272	5		X	X	NA	NA	.0005	.7356	.0087	.7914	NA	NA	NA	0	1	1	0	9	5
TACSTD2	NM_002353	1	X			.0184	.6988	NA	NA	NA	NA	NA	NA	NA	0	1	1	1	8	6
TACTILE	NM_005816	3			X	NA	NA	NA	NA	.0450	.5909	NA	NA	NA	0	0	1	1	14	10
TAF1C	NM_005679	16			X	NA	NA	NA	NA	.0329	.5503	.0000008	.4367	.6475	2	0	0	0	3	7
TAF2F	NM_005642	5		X		NA	NA	.0108	.5514	NA	NA	NA	NA	NA	0	0	0	0	2	4
TAF2N	NM_003487	17		X	X	NA	NA	.0078	.5738	.0222	.5442	NA	NA	NA	NA	NA	NA	NA	NA	NA
TAGLN	NM_003186	11		X	X	NA	NA	.0002	.7463	.0002	1.2027	NA	NA	NA	0	0	0	0	3	1
TCP10	NM_004610	6		X		NA	NA	.0195	.5170	NA	NA	NA	NA	NA	0	0	0	2	6	5
TDO2	NM_005651	4		X	X	NA	NA	.0004	.7506	.0022	.8348	NA	NA	NA	1	0	1	3	10	16
TGFB2	NM_003238	1	X	X		.0351	.9198	.0054	.5532	NA	NA	.003	NA	NA	0	0	0	0	4	6
TGM2	NM_004613	20	X	X	X	.0302	.8491	.0057	.5918	.0135	.6604	NA	NA	NA	0	0	0	1	0	2
TIMELESS	NM_003920	12		X		NA	NA	.0046	.6596	NA	NA	NA	NA	NA	1	0	0	0	5	6
TLE3	NM_005078	15		X	X	NA	NA	.0046	.5051	.0366	.5070	NA	NA	NA	0	0	0	0	0	3
TLR4	NM_003266	9	X			.0403	.6244	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
TNNI1	NM_003281	1		X		NA	NA	.0140	.5406	NA	NA	NA	NA	NA	0	0	1	1	3	6
TNS	NM_022648	2	X		X	.0319	.6754	NA	NA	.0231	.6409	NA	NA	NA	0	0	0	0	2	3
TOM1	NM_005488	22			X	NA	NA	NA	NA	.0357	.5146	NA	NA	NA	0	0	0	1	4	3
TOP2B	NM_001068	3	X			.0387	.5029	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	3	0
TP53TG1	NM_007233	7		X		NA	NA	.0041	1.2632	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
TPSD1	NM_012217	16		X		NA	NA	.0050	.5075	NA	NA	NA	NA	NA	0	0	0	0	1	0
TPSG1	NM_012467	16	X		X	.0204	.5671	NA	NA	.0351	.5145	NA	NA	NA	0	0	0	0	3	8
TRAF3	NM_003300	14	X	X	X	.0226	.9777	.0276	.6833	.0061	.9782	NA	NA	NA	NA	NA	NA	NA	NA	NA
TRAP1	NM_016292	16	X			.0063	.7397	NA	NA	NA	NA	.0016	NA	NA	0	0	0	0	1	1
TRAP-1	NM_004257	2	X		X	.0096	.7332	NA	NA	.0149	.7419	NA	NA	NA	0	0	0	0	4	6
TRF4	NM_006999	5		X		NA	NA	.0046	.5055	NA	NA	NA	NA	NA	0	0	0	0	6	9
TRP7	NM_020389	5		X		NA	NA	.0227	.5889	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
TTK	NM_003318	6			X	NA	NA	NA	NA	.0437	.5624	NA	NA	NA	0	0	0	0	3	3
UBE2G1	NM_003342	17		X	X	NA	NA	.0007	.6810	.0064	.7475	NA	NA	NA	NA	NA	NA	NA	NA	NA
UBQLN1	NM_013438	9		X		NA	NA	.0043	.5068	NA	NA	NA	NA	NA	0	0	0	0	1	3
UK114	NM_005836	8			X	NA	NA	NA	NA	.0291	.5440	NA	NA	NA	0	0	0	0	3	1
ULBP2	AY358665	6	X			.0237	.6179	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	3	1
VDAC3	NM_005662	8		X		NA	NA	.0068	.5347	NA	NA	NA	NA	NA	0	0	0	0	4	0
VDR	NM_000376	12			X	NA	NA	NA	NA	.0096	.7698	NA	NA	NA	0	0	0	0	3	0
VLDLR	NM_003383	9	X		X	.0190	.8386	NA	NA	.0051	.9363	.0207	NA	NA	0	0	0	0	0	1
WDR9	NM_033656	21	X		X	.0081	.7508	NA	NA	.0191	.5976	NA	NA	NA	0	0	0	0	7	17
WISP2	NM_003881	20	X	X		.0255	.7554	.0006	.6905	NA	NA	NA	NA	NA	0	0	0	0	2	1
WNT1	NM_005430	12	X			.0372	.5091	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	0	0
WNT10B	NM_003394	12	X			.0376	.5500	NA	NA	NA	NA	NA	NA	NA	0	0	0	0	0	0
WWOX	NM_130790	16	X			.0435	.7051	NA	NA	NA	NA	NA	NA	NA	1	0	0	1	6	7
ZNF216	NM_006007	9		X	X	NA	NA	.0034	.6026	.0306	.5161	NA	NA	NA	0	0	0	0	2	1
ZNF236	NM_007345	18			X	NA	NA	NA	NA	.0056	.7160	NA	NA	NA	0	0	0	0	1	8
ZNF254	NM_203282	19	X			.0193	.5085	NA	NA	NA	NA	NA	NA	NA	0	0	0	1	14	19
ZNF264	NM_003417	19			X	NA	NA	NA	NA	.0246	.6508	NA	NA	NA	0	0	0	0	2	2
ZNF43	NM_003423	19	X			.0377	.5609	NA	NA	NA	NA	.103	.3964	1.5405	0	0	0	1	16	12
ZNF7	NM_003416	8	X		X	.0103	1.1337	NA	NA	.0319	.6670	NA	NA	NA	0	0	0	0	0	0
ZP2	NM_003460	16		X		NA	NA	.0099	.5085	NA	NA	NA	NA	NA	0	0	0	1	5	5

