Skip to main content
Molecular Neurodegeneration logoLink to Molecular Neurodegeneration
. 2008 Feb 8;3:3. doi: 10.1186/1750-1326-3-3

Dispensable role of Drosophila ortholog of LRRK2 kinase activity in survival of dopaminergic neurons

Danling Wang 1,2, Beisha Tang 2,3, Guohua Zhao 2,3, Qian Pan 2, Kun Xia 2, Rolf Bodmer 1, Zhuohua Zhang 1,2,✉
PMCID: PMC2276501  PMID: 18257932

Abstract

Background

Parkinson's disease (PD) is the most prevalent incurable neurodegenerative movement disorder. Mutations in LRRK2 are associated with both autosomal dominant familial and sporadic forms of PD. LRRK2 encodes a large putative serine/threonine kinase with GTPase activity. Increased LRRK2 kinase activity plays a critical role in pathogenic LRRK2 mutant-induced neurodegeneration in vitro. Little is known about the physiological function of LRRK2.

Results

We have recently identified a Drosophila line with a P-element insertion in an ortholog gene of human LRRK2 (dLRRK). The insertion results in a truncated Drosophila LRRK variant with N-terminal 1290 amino acids but lacking C-terminal kinase domain. The homozygous mutant fly develops normally with normal life span as well as unchanged number and pattern of dopaminergic neurons. However, dLRRK mutant flies were selectively sensitive to hydrogen peroxide induced stress but not to paraquat, rotenone and β-mercaptoethanol induced stresses.

Conclusion

Our results indicate that inactivation of dLRRK kinase activity is not essential for fly development and suggest that inhibition of LRRK activity may serve as a potential treatment of PD. However, dLRRK kinase activity likely plays a role in protecting against oxidative stress.

Background

Parkinson's disease (PD) is a common and currently incurable neurodegenerative movement disorder affecting approximately 1–2% of the population over 65 years of age. Clinically, it is characterized by age-dependent resting tremor, muscular rigidity, and akinesia. Neuropathologically, selective loss of dopaminergic (DA) neurons in the substantia nigra compacta region and Lewy body formation in the remaining neurons are two hallmarks of PD patient brains [1].

The molecular mechanism of PD-specific neuropathological changes and parkinsonism motor deficits are largely unknown. Nevertheless, significant progress on molecular genetics of PD has been made during the last several years by studying familial PD cases. Mutations in at least 7 genes have been implicated in various forms of familial PD cases. These genes include α-synuclein, uchL1, LRRK2, parkin, PINK1, DJ-1, and ATP13A2 [2-10].

LRRK2 was recently identified as a novel gene responsible for an autosomal dominant form of PD, suggesting a toxic gain of function of LRRK2 in affected cases [3,5]. So far, at least 20 LRRK2 mutations have been identified from PD patients, accounting for ~7% familial form of PD cases and for a significant portion of sporadic PD cases [11,12]. Unlike other PD-associated genes, which normally are correlated with early-onset or pathologically atypical forms of PD, LRRK2 is associated with late-onset and clinically idiopathic PD [3,5,12]. Thus, dysfunction of LRRK2 may impair a common pathway involving in pathogenesis of both familial and sporadic PD cases.

LRRK2 is a large protein (2527 amino acids) consisting of several independent domains, including a leucine-rich repeat domain, a Roc GTPase domain followed by its associated C terminal of Roc (Rac) domain, a protein kinase domain of the MAPKKK family, and a C-terminal WD40 domain [13,14], suggesting a complexity of its cellular function and regulation. Recent studies suggest that LRRK2 can self-phosphorylate in vitro. Moreover, the kinase activity of LRRK2 seems to be tightly regulated by its GTPase activity [15]. PD related mutations results in increased kinase activity of LRRK2 [16,17]. Thus, inactivation of LRRK2 kinase activity constitutes a potential strategy for PD treatment. A critical point for this treatment strategy is whether inhibition of LRRK2 physiological activity will affect the normal development process or induce severe pathological side effects.

