Skip to main content
NCBI home page
Endocrinology logoLink to Endocrinology
. 2007 Dec 27;149(4):1571–1580. doi: 10.1210/en.2007-0515

Feeding and Metabolism in Mice Lacking Pituitary Adenylate Cyclase-Activating Polypeptide

Bruce A Adams 1,a, Sarah L Gray 1,a, Emma R Isaac 1, Antonio C Bianco 1, Antonio J Vidal-Puig 1, Nancy M Sherwood 1
PMCID: PMC2276722  PMID: 18162530

Abstract

Disruption of the pituitary adenylate cyclase-activating polypeptide (PACAP) gene in mice has demonstrated a role for this highly conserved neuropeptide in the regulation of metabolism and temperature control. Localization of PACAP neurons within hypothalamic nuclei that regulate appetite suggest PACAP may affect feeding and thus energy balance. We used PACAP-null mice to address this question, examining both food intake and energy expenditure. PACAP-null mice were leaner than wild-type littermates due to decreased adiposity and displayed increased insulin sensitivity. The lean phenotype in the PACAP-null mice was completely eliminated if animals were fed a high-fat diet or housed near thermoneutrality (28 C). Further metabolic analyses of PACAP-null mice housed at 21 C indicated that the reduced body weight could not be explained by decreased food intake, increased metabolic rate, or increased locomotor activity. The thyroid hormone axis of PACAP-null mice was affected, because mRNA levels of hypothalamic TRH and brown adipose tissue type 2 deiodinase were reduced in PACAP-null mice housed at room temperature, and brain deiodinase activity was lower in PACAP-null mice after an acute cold challenge compared with wild-type controls. These results demonstrate that PACAP is not required for the regulation of food intake yet is necessary to maintain normal energy homeostasis, likely playing a role in central cold-sensing mechanisms.

PITUITARY ADENYLATE CYCLASE-activating poly-peptide (PACAP) was originally isolated from the hypothalamus of sheep (1,2) and was included as a member of the glucagon superfamily of hormones because of related protein structure, particularly in the first 27 amino acids. Three receptors are known to bind PACAP; PAC1 receptor, of which there are at least nine variant forms, is specific for PACAP, whereas the other two receptors, VPAC1 and VPAC2, bind both PACAP and vasoactive intestinal polypeptide (VIP) (3,4).

A number of primarily in vitro studies show PACAP stimulates the release of other hormones. PACAP releases insulin and glucagon from the pancreas (5), catecholamines from the adrenal medulla (6), glucocorticoids from the adrenal cortex in some species (7), and GH from the pituitary gland (8). PACAP acts on blood vessels to cause vasorelaxation (9) and can inhibit platelet formation in blood (10). In the developing nervous system, PACAP acts to alter proliferation and differentiation (11,12). Recently, PACAP’s actions have been examined in mice in which either PACAP or one of its receptors has been knocked out by targeted disruption of the gene (13). These studies show that PACAP plays a role in behavior (14,15) and in lipid and carbohydrate metabolism (16), including the response to a metabolic stress such as an insulin challenge or cold (6,16). One hypothesis to explain the many actions of PACAP is that it is used for responses to environmental or metabolic stress (6).

There is an increasing focus on determining which hormones play a role in coordinating energy balance and appetite regulation as well as their interplay (17). Mouse models null for PACAP or the PAC1 or VPAC2 receptors present a complex phenotype with altered metabolic function (13,18). Features such as defective norepinephrine signaling (19) would suggest that PACAP-null mice are prone to obesity. Injection of PACAP into rodent models of type 2 diabetes does reduce blood glucose levels (20), presumably by aiding in insulin release and uptake of glucose in peripheral tissues such as white adipose tissue (WAT) (21). However, there is no association between polymorphisms in the human gene that codes for PACAP, ADCYAP1, and clinical symptoms in type 2 diabetic patients (22). One question is whether PACAP-null mice are subject to a unique problem in energy homeostasis in the long term and whether this is aggravated by diet type.

PACAP is expressed in neural regions of the hypothalamus known to regulate appetite (23). Exogenous PACAP can affect appetite; intracerebroventricular injection of PACAP reduced short-term food intake in mice (24), rats (25,26), chicks (27,28), and goldfish (29). The mechanism for this action of PACAP is not clear. In rats, there is no effect of PACAP on expression of NPY or CRH (26). However, in the chick, a possible anorexigenic action of PACAP is mediated by CRH neurons (30). These data generate the question of whether appetite is altered in the PACAP-null mouse.