Note.— NA = not available.

Figure 2. .

Transcriptional targets of FOXP2 identified by ChIP-chip assay

FOXP2 Targets in Lung versus Brain

Murine Foxp2 has been shown to repress the promoter of the human lung-epithelial specific gene SP-C in vitro.¹² Since Foxp2 has been reported as a transcriptional repressor that is expressed in the developing lung of mice,¹² we were interested to see, which, if any, of the identified targets were potentially more-specific targets in the developing brain relative to lung, a non-CNS tissue expressing high levels of FOXP2 during development. Furthermore, no studies of targets of FOXP2 have been published from any human tissue, so even overlapping targets would be of general interest and would serve as a core set of non–tissue-specific FOXP2-regulated genes. We performed ChIP-chip in human fetal lung at 18 GW and identified 192 targets (table 1). There was 47% and 37% overlap between genes identified in lung and BG and in lung and IFC, respectively (fig. 3), providing further confidence in these genes as robust FOXP2 targets. Subtraction of the lung-enriched genes from the CNS data sets yielded 84 BG-specific genes and 83 IFC-specific genes (fig. 3 and table 1). In addition, there were eight targets found in both BG and IFC that were not enriched in lung. These highest-confidence brain-enriched targets include FGF8, which is a key effector of cortical patterning in mammals,³⁶ and HOXB5 and HOXB7, members of the homeobox family of transcription factors, many of which are already known to be involved in CNS patterning.^37,38

Figure 3. .

Distribution of FOXP2 targets identified among tissue regions. Shown are overlapping and tissue-specific targets of the 175 BG, 144 IFC, and 192 lung target genes among the three experiments. The P values based on the hypergeometric distribution show highly statistically significant overlap between the tissues.

To provide independent validation of the array results, we checked a cross-section of the putative FOXP2 targets by ChIP-PCR, as is now standard.^34,35,39,40 We used a second commercial antibody to FOXP2 to validate brain tissue and an antibody against the FLAG epitope in a neuronal cell line. For the cell-line confirmation, the neuronal cell line SH-SY5Y was stably transfected with FOXP2 isoform I with three C-terminal FLAG tags (see the “Material and Methods” section). Using either real-time quantitative or semiquantitative PCR, we assessed seven nervous-system targets in vitro and were able to confirm enrichment of FOXP2 occupancy at the promoters of all these genes (fig. 4 and data not shown). In contrast, the promoter of one lung target tested, ANK1, was not pulled down in these neuronal cells and served as a negative control; even though the level of expression of ANK1 changed in SY5Y cells with overexpressed FOXP2, it is likely a result of indirect regulation by FOXP2 and not direct binding. Although tissue was a limiting factor, we were able to test a subset of FOXP2 CNS targets in fetal brain tissue by ChIP-PCR and confirmed three of five promoters examined, providing a secondary level of confirmation for these targets (fig. 4 and data not shown).