In the present study, we investigated roles of LRRK2 in development and neuronal survival using Drosophila as a model system. Our results suggest that LRRK2 kinase activity is not required for development, survival of DA neurons, and protection of PD-related stress of Drosophila.

Results

Identification of Drosophila Line with LRRK2 Deletion

Sequence analysis revealed a single Drosophila ortholog (CG5483) of human LRRK1 (hLRRK1) and LRRK2 (hLRRK2) [designated as Drosophila LRRK (dLRRK)]. dLRRK shares 24% identity and 38% similarity at the amino acid (aa) level to hLRRK2. The kinase domain is 31% identical and 52% similar between dLRRK and hLRRK2. The predicted critical amino acids for function of LRRK2, including proton acceptor (D1994), ATP binding site (K1906), and 9 of total 18 identified pathogenic mutant amino acids, are highly conserved [see Additional file 1] [12]. These results suggest that CG5483 is a Drosophila ortholog of both hLRRK1 and hLRRK2.

We identified a fly line (e03680) with piggyBac element insertion in the intron between exon 5 and exon 6 of dLRRK gene [18] (Fig. 1). RT-PCR detects a mutant dLRRK transcript with deletion of exon 6 (Fig 1a, b, c). Primer extension analysis revealed the mutant dLRRK transcript encoding N-terminal 1289aa, RYCNECA encoded by the intron between exon 5 and exon 6, followed by an in-frame stop codon. The transcript returns to exon 7 and the whole C-terminal sequence after exon 7. Therefore, the mutant fly harbors a truncated protein consisting of the N-terminal ankyrin repeat (ANK), leucine-rich repeat (LRR) and Rac domains. Thus, the resulted mutant fly carries a kinase-null dLRRK (Fig. 1d).

Figure 1.

Figure 1

Identification of Drosophila Line with LRRK2 Deletion. Schematic representation of the piggyBac element insertion site of Drosophila line e03680. (a). The dLRRK gene has 11 exons (arrow boxes) and 10 introns (black line between exons). The piggyBac insertion site is indicted by a filled block arrow. 4 pairs of primers used for RT-PCR analysis of dLRRK transcripts are also indicated. These include 1351 and 1561; 3374 and 3604; 3776 and 3996; 5091 and 4237. Positions and directions of different primers are marked with vertical black lines and horizontal arrows. (b) dLRRK transcripts in various fly lines are detected with RT-PCR. C, negative control; WT, +/+ fly; HE, e03680/+ fly; HO, e03680/e03680 fly. (c). The flanking sequence of piggyBac insertion was shown. (d). Schematic representation of wt dLRRK protein and mutant dLRRK protein in fly line e03680. ANK, N-terminal ankyrin repeat domain; LRR, leucine-rich repeat domain; Rac, C terminal of Roc GTPase domain; S_TKc, Serine/Threonine protein kinases domain.

Drosophila lacking dLRRK kinase activity are viable with normal development

Recent studies suggest that increased kinase activity plays critical roles in neuronal death induced by pathogenic LRRK2 mutants [17]. We therefore determined the roles of the dLRRK kinase activity in fly development and DA neuron survival. Homozygous dLRRK mutant files were generated. These mutant flies were viable, fertile and developed with no obvious preadult or afteradult external abnormality (not shown). They showed similar life span to their wildtype counterparts (Fig 2a). Whole-mount brain immunostaining with an anti-Drosophila tyrosine hydroxylase antibody revealed no detectable change of number and distribution of DA neurons in flies at age 20 days in comparison with wildtype control flies (Fig 3). The results suggest that inactivation of dLRRK kinase has little affect on development, life span, and survival of DA neurons in fly.

Figure 2.