To further explore how PACAP acts to regulate energy balance, we fed PACAP-null mice a regular chow or high-fat diet and assessed the effect of diet composition on body mass, fat mass and distribution, food intake, utilization of glucose, and insulin response compared with controls. Additionally, because of the previously determined temperature-sensitive phenotype of our PACAP-null mice housed at 21 C, we performed a parallel feeding study of mice housed at 28 C, near thermoneutrality. We show that PACAP-null mice fed normal chow and housed at 21 C have reduced body mass due to a reduction in adiposity. However, high-fat feeding and housing near thermoneutrality prevent the PACAP-null mice from developing this lean phenotype.

Materials and Methods

Animals and feeding

PACAP-null mice and wild-type littermate controls were backcrossed for 10 generations onto a C57BL/6 background unless otherwise stated. Because PACAP-null mouse survival is reduced when housed at 21 C (19), mice were reared at 28 C at least until weaning before being housed at 21 C or remaining at 28 C. Mice were genotyped and identified by ear clipping during the first postnatal week. Genomic DNA was generated and PCR performed as described previously (16). All procedures using animals were approved by the University of Victoria Animal Care Committee or by the University of Cambridge and The UK Home Office.

Experimental design

Four major experiments on wild-type and PACAP-null mice are included. 1) Long-term feeding was studied in four groups of mice: chow diet maintained at 21 C, high-fat diet at 21 C, chow diet at 28 C, and high-fat diet at 28 C. Body mass and food intake were monitored throughout the experiment; glucose tolerance and insulin tolerance were assessed 23 wk after weaning; and adipose tissue mass, and serum insulin and serum leptin levels were determined at the end of the experiment. 2) Continuous short-term food consumption (72 h) of regular chow diet at 21 C was examined along with continuous monitoring of water intake, animal activity, and oxygen consumption. At the end of the experiment, body composition, fasted blood glucose, fasted serum biochemistry, and gene expression profiles of adipose tissue and skeletal muscle were assessed. 3) The thyroid axis was assessed by measuring total T3 and T4 from adult mice on regular chow diet maintained at 21 C or 28 C. 4) Finally, adult PACAP-null mice fed a chow diet and housed at 21 C were exposed to an acute cold challenge during which behavior and rectal temperature was monitored. At the end of the cold challenge, deiodinase activity was measured in brain, liver, and brown adipose tissue (BAT), and serum T3 and T4 were measured.

Long-term feeding study

Mice were fed either a regular chow diet consisting of 10% kcal from fat or a high-fat diet consisting of 45% kcal from fat (Research Diets, New Brunswick, NJ) from weaning until 23 wk of age. For studies at 21 C, pups were reared at 28 C until weaning when they were transferred to 24 C for 1 wk and finally moved to 21 C for the duration of the study. Body mass and food consumption was recorded once per week. Food consumption was considered the difference between the remaining food upon weighing from the weight of the food the week before (adjusted for any added food). The daily value was then determined by dividing that difference in mass by the number of days between the two weights. Upon completion of testing, mice were deeply anesthetized with isoflurane (flow rate = 5 liters/min), and blood was collected by cardiac puncture. The blood was kept at 4 C for up to 1 h, centrifuged in a microcentrifuge for 5 min at 5000 × g, and serum was stored at −80 C. The mice were euthanized for dissection of brain, BAT, liver, skeletal muscle, and WAT. Tissues were quick-frozen in liquid nitrogen and later transferred to −80 C for long-term storage.

Metabolic analyses

Metabolic analyses of PACAP-null mice and wild-type controls housed at 21 C included 72 h of continuous monitoring of animal activity and food (chow diet), water, and oxygen consumption using the continuous laboratory animal monitoring system (CLAMS) (Columbus Instruments, Columbus, OH) fitted with an indirect calorimetry system (miniMOX; University of Cambridge, Cambridge, UK). Oxygen consumption rates were normalized to lean mass as determined using the Lunar PIXImus 2 bone densitometer [dual-energy x-ray absorptiometry (DEXA); GE Medical Systems, Madison, WI].

Glucose and insulin tolerance tests

Adult wild-type and PACAP-null mice from the long-term feeding study with both diets and ambient temperatures were fasted for 5 h, and blood glucose was determined by sampling through the saphenous vein before glucose administration. d-Glucose was given by gavage, and blood glucose was determined at 10, 30, 60, 90, and 120 min after gavage using a glucometer (OneTouch Ultra, LifeScan; Johnson & Johnson, HighWycombe, UK). The same mice were tested 1 wk later for insulin tolerance. Mice were fasted for 5 h or more, and blood glucose was determined before an ip injection of insulin (0.75 U human insulin/kg). Blood glucose was determined at 10, 30, 60, 90, and 120 min after the injection.