Figure 4. .

Confirmation of identified FOXP2 targets by ChIP-PCR from SH-SY5Y cells overexpressing FLAG-tagged FOXP2 (A) or IFC (B). A, Promoters of three FOXP2 targets showing enrichment of FLAG-tagged FOXP2 at their promoters compared with control immunoprecipitations (IPs). No enrichment occurred at a lung-specific promoter, ANK1, or in a gene that was not a FOXP2 target, CDH1. B, Promoters of three FOXP2 targets showing enrichment of endogenous FOXP2 compared with control IPs. Also shown is an example of an IFC target, PIR51, that did not show confirmation by ChIP-PCR. No enrichment is seen when primers are used for the ANK1 promoter or CDH1 gene. No Ab = no addition of anti-FOXP2 antibody.

In Vitro Functional Validation of FOXP2 Targets

To provide some functional evidence of target regulation, we assessed the effect of FOXP2 overexpression in a neuronal cell culture system on identified FOXP2 targets. SH-SY5Y cells were stably transfected with FOXP2 isoform I with three C-terminal FLAG tags, and a population of stably transfected cells was used for the experiments at several different passages (fig. 5). Cells stably transfected with empty plasmid were used as a baseline control for comparison. Immunoblotting of the two cell lines for both FOXP2 and FLAG revealed robust expression of FLAG-tagged FOXP2 in the cell line transfected with FOXP2, compared with no expression in the cells transduced with the empty vector (fig. 5A and data not shown). This cell line provides an appropriate vehicle for overexpression studies, since FOXP1 is natively expressed in these cells, whereas FOXP2 is not detectable.⁴

Figure 5. .

FOXP2 overexpression confirming functional regulation of targets by FOXP2. A, Cell lysate from SH-SY5Y cells transfected with empty vector or FOXP2 isoform I, run on an SDS-PAGE gel and transferred to PVDF membrane. The membrane was hybridized with anti-FLAG antibody and anti-GAPDH antibody. B, Nineteen genes tested by qRT-PCR. The average of seven replicates and SEMs are indicated. Genes with a down-regulation in expression are shown in red, whereas those with a positive change in gene expression are shown in blue. Genes with significant difference in expression between control and FOXP2-overexpressing cells are indicated with an asterisk (*) (P<.05, by Student’s t test).

The majority of target genes investigated were chosen randomly, although a few were selected on the basis of their enrichment in all tissues studied (NOS1, CALCRL, PM5, and GDF5). Real-time quantitative RT-PCR (qRT-PCR) for 19 genes was performed on seven biological replicates of both control cells and cells overexpressing FOXP2. qRT-PCR analysis demonstrated that the majority of FOXP2 target genes identified (11 of 19) had at least a 25% change in expression with FOXP2 isoform I overexpression (fig. 5). Three genes, TAGLN, CALCRL, and CER1, showed up-regulation after overexpression of FOXP2, whereas DPAGT1 showed a trend toward increased expression (fig. 5). To test the reproducibility of the results, two genes, TNN1 and NUDT1, were examined using two different sets of primers in a blinded fashion. Both primer sets gave very similar results for each gene, indicating high specificity for the assay (data not shown). By use of a two-tailed paired t test, five of the genes had statistically significant fold changes between control and FOXP2-overexpressing cells. These genes were CALCRL, NOS1, LBR, KCNJ15, and ANK1. Accordingly, all these genes had changes >1.5 fold and were contained within the top-seven most changed genes. Interestingly, two of these genes, NOS1 and CALCRL, represent two of the genes enriched in all tissues by ChIP-chip and, as mentioned above, were selected a priori for this reason. Thus, we can conclude that the levels of at least 26% of the genes identified as targets of FOXP2 can be altered by manipulating expression of FOXP2 in a neuronal cell line. These data, confirming slightly more than 25% of targets examined in vitro, are consistent with those of other published studies, in which 20%–35% of the targets are typically confirmed in this manner.^39–43