Figure 2

dLRRK mutant flies are selectively sensitive to hydrogen peroxide. Wild type flies and dLRRK mutant flies have similar life span (a). Wild type flies and dLRRK mutant flies were treated with 250 μM rotenone (b), 5 mM paraquat (c), 2 mM β-ME (d) and 1% H2O2 (e). Note: dLRRK mutant flies have similar sensitivity to normal flies towards treatments of PD-associated stress inducer rotenone and paraquat, as well as misfolded protein stressor β-ME. dLRRK mutant flies show increased sensitivity to general oxidative stress inducer H2O2.

Figure 3.

Figure 3

Drosophila lacking dLRRK kinase activity has normal development of DA neuron. Brain dissected from wild-type flies (a), e03680/+ flies (b) and e03680/e03680 flies (c) aged 20 days were immunostained with anti-Drosophila TH antibody followed by an Alexa Fluor 594-labeled secondary antibody to indentify DA neurons. Representative pictures shown were collected by confocal microscopy. Dopaminergic neurons in six brain regions, including PAL, PPM1/2, PPM3, PPL1, PPL2, and VUM, were quantified and no significant difference was found among different fly lines (d). Localization of Drosophila DA neurons is illustrated in e.

dLRRK mutant flies are selectively sensitive to hydrogen peroxide

Oxidative stress is implicated in PD pathogenesis [19,20]. We next determined the effects of oxidative stress on dLRRK mutant flies. dLRRK mutant flies showed little difference in survival from their wiltype counterparts after exposure to oxidants rotenone (250 μM), paraquat (5 mM), and unfolded protein inducer β-mercaptoethanol (β-ME, 2 mM) (Fig. 2b, c, d) [21]. Paraquat and rotenone, mitochondrial complex I inhibitors, induce PD-like selective degeneration of DA neurons [22,23]. In contrast, hydrogen peroxide (H2O2) treatment (1%) resulted in increased death of dLRRK mutant flies comparing to their wildtype counterpart (Fig. 2e). Unlike paraquat and rotenone, H2O2 induces a more general oxidative stress that is not selective for the DA neuron. The results suggest that loss of LRRK function unlikely trigger the selective sensitivity to DA neuron preferential or mitochondria initiated oxidative stress in fly. However, dLRRK mutant flies are more sensitive to general and overall oxidative stress than wildtype flies.

Discussion

LRRK2 mutations are linked to a significant number of both familial and sporadic PD cases, little is known about the biological functions and PD-related pathogenic mechanism of this protein. We have shown in this study that inactivation of dLRRK kinase activity has no effect on the development and DA neuronal survival of Drosophila. Recent studies using transfected cells suggest that PD-associated LRRK2 mutants have increased kianse activity. Moreover, the increased kinase activity is correlated with increased susceptibility to cell death [24]. This observation is consistent with finding of association of human LRRK2 mutations with autosomal dominant form of PD. The PD-associated LRRK2 mutant proteins likely contribute to PD pathogenesis via gain of deleterious functions. If LRRK2 functions are conserved between Drosophila and human, our observation suggests a potential strategy for PD treatment via developing LRRK2 kinase inhibitors

Another interesting finding of this study is that loss of LRRK2 kinase activity does not change sensitivity of Drosophila to PD related stress reagents. Rotenone and paraquat are shown to induce parkinsonism in multiple animal models and in human. Despite the precise mechanism remains unknown, the two chemicals inhibit mitochondrial complex I activity [25,26]. On the other hand, inactivation of dLRRK kinase activity results in increased susceptibility of Drosophila to a general oxidant H2O2. Together, these results suggest that dLRRK likely plays a role in protecting against non-mitochondrial oxidative stress. Nevertheless, the implication of this finding in PD pathogenesis needs to be further verified in mammalian models, given that there are two LRRK homologs in mammals.

A recent study suggests that inactivation of dLRRK results in severely impaired locomotive activity and degeneration of dopaminergic neurons [27] that are not found in this study. The discrepancy between the two studies remains to be resolved by further investigation.