Insulin and leptin ELISAs

Serum insulin and leptin levels were measured using commercially available kits (Rat Sensitive Insulin ELISA Kit and Mouse Leptin ELISA Kit; Millipore, Temecula, CA) according to the manufacturer’s directions.

Assessment of body composition

At the end of the short- and long-term feeding studies, mouse body mass and individual fat pad masses including inguinal sc WAT, gonadal WAT (gWAT), and interscapular BAT (iBAT) were measured at dissection and expressed as a percentage of total body mass. In mice that underwent metabolic analysis (CLAMS), body composition was determined using the Lunar PIXImus 2 bone densitometer (DEXA; GE Medical Systems), which provided a measure of percent fat and lean mass.

Biochemistry

Biochemical analyses of serum samples included measurement of blood glucose (OneTouch Ultra Lifescan, Johnson and Johnson; or Glucometer Elite, Bayer Toronto, Canada), total serum cholesterol, high-density lipoprotein, triglycerides (automated analyzer), insulin (DRG Diagnostics International Ltd., Mountainside, NJ), free fatty acids (Roche, Welwyn Garden City, UK), adiponectin (B-Bridge International, Mountain View, CA), and leptin (R&D Systems, Abingdon, UK).

Expression of mRNA for selected genes using real-time PCR

Individual tissues (gWAT, iBAT, and skeletal muscle) from mice that underwent metabolic analyses at 21 C were dissected and frozen immediately in liquid nitrogen. Total RNA was extracted using RNA STAT60 (Tel-Test “B” Inc., Friendswood, TX) as described by the manufacturer. cDNA was reverse transcribed from 500 ng total RNA (Promega, Southampton, UK). Expression levels (mRNA) for selected genes were determined using real-time PCR (TaqMan; Applied Biosystems, Warrington, UK) with primers and probes designed to specific mRNAs (Sigma, Poole, UK) (Table 1). PCR conditions were carried out as follows: one cycle of 50 C for 2 min, 95 C for 10 min, and then 40 cycles of 95 C for 15 sec, 60 C for 1 min. Values were normalized against 18S RNA (gWAT and iBAT) or β-actin (skeletal muscle) and expressed as fold change compared with wild-type mice.

Table 1.

TaqMan primer/probe sets used to measure mRNA expression levels in various tissues of PACAP+/+ and PACAP−/− mice

Gene Forward primer (5′–3′) Reverse primer (5′–3′) Probe (5′–3′) (Fam/Tamara)
18S CGGCTACCACATCCAAGGAA GTCGGAATTACCGCGGCT GAGGGCAAGTCTGGTGCCAG
β-Actin GCTCTGGCTCCTAGCACCAT GCCACCGATCCACACAGAGT GATCAAGATCATTGCTCCTCCTGAGCGC
PPARγ1 TTTAAAAACAAGACTACCCTTTACTGAAATT AGAGGTCCACAGAGCTGATTC AGCACTTCACAAGAAATTACCATGGTTGACACA
PPARγ2 GATGCACTGCCTATGAGCACTT AGAGGTCCACAGAGCTGATTC AGCACTTCACAAGAAATTACCATGGTTGACACA
aP2 CACCGCAGACGACAGGAAG GCACCTGCACCAGGGC TGAAGAGCATCATAACCCTAGATGGCGG
CD36 GCCAAGCTATTGCGACATGA TCTCAATGTCCGAGACTTTTCA CACAGACGCAGCCTCCTTTCCACCT
HSL GGAGCACTACAAACGCAACGA TCGGCCACCGGTAAAGAG CAGGCCTCAGTGTGACCGCCA
LPL TGGAGAAGCCATCCGTGTG TCATGCGAGCACTTCACCAG TGCAGAGAGAGGACTCGGAGACGTGC
UCP1 CCCGCTGGACACTGCC ACCTAATGGTACTGGAAGCCTG AAGTCCGCCTTCAGATCCAAGGTGAAG0
PGC1α AACCACACCCACAGGATCAGA CTCTTCGCTTTATTGCTCCATGA CAAACCCTGCCATTGTTAAGA
UCP2 GATCTCATCACTTTCCCTCTGGATA CCCTTGACTCTCCCCTTGG CGCCAAGGTCCGGCTGCAGA
UCP3 AGATGGTGGCTCAGGAGGG CCCAGACGCAGAAAGGAGG CCCACGGCCTTCTACAAAGGA
ACS CAAACCAGCCCTATGAGTGGAT CAGCCCGGAGCGTATGC CCTACAAAGAGGTGGCAGAACTGGCTGAG
AOX AATTGGCACCTACGCCCAG AGTGGTTTCCAAGCCTCGAA CGGAGATGGGCCACGGAACTCA
LCAD GCATGAAACCAAACGTCTGGA TGTTTTGTAATTCAGATGCCCAGT TCCGGTTCTGCTTCCATGGCAAAA
CPT1 GCGTGCCAGCCACAATTC TCCATGCGGTAATATGCTTCAT CCGGTACTTGGATTCTGTGCGGCC
PPARα CCTCAGGGTACCACTAGGGAGT GCCGAATAGTTCGCCGAAA CACGCATGTGAAGGCTGTAAGCGCTT
GLUT4 ACTCATTCTTGGACGGTTCCTC CACCCCGAAGATGAGTGGG TGGCGCCTACTCAGGGCTAACATCA
PEPCK TGTGGGCGATGACATTGC TGGCATTTGGATTTGTCTTCAC TATCAACCCAGAAAAACGGGTTTTTTG
TRH CGGCCAGAACGTCGATTC GAATCTAAGGCAGCACCAAGGT AGGAAAGACCTCCAGCGTGTGCGAG
mGUS CTCATCTGGAATTTCGCCGA GGCGAGTGAAGATCCCCTTC CGAACCAGTCACCGCTGAGAGTAATCG
Open in a new tab