FOXP2 Binding Sites Sequence in Candidate Genes

We next determined whether the promoter regions of candidate genes present on the Aviva array contain putative FOXP2 binding sites. Since double-stranded PCR products were spotted onto the array, the binding site could lie in either strand, so we examined both strands. We inspected the sequences of identified candidate targets for the FOXP2 binding site CAAATT or the core FOXP2 binding site AAAT.⁴⁴ The sequence from 323 of 367 potential targets identified by ChIP-chip was examined for binding sites, and 95% (307 genes) were found to contain at least one AAAT core FOXP2 binding site, whereas 106 contained at least one CAAATT binding site (table 1). Since the FOXP1 binding site (TATTT[A/G]T) has been shown to be a possible FOXP2 binding site,^4,45 we also searched for the presence of a FOXP1 binding site. A total of 82 genes were found to have at least one FOXP1 binding site (table 1). All genes tested by overexpression of FOXP2 were found to have at least one copy of the core-binding site (AAAT), and most had multiple sites. HSPB7, CER1, CALCRL, ANK1, LBR, and KCNJ15, which showed directional changes in expression following overexpression of FOXP2, were also found to have at least one CAAATT binding site. Additionally, NOS1, which showed a large, statistically significant decrease in expression, and CALCRL, which showed a significant increase in expression after FOXP2 overexpression, as well as GDF5, were found to have a FOXP1 binding site present. Comparing this enrichment of FOXP2 sites within the target genes identified on the array with an equivalent number of random promoter sequences from Ref Seq genes showed a statistically significant enrichment for all sequences identified in BG as a group (P<.05, by χ² with Yates correction), which was more significant for the more stringent canonical CAAATT site in BG targets (P=.007, by χ²). The targets identified in IFC and lung showed the same trend as BG but did not reach significance.

Functional Annotation

To investigate whether FOXP2 target genes belong to functional categories that provide insight into the role of FOXP2, we performed GO and pathway analysis on target genes, using the DAVID Bioinformatics Resources.²⁴ Gene targets identified in BG or IFC were grouped together as “CNS-specific” genes and were compared with and contrasted to “lung-specific” genes. We focused on GO categories of level three or higher, containing at least three genes and having a P value ⩽.05 by Fisher’s exact test. CNS-specific genes were significantly enriched in six categories of molecular function, and the lung genes were enriched in three categories that did not overlap with those found in the CNS gene set (fig. 6). The CNS-specific genes were enriched for 11 biological-function GO categories, whereas the lung data set did not have any significant categories grouped according to biological function.

Figure 6. .

GO categories of in vivo targets, revealing tissue specificity of target pathways. FOXP2 target gene lists from either the CNS (BG and IFC) or lung were analyzed for significantly enriched GO categories by use of DAVID Bioinformatics Resources. Categories were considered significantly enriched if at least three genes were in one category with a P value ⩽.05. Significant CNS targets with a known molecular function fall into six categories (A), whereas lung targets can be classified into three categories (B), none of which overlap with the CNS results. Significant CNS targets with a known biological function are grouped into 11 categories (C). There were no significant biological function categories for lung-specific targets.

Several intriguing CNS-enriched GO categories were identified: morphogenesis (TIMELESS, WNT1, SOX13,HOXB5, and FGF8), intracellular signaling cascades (CDC42BPB, GABBR1, CCKAR, RP26KA2, and RRAS), and cation homeostasis (GALR2, RYR3, and CCKAR). Focusing this analysis on those genes contained within significantly enriched GO categories in the CNS allowed us to uncover FOXP2 targets with potential roles in neural development and to strengthen the hypothesis of FOXP2 as a crucial player in signaling cascades regulating this critical epoch. Salient examples of FOXP2 targets previously shown to be important for CNS development models include WNT1^46,47 and RPS6KA2, also known as RSK3, which is highly expressed in the cortical primordium.⁴⁸ Mutations in a related family member of RSK3, RSK2, lead to Coffin-Lowry syndrome (MIM 303600), which is associated with cognitive abnormalities.⁴⁹

Another critical pathway downstream of FOXP2 in the IFC appears to be neurite outgrowth and axonal morphology, including calcium-mediated growth cone dynamics (e.g., GALR2, POU4F2, RRAS, and RYR3).^50–54 Further support for the role of FOXP2 transcriptional targets in dynamic regulation of neuronal structure was obtained using Ingenuity pathway-analysis software to analyze the 34 core CNS targets identified in both BG and IFG. Ingenuity identified several functions of neuronal activity significantly enriched, including branching of dendrites (NOS1 and CRH), mobilization of calcium (CALCRL, CD5, and PRLH), quantity of calcium (EPOR and CRH), and learning (CRH and EPOR) (data not shown). These data also suggest a possible function for FOXP2 signaling cascades in activity-based (e.g., long-term potentiation) modeling of neural connections, in addition to its role in development.