Conclusion

In summary, we have found that dLRRK kinase activity is not required for normal development and growth. The results will facilitate our understanding of pathophysiological function of human LRRK2.

Methods

Drosophila stocks and reagents

e03680 flies were obtained from the Exelixis collection at Harvard Medical School. Drosophila were maintained on standard cornmeal-molasses-agar medium at 25°C.

Anti-Drosophila TH antibody (1:500) was generously provided by Dr. Neckameyer (Department of Pharmacological and Physiological Science, Saint Louis University School of Medicine, St. Louis, Missouri 63104), Alexa Fluor 594 goat anti-rabbit IgG was from Invitrogen (San Diego, CA). Hydrogen peroxide, paraquat, rotenone and β-ME were purchased from Sigma.

Checking and Identification of piggyBac Insertion sites

Genomic DNA was purified from wild type, e03680/+ or e03680/e03680 flies. According to the piggyBac element insertion site information from Exelixis collection at Harvard Medical School. Several pairs of primers were designed around insertion site and PCR was performed to check the band size, including 1351–1561, 3374–3604, 3776–3996, and 5091–5237. For sequencing flanking sequence, we used primers 3776-100R and 473L-3996 to amplify 5' and 3' flanking DNA, then sent DNA fragment for sequencing. The sequences of primers are 1351: GTAAGGGTTCCCTGGATGGT; 1561: GGCCTATTGGTGCAGGTAGA; 3374: TAAGTTGCCGGACCCTACAC; 3604: 111TCATCTGTTCGGTGACCAAG; 3776: AGATCAACCCCTTTGCTCCT; 3995: AGCTTAACCGTGCTTCCTGA; 5091: AGGTGCTTTTGGGTTCGTTT; 5273: ATCCCGACCAAGGGTACAAT; 100R: TCCTAAATGCACAGCGACGG; 473L: ACCTCGATATACAGACCG.

Primers used for 5' RACE experiment including: RACE-1: GACTCGAGTCGACGAATTCAATTTTTTTTTTTTTTTTT; RACE-2: GACTCGAGTCGACGAATTCAA; 4042R: CGGACGGGAAATAAGTCATC; 3954R: CGAAGGCAGTAAGGAGGGTA

Whole mount immunostaining

Whole mount immunostaining of fly brains was done as previous described [28]. Briefly, fly heads were fixed with 4% paraformaldehyde containing 0.2% Triton X-100 overnight and washed with PBT (PBS containing 0.2% Triton X-100) 3 times. Brains were dissected in blocking buffer (PBS, 5% heat inactivated normal goat serum, 0.2% Triton X-100), followed by blocking at room temperature for 1 hour. Brains were immunostained with corresponding primary antibodies at 4°C overnight followed by respective secondary antibodies at room temperature for 3 hr. DA neurons were quantified using confocal images and analyzed statistically using InStat 3 (GraphPad, San Diego).

Lifespan

Approximately 500 flies per genotype were analyzed in the lifespan study. The flies were transferred to new vials every second day and the number of dead flies in each vial was recorded. The experiment was continued until all flies were dead. The percentage of flies alive at each time point was quantified and graphed.

Compounds treatment

3–5 days old flies were used for all treatments. At least 100 flies were used for each treatment. Flies were first starved for 3 hours and then transferred to vials with filter papers soaked with toxic compound containing 5% sucrose. Flies were transferred to new vials with fresh compound every day, and the number of dead flies in each vial was recorded. The experiment was continued until all flies were dead. The percentage of flies alive at each time point was quantified and graphed. Chemical compounds were administered at the following doses: 250 μM rotenone, 5 mM paraquat and 2 mM β-ME.