Assessment of thyroid axis in adult mice

Adult mice were anesthetized for blood collection by cardiac puncture and immediately euthanized by isoflurane or carbon dioxide overdose and cervical dislocation. Plasma total T4 and total T3 were measured by commercial RIA kits (Diagnostics Products Corp., Los Angeles, CA).

Deiodinase activity assays

Type 1 and type 2 deiodinase (D1 and D2) activities were measured as previously described (31). Tissues were sonicated in 0.25 mol/liter sucrose, 100 mmol/liter potassium phosphate buffer, 1 mmol/liter EDTA, and 10 mmol/liter dithiothreitol. Protein concentration was measured by the Bradford method using BSA as a standard. Assay reactions contained tissue sonicates plus 0.5 nmol/liter [125I]T4 (for D2) or 0.5 μmol/liter [125I]rT3 (for D1), 10 mmol/liter dithiothreitol (for D1) or 20 mmol/liter dithiothreitol (for D2) in potassium phosphate/EDTA buffer in a total volume of 300 μl. For D2 activity, 1 mmol/liter propylthiouracil was added to the reaction mixture to inhibit D1 activity.

Acute cold challenge of adult mice

Two- to 3-month-old adult C57BL/6 male and female wild-type and PACAP-null mice were born and raised at 28 C, acclimated to 21 C for at least 2 wk, and then transferred to a 4 C cold room for up to 5 h. After 1 h, some mice were removed from the experiment so that hypothalamic tissue could be analyzed for mRNA levels of TRH. RNA was extracted using the RNeasy Kit (QIAGEN Inc., Valencia, CA) and treated by Turbo DNase (Ambion, Austin, TX) as described by the manufacturer. cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA), and TRH was measured by TaqMan PCR as described above. For the remainder of the mice, rectal temperatures were taken using a rectal probe for mice (Harvard Instruments, Boston, MA) at 0 and 30 min and at every hour thereafter. Following the Animal Care Committee protocol, mice were removed from the study and euthanized if their rectal temperature dropped 10 C or more from the initial temperature. Furthermore, the animals were monitored for signs of behavioral responses to cold (e.g. activity and shivering) and for consciousness. Mice were anesthetized for blood collection by cardiac puncture for measurement of total T4 and T3 and then euthanized with carbon dioxide and cervical dislocation. Brain, liver, and BAT were collected by dissection, quick-frozen in liquid nitrogen, and stored at −80 C until deiodinase activity was measured.

In situ hybridization and immunohistochemistry

Whole brain was dissected from adult wild-type mice, and immediately, the hypothalamus and surrounding tissue were dissected from the brain and washed three times in PBS without calcium and magnesium ions for 10 min each at 4 C and then overnight in 4% paraformaldehyde (PFA) in PBS. Tissue was washed two times for 10 min in PBS and then immersed in 20% sucrose in PBS for 12 h before being incubated overnight in 30% sucrose in PBS. The next day, the tissue was transferred into embedding medium Tissue Tek O.C.T. (Electron Microscopy Sciences, Hatfield, PA) at 4 C before the tissue was finally immersed into blocks containing O.C.T. and frozen on dry ice.

Ten-micrometer frozen sections on