Possible Positive Selection of Several FOXP2 Targets in Humans

FOXP2 is clearly involved in multiple functions not related to human higher cognitive functions, including sensorimotor integration and vocal learning in birds^8,55 and lung development outside the CNS.¹² It would therefore be useful to identify a list of targets that most likely contribute to the development of higher cognitive specializations.¹¹ We hypothesized that, given the genetic complexity of a highly advantageous trait such as human language, positive selection may be working on FOXP2 target proteins in addition to FOXP2 itself.^17,18 We reasoned that identification of FOXP2 target genes potentially under positive selection will enrich for those target genes more likely to be involved in language development. We analyzed our data with respect to published estimates of protein sequence divergence (Ka/Ki and Ka/Ks) for 1,168 genes with available data.²⁹

Ka measures the rate of nonsynonymous nucleotide substitutions, Ki measures the rate of nucleotide substitutions in interspersed repeats within a 250-kb window centered around each gene, and Ks measures the rate of synonymous substitutions. Low Ka/Ki or Ka/Ks values suggest strong purifying selection (deleterious mutations), whereas elevated Ka/Ki values suggest accelerated evolution via positive selection, or relaxation of constraint.²⁹ Typically, a value >1.0 is indicative of acceleration.⁵⁶ Fourteen genes identified as FOXP2 targets in either BG, IFC, or lung had Ka/Ks or Ka/Ki >1.0 (table 2). As a whole, these genes are potential key FOXP2 targets that, by virtue of their sequence divergence, show evidence of accelerated evolution. Remarkably, this list includes genes such as NDUFA2, which is part of the electron transport chain, a pathway identified to be under potential adaptive evolution in humans by comparative gene-expression studies in brain.^57,58 It also includes a number of other genes implicated in vertebrate forebrain patterning, including HESX1 and CER1. Remarkably, four of the FOXP2 targets, HESX5, MEOX1, PIR51, and RBP2, have Ka/Ks values >50.²⁹ Genes with evidence of accelerated evolution, which is likely to be indicative of positive selection in humans, comprise a key cohort potentially related to human cognitive specializations integrated by the BG and IFC, including speech and language.

Table 2. .

Fourteen Genes with Ka/Ki or Ka/Ks >1.0^[Note]

		Positive Selection
Gene	GenBank Accession Number	Ka/Ki	Ka/Ks
CA4	NM_000717	.6937	1.5476
CD7	NM_006137	.7805	1.5375
CER1	NM_005454	.5913	1.7308
FCGR2A	DQ894525	.7127	2.8529
GPR21	NM_005294	NA	1.3871
HESX1	NM_003865	.5971	75
LBR	NM_002296	NA	1.0833
MEOX1	NM_004527	NA	52
NDUFA2	NM_002488	1.6458	1.2958
PGLYRP	NM_005091	1.8051	.5485
PIR51	NM_006479	NA	56
PRG4	NM_004758	2.4455	.5826
RBP2	NM_004164	.9006	106
ZNF43	NM_003423	NA	1.5405

Note.— Estimated rates of protein-sequence divergence between humans and chimpanzees were obtained from the study by Khaitovich et al.²⁹ NA = not available.

Differential Expression of Several FOXP2 Targets between Chimpanzee and Human Brain

Although measures of protein-sequence divergence measure one key metric of function relevant to evolution, they do not consider additional changes in promoter or other regions that might alter gene expression, another dimension relevant to brain evolution.^58,59 This is especially important because FOXP2 is a transcriptional regulator, and one might expect its targets to exhibit differential expression between evolutionarily divergent species. Therefore, we performed a meta-analysis of primate-human gene-expression data, to identify genes differentially expressed in the brains of humans and nonhuman primates, using three published data sets^26–28 to insure identification of the most robust changes in expression (see the “Material and Methods” section). This was essential since each study was comprised of only a few individuals. We identified 47 FOXP2 target genes that were differentially expressed between human and chimpanzee brains, including one of the genes whose coding region was also under positive selection, FCGR2 (table 3).

Table 3. .

Summary of Evolutionary Data^[Note]