Abbreviations

Parkinson's disease (PD), dopaminergic (DA), human LRRK2 (hLRRK2), Drosophila LRRK (dLRRK), leucine-rich repeat (LRR), N-terminal ankyrin repeat (ANK), β-mercaptoethanol (β-ME), hydrogen peroxide (H2O2)

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

DW carried out the molecular genetic studies to characterize dLRRK deletion line used in this study, did whole mount immunostaining and drafted the manuscript. GZ did the life span and stress treatments. BT, QP, KX, RB participated in experimental designs. ZZ designed the whole project and draft the manuscript.

All authors above have read and approved the final manuscript.

Supplementary Material

Additional file 1

Amino acid sequence alignment of hLRRK2 and dLRRK. The data provided the amino acid sequence alignment of hLRRK2 and dLRRK. hLRRK2 amino acid sequences (NP_940980) and dLRRK amino acid sequences (CG5483, NP_650903) are from NCBI protein database. Alignment was done with MacVector™ 7.2.2. "*" Indicates identical amino acids between the two sequences. "." Indicates conserved amino acids between the two sequences. Highlighted purple indicates Roc GTPase domain. Highlighted red indicates kinase domain. Highlighted blue indicates the conserved PD associated point mutation sites between human and Drosophila.

Click here for file (56KB, doc)

Acknowledgments

Acknowledgements

We thank Dr. Kiren Ubhi for proofreading and editing. This work is supported by grants from the National Institute of Health (Z.Z., R.B.), Michael J Fox Foundation for Parkinson's Research (Z.Z.), American Parkinson's Disease Association (Z.Z.), and the Chinese National 973 and 863 Projects (Z.Z., T.B.).

Contributor Information

Danling Wang, Email: dwang@burnham.org.

Beisha Tang, Email: bstang7398@yahoo.com.cn.

Guohua Zhao, Email: zhaoguohua@cnlmg.com.

Qian Pan, Email: panqian@cnlmg.com.

Kun Xia, Email: xiakun@cnlmg.com.

Rolf Bodmer, Email: rolf@burnham.org.

Zhuohua Zhang, Email: benzz@cnlmg.com.

References

  1. Lang AE, Lozano AM. Parkinson's disease. Second of two parts. N Engl J Med. 1998;339:1130–1143. doi: 10.1056/NEJM199810153391607. [DOI] [PubMed] [Google Scholar]
  2. Dawson TM, Dawson VL. Molecular pathways of neurodegeneration in Parkinson's disease. Science. 2003;302:819–822. doi: 10.1126/science.1087753. [DOI] [PubMed] [Google Scholar]
  3. Paisan-Ruiz C, Jain S, Evans EW, Gilks WP, Simon J, van der Brug M, Lopez de Munain A, Aparicio S, Gil AM, Khan N, et al. Cloning of the gene containing mutations that cause PARK8-linked Parkinson's disease. Neuron. 2004;44:595–600. doi: 10.1016/j.neuron.2004.10.023. [DOI] [PubMed] [Google Scholar]
  4. Valente EM, Abou-Sleiman PM, Caputo V, Muqit MM, Harvey K, Gispert S, Ali Z, Del Turco D, Bentivoglio AR, Healy DG, et al. Hereditary early-onset Parkinson's disease caused by mutations in PINK1. Science. 2004;304:1158–1160. doi: 10.1126/science.1096284. [DOI] [PubMed] [Google Scholar]
  5. Zimprich A, Biskup S, Leitner P, Lichtner P, Farrer M, Lincoln S, Kachergus J, Hulihan M, Uitti RJ, Calne DB, et al. Mutations in LRRK2 cause autosomal-dominant parkinsonism with pleomorphic pathology. Neuron. 2004;44:601–607. doi: 10.1016/j.neuron.2004.11.005. [DOI] [PubMed] [Google Scholar]
  6. Bonifati V, Rizzu P, van Baren MJ, Schaap O, Breedveld GJ, Krieger E, Dekker MC, Squitieri F, Ibanez P, Joosse M, et al. Mutations in the DJ-1 gene associated with autosomal recessive early-onset parkinsonism. Science. 2003;299:256–259. doi: 10.1126/science.1077209. [DOI] [PubMed] [Google Scholar]
  7. Di Fonzo A, Chien HF, Socal M, Giraudo S, Tassorelli C, Iliceto G, Fabbrini G, Marconi R, Fincati E, Abbruzzese G, et al. ATP13A2 missense mutations in juvenile parkinsonism and young onset Parkinson disease. Neurology. 2007;68:1557–1562. doi: 10.1212/01.wnl.0000260963.08711.08. [DOI] [PubMed] [Google Scholar]
  8. Kitada T, Asakawa S, Hattori N, Matsumine H, Yamamura Y, Minoshima S, Yokochi M, Mizuno Y, Shimizu N. Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature. 1998;392:605–608. doi: 10.1038/33416. [DOI] [PubMed] [Google Scholar]
  9. Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B, Root H, Rubenstein J, Boyer R, et al. Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science. 1997;276:2045–2047. doi: 10.1126/science.276.5321.2045. [DOI] [PubMed] [Google Scholar]
  10. Wintermeyer P, Kruger R, Kuhn W, Muller T, Woitalla D, Berg D, Becker G, Leroy E, Polymeropoulos M, Berger K, et al. Mutation analysis and association studies of the UCHL1 gene in German Parkinson's disease patients. Neuroreport. 2000;11:2079–2082. doi: 10.1097/00001756-200007140-00004. [DOI] [PubMed] [Google Scholar]
  11. Mata IF, Kachergus JM, Taylor JP, Lincoln S, Aasly J, Lynch T, Hulihan MM, Cobb SA, Wu RM, Lu CS, et al. Lrrk2 pathogenic substitutions in Parkinson's disease. Neurogenetics. 2005;6:171–177. doi: 10.1007/s10048-005-0005-1. [DOI] [PubMed] [Google Scholar]
  12. Mata IF, Wedemeyer WJ, Farrer MJ, Taylor JP, Gallo KA. LRRK2 in Parkinson's disease: protein domains and functional insights. Trends Neurosci. 2006;29:286–293. doi: 10.1016/j.tins.2006.03.006. [DOI] [PubMed] [Google Scholar]
  13. Manning G, Whyte DB, Martinez R, Hunter T, Sudarsanam S. The protein kinase complement of the human genome. Science. 2002;298:1912–1934. doi: 10.1126/science.1075762. [DOI] [PubMed] [Google Scholar]
  14. Bosgraaf L, Van Haastert PJ. Roc, a Ras/GTPase domain in complex proteins. Biochim Biophys Acta. 2003;1643:5–10. doi: 10.1016/j.bbamcr.2003.08.008. [DOI] [PubMed] [Google Scholar]