			Positive Selection
Gene	GenBank Accession Number	Differential Expression P Value	Ka/Ki	Ka/Ks
ADAM28	NM_021777	.0395	.7658	NA
AKR7A2	NM_003689	NA	.5579	NA
AOAH	NM_001637	.021	NA	.7755
APOD	NM_001647	.0001	NA	NA
ASGR1	NM_001671	.0235	NA	NA
C1QA	NM_015991	NA	NA	.791
CA4	NM_000717	NA	.6937	1.5476
CD7	NM_006137	NA	.7805	1.5375
CER1	NM_005454	NA	.5913	1.7308
CRYBB3	NM_004076	NA	.6762	.6374
CXADR	NM_001338	.0001	NA	NA
CYB5-M	NM_030579	.0048	NA	NA
CYP2J2	NM_000775	.0001	NA	.7101
DAXX	NM_001350	.0308	NA	NA
DCT	NM_001922	.0331	NA	NA
DISC1	NM_018662	NA	.8117	NA
DPAGT1	NM_001382	NA	NA	.5
EFNB3	NM_001406	.0365	NA	.8846
EMR2	NM_001784	NA	.5098	.6667
EPHX2	NM_001979	.0472	NA	NA
EPOR	NM_000121	NA	NA	.5185
ERCC4	NM_005236	.0439	NA	NA
FCGR2A	DQ894525	.0008	.7127	2.8529
FSHR	NM_000145	NA	.5082	.7816
FY	NM_002036	.0361	NA	NA
G10	NM_003910	.0119	NA	NA
GFRA1	NM_005264	.0287	NA	NA
GIF	NM_005142	NA	NA	.7541
GLUD1	NM_005271	.0011	NA	NA
GPLD1	NM_001503	.009	.5473	NA
GPR21	NM_005294	NA	NA	1.3871
GRIK1	NM_000830	.0439	NA	NA
HESX1	NM_003865	NA	.5971	75
HEXB	NM_000521	NA	.6457	.9425
HOXB5	NM_002147	.0025	NA	NA
HOXB7	NM_004502	NA	NA	.7049
IK	NM_006083	0	NA	NA
INHA	NM_002191	.0123	NA	.6471
ITGB3	NM_000212	.0164	NA	NA
LBR	NM_002296	NA	NA	1.0833
MAP2K3	NM_002756	.0345	NA	NA
MCF2	NM_005369	.0413	NA	NA
MEOX1	NM_004527	NA	NA	52
MGST2	NM_002413	NA	NA	.623
MRAS	NM_012219	.0137	NA	NA
MSLN	NM_013404	NA	.5922	.5
NAP1	NM_004851	NA	.7813	.7522
NCF2	NM_000433	NA	NA	.8846
NDUFA2	NM_002488	NA	1.6458	1.2958
PARG	NM_003631	.0064	NA	NA
PAX3	NM_000438	.0235	NA	NA
PDXK	NM_003681	.0132	NA	NA
PGLYRP	NM_005091	NA	1.8051	.5485
PIR51	NM_006479	NA	NA	56
PON2	NM_000305	.0112	NA	NA
PPP2R1B	NM_181699	.0366	NA	NA
PRDX5	NM_012094	NA	NA	.902
PRG4	NM_004758	NA	2.4455	.5826
PRND	NM_012409	NA	.7955	NA
PVR	NM_006505	NA	.886	NA
RBP2	NM_004164	NA	.9006	106
RPL10	NM_006013	.026	NA	NA
RPL8	NM_000973	.0136	NA	NA
RRAS	NM_006270	.0468	NA	NA
S100A10	NM_002966	.0219	NA	NA
SCRG1	NM_007281	.0001	NA	NA
SEMA3B	NM_004636	.001	NA	NA
SLC13A2	NM_003984	NA	NA	NA
SLC26A6	NM_022911	NA	NA	.6154
SLC28A1	NM_004213	.0178	NA	NA
SLC4A4	NM_003759	.0023	NA	NA
SNRPG	NM_003096	.0008	NA	NA
SNW1	NM_012245	.0095	NA	NA
STK11	NM_000455	.002	NA	NA
SYK	NM_003177	.0001	NA	NA
TAF1C	NM_005679	0	NA	.6475
TGFB2	NM_003238	.003	NA	NA
TRAP1	NM_016292	.0016	NA	NA
VLDLR	NM_003383	.0207	NA	NA
ZNF43	NM_003423	NA	NA	1.5405

Note.— NA = not available.

Among FOXP2 in vivo targets showing primate-human differential expression were a number of genes encoding transcription factors involved in neural development, including PAX3 and HOXB5, and a number of other genes encoding known CNS patterning and guidance molecules, such as EPHX2, ITGB3, and SEMA3B.⁶⁰ Several genes related to neural transmission, including neurotransmitter receptor genes GFRA1 and GRIK1, were also identified among this cohort. When combined with the analysis of sequence evolution, these data suggest a potential role of specific genes in human cognition by identifying genes with differential expression at the mRNA level or that are potentially under positive selection in humans.

Discussion

Here, we identify FOXP2 targets in vivo for the first time, providing an initial transcriptional network downstream of this gene known to be involved in human higher cognition and vocal-motor learning. We used previously published, well-validated ChIP-chip methods^21,22 and, in addition, performed extensive functional validation. Although the majority of genes were repressed by FOXP2, we were able to identify a subset of genes that appear to be activated by FOXP2 at the transcriptional level, indicating that FOXP2 can act as a transcriptional activator in some contexts. Further, we show that some of the genes show evidence of accelerated evolution and thus may be under positive selection in humans, or they are differentially expressed between chimpanzee and human brain, providing support for their potential role in higher cognition and language. Some FOXP2 targets, such as FGF8 and PAX3, have known roles in cerebral cortical patterning, immediately connecting FOXP2 transcriptional regulation to brain patterning during development.^36,61

FOXP2 Targets and Transcriptional Activity

FOXP2 promoter binding demonstrated by ChIP-chip across multiple samples and multiple independent replicate experiments provides strong support for the targets identified. By comparing targets identified in different CNS tissues, we were able to identify a large set of core nervous-system targets with genes specific to the different regions. Further, we confirm a cross-section of targets, using ChIP-PCR in vitro and in vivo with use of a second antibody, an additional level of confirmation.

We also note that a subset of FOXP2 targets were identified in two brain regions and not in lung. Although we hypothesize that some of these may be CNS-specific FOXP2 targets, it remains possible that some could be targets in other nonneural tissues, a question that can be explored in subsequent studies. Additionally, this distinction of CNS specificity does not necessarily make these genes higher priorities for further study than genes identified in lung. Many FOXP2 targets were also identified in the lung, including several genes known to play important roles in nervous-system development or maturation, such as MEF2D, GDF5, POU4F3, SEMA3B, A2BP1, and PAX3, which is correlative to the key function of FOXP2 in both lung and brain development.

It is also supportive that we identified consensus sites described elsewhere on the basis of the binding structure of FOXP2⁴⁴ in a majority of the FOXP2 target genes. Statistical analysis supports the enrichment of putative FOXP2 binding sites within the target genes identified in BG. However, there was only a trend toward significance in frontal cortex and lung, and not all candidate genes identified have a consensus binding sequence, suggesting that other as-yet unidentified FOXP2 regulatory regions exist in these genes or that FOXP2 may act in a complex that permits binding to different sites. These results indicate the need for further investigation into the sequence-specific DNA binding parameters of FOXP2.

Here, we took an additional validation step by showing that >25% of genes whose promoters were bound by FOXP2 protein were indeed regulated by manipulation of FOXP2 levels in a neuronal cell line. Since the basic ChIP experiment was done in tissue, and it was necessary to perform functional confirmation in vitro, the cell line is distinct from the original in vivo tissue; yet, we were still able to confirm transactivation in a percentage of targets very similar to that in other published studies.^39,40,42,43 We were able to show that, in general, overexpression of FOXP2 resulted in the expected decrease in expression of target genes. However, overexpression of FOXP2 increased expression of TAGLN, CALCRL, and CER1, suggesting transcriptional activation. This, along with the study by Vernes et al.,^{19(in this issue)} provides the first evidence that FOXP2 can potentially act as a transcriptional activator in certain situations. ChIP-chip identifies promoter regions that are bound to FOXP2 but does not indicate more-complex transcriptional regulation that may have tissue- and cell-specific requirements for regulating transcription. Thus, the behavior of the subset of genes not altered after forced FOXP2 overexpression may be attributed to the lack of additional binding partners necessary for FOXP2 transcriptional regulation of certain genes. However, we do expect a percentage of false-positive results contained within our subset of genes.

Using a similar experimental paradigm, Vernes et al.^{19(in this issue)} identified FOXP2 targets in vitro in SH-SY5Y cells by using a commercial antibody that recognizes a different region of the FOXP2 protein and found 303 FOXP2 targets. Of our core set of 34 targets that we found in vivo in both IFC and BG, 47% (16) overlap the targets identified in SH-SY5Y cells by Vernes et al., and there is a 22% overlap between all 285 genes we identified in either IF or BG and the 303 genes that Vernes et al. identified in SY5Y (62 of 285). This highly significant overlap provides another level of independent confirmation of our results, and our data speak to the relevance of at least a subset of the in vitro findings for normal human brain development in vivo. Vernes et al. also found up-regulation of certain targets’ expression after FOXP2 overexpression, consistent with the notion that some targets may not be repressed. Although we each confirmed that FOXP2 binding regulates the targets identified, and both studies note down-regulation of HSP7 and PM5 with FOXP2 expression in SH-SY5Y cells, in some cases, such as for CALCRL, we observed different directions of regulation in vitro after FOXP2 overexpression than did Vernes et al. Testing the possibility that this difference could be the result of identification of different isoforms, each group tested both CALCRL primer pairs on our respective cDNA. The results were consistent across primer pairs in each cell line and therefore are not due to testing distinct isoforms (data not shown). Many factors could explain these differences between the studies. For example, variations in the levels of FOXP2 expression in each of the cell lines used could explain these discrepancies. SH-SY5Y cells also contain abundant amounts of FOXP1 protein, and it is possible that FOXP2 and FOXP1 share a subset of common transcriptional targets. FOXP2 has been shown to heterodimerize with FOXP1,¹³ and heterodimers of FOXP2 with FOXP1 may result in different transcriptional outcomes than homodimers of FOXP2 or FOXP1. Thus, one could imagine a scenario in which low levels of FOXP2 repress transcription through heterodimerization with FOXP1, but, with increasing amounts of FOXP2, there is competition of FOXP2 homodimers with endogenous FOXP1, leading to transcriptional activation. Thus, as has been the case with other transcription factors, it will be important to define a subset of genes coregulated by FOXP2 and FOXP1, as well as the repertoire of FOXP2 partners and their regulation, to understand the context in which FOXP2 acts as a transcriptional repressor or activator.