  15. Guo L, Gandhi PN, Wang W, Petersen RB, Wilson-Delfosse AL, Chen SG. The Parkinson's disease-associated protein, leucine-rich repeat kinase 2 (LRRK2), is an authentic GTPase thatstimulates kinase activity. Exp Cell Res. 2007;313:3658–3670. doi: 10.1016/j.yexcr.2007.07.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Greggio E, Jain S, Kingsbury A, Bandopadhyay R, Lewis P, Kaganovich A, van der Brug MP, Beilina A, Blackinton J, Thomas KJ, et al. Kinase activity is required for the toxic effects of mutant LRRK2/dardarin. Neurobiol Dis. 2006;23:329–341. doi: 10.1016/j.nbd.2006.04.001. [DOI] [PubMed] [Google Scholar]
  17. Smith WW, Pei Z, Jiang H, Dawson VL, Dawson TM, Ross CA. Kinase activity of mutant LRRK2 mediates neuronal toxicity. Nat Neurosci. 2006;9:1231–1233. doi: 10.1038/nn1776. [DOI] [PubMed] [Google Scholar]
  18. The Exelixis Collection at the Harvard Medical School http://drosophila.med.harvard.edu/index.php?option=com_frontpage&Itemid=1
  19. Klivenyi P, Siwek D, Gardian G, Yang L, Starkov A, Cleren C, Ferrante RJ, Kowall NW, Abeliovich A, Beal MF. Mice lacking alpha-synuclein are resistant to mitochondrial toxins. Neurobiol Dis. 2006;21:541–548. doi: 10.1016/j.nbd.2005.08.018. [DOI] [PubMed] [Google Scholar]
  20. Abeliovich A, Flint Beal M. Parkinsonism genes: culprits and clues. J Neurochem. 2006;99:1062–1072. doi: 10.1111/j.1471-4159.2006.04102.x. [DOI] [PubMed] [Google Scholar]
  21. Meulener M, Whitworth AJ, Armstrong-Gold CE, Rizzu P, Heutink P, Wes PD, Pallanck LJ, Bonini NM. Drosophila DJ-1 mutants are selectively sensitive to environmental toxins associated with Parkinson's disease. Curr Biol. 2005;15:1572–1577. doi: 10.1016/j.cub.2005.07.064. [DOI] [PubMed] [Google Scholar]
  22. Thiruchelvam M, Richfield EK, Baggs RB, Tank AW, Cory-Slechta DA. The nigrostriatal dopaminergic system as a preferential target of repeated exposures to combined paraquat and maneb: implications for Parkinson's disease. J Neurosci. 2000;20:9207–9214. doi: 10.1523/JNEUROSCI.20-24-09207.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Coulom H, Birman S. Chronic exposure to rotenone models sporadic Parkinson's disease in Drosophila melanogaster. J Neurosci. 2004;24:10993–10998. doi: 10.1523/JNEUROSCI.2993-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Iaccarino C, Crosio C, Vitale C, Sanna G, Carri MT, Barone P. Apoptotic mechanisms in mutant LRRK2-mediated cell death. Hum Mol Genet. 2007;16:1319–1326. doi: 10.1093/hmg/ddm080. [DOI] [PubMed] [Google Scholar]
  25. Bove J, Prou D, Perier C, Przedborski S. Toxin-induced models of Parkinson's disease. NeuroRx. 2005;2:484–494. doi: 10.1602/neurorx.2.3.484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Gomez C, Bandez MJ, Navarro A. Pesticides and impairment of mitochondrial function in relation with the parkinsonian syndrome. Front Biosci. 2007;12:1079–1093. doi: 10.2741/2128. [DOI] [PubMed] [Google Scholar]
  27. Lee SB, Kim W, Lee S, Chung J. Loss of LRRK2/PARK8 induces degeneration of dopaminergic neurons in Drosophila. Biochem Biophys Res Commun. 2007;358:534–539. doi: 10.1016/j.bbrc.2007.04.156. [DOI] [PubMed] [Google Scholar]
  28. Wang D, Qian L, Xiong H, Liu J, Neckameyer WS, Oldham S, Xia K, Wang J, Bodmer R, Zhang Z. Antioxidants protect PINK1-dependent dopaminergic neurons in Drosophila. Proc Natl Acad Sci USA. 2006;103:13520–13525. doi: 10.1073/pnas.0604661103. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 1

Amino acid sequence alignment of hLRRK2 and dLRRK. The data provided the amino acid sequence alignment of hLRRK2 and dLRRK. hLRRK2 amino acid sequences (NP_940980) and dLRRK amino acid sequences (CG5483, NP_650903) are from NCBI protein database. Alignment was done with MacVector™ 7.2.2. "*" Indicates identical amino acids between the two sequences. "." Indicates conserved amino acids between the two sequences. Highlighted purple indicates Roc GTPase domain. Highlighted red indicates kinase domain. Highlighted blue indicates the conserved PD associated point mutation sites between human and Drosophila.

Click here for file (56KB, doc)

Articles from Molecular Neurodegeneration are provided here courtesy of BMC

RESOURCES