Function of Targets

The target genes identified provide a foundation for exploring the transcriptional network downstream of FOXP2 in the developing brain. Functions such as growth regulation, embryonic development, and signal transduction identified as enriched GO categories for the candidate targets of FOXP2 are also common functions for targets of other forkhead-containing genes.^62–64 GO analysis of the potential targets specific to IFC indicated that many of these genes are involved in growth and morphogenesis, whereas other classes, such as development, were enriched for in targets identified in BG, indicating different downstream functional differences in the different regions of the brain. Furthermore, FOXP2 continues to be expressed in the adult and is modulated by vocal learning in adult song birds.⁵⁵ Thus, the identification of FOXP2 target genes involved in neurite outgrowth, calcium signaling, and learning, by Ingenuity pathway analysis, may provide a potential molecular link to ongoing behavioral plasticity throughout development and into adulthood.

Previous work has suggested that FOXP2 may be under positive selection in humans, so we reasoned that some FOXP2 targets may be components of neurodevelopmental pathways also under positive selection.^17,18 Large-scale gene coexpression network analysis of human and chimpanzee brain confirmed the previously reported action of positive selection on the pathway of the electron transport chain.^57,65–67 Further, this work showed that entire functional modules of coexpressed genes appear to be under positive selection in humans.⁶⁵ Other genomewide analyses investigating alleles with accelerated increase of frequency between three different human populations have demonstrated that multiple genes in the phosphatidylinositol pathway, in addition to the electron transport chain pathway, have undergone positive selection.⁶⁸ These precedents support the notion that positive selection of genes regulated by FOXP2 may direct us to molecular pathways of particular interest in human evolution and human cognitive specialization, since language is a complex trait that likely can be modulated by many genes.¹¹ Some of the FOXP2 target genes that we identified are genes known to be involved in human brain development and patterning, such as EFNB3, HESX1, and CER1. This provides further support for the notion that targets of FOXP2 showing these significant differences between humans and our closest relative, the chimpanzee, are particularly important in development of human cognitive specializations.

Similarly, 15 of the potential FOXP2 targets identified here (APOD,⁶⁹ CCK,^70,71 CCK-AR,^72–75 CCND2,⁷⁶ CD5,^77,78 DISC1,^79–81 DRD2,⁸² GABBR1,⁸³ MT2A,⁸⁴ NOS1,^85–87 PMX2B,⁸⁸ TDO2,⁸⁹ TIMELESS,⁹⁰ WNT1,⁹¹ and ZNF74⁹²) have shown some evidence of association with schizophrenia (SCZD [MIM 181500]), a disease that has been suggested to involve primary language dysfunction. Although most of these associations are preliminary or marginal, DISC1 has been clearly replicated. The association of SNP rs2396753, located within an intron of FOXP2, with schizophrenia with auditory hallucinations,⁹³ further suggests that targets of FOXP2 may also be candidates for involvement in schizophrenia. The concept that complex genetic disorders might involve multiple genes within common pathways implies that the FOXP2 targets identified here are realistic candidates for a variety of neurodevelopmental disorders involving higher cognitive functions.

In summary, these data are the first identification of human FOXP2 targets in the developing brain. This is also the first time, to our knowledge, that ChIP-chip has been used to assess transcription factor targets in the human fetal brain. Many of the identified FOXP2 targets have been previously characterized as having critical roles in several important neuronal features, such as neurite outgrowth and axon pathfinding. In addition, we have uncovered targets of FOXP2 that may have vital functions in the evolution of the mammalian brain. Since FOXP2 has a direct link to speech in humans, together these findings provide insight into signaling pathways that may be important both in the development and evolution of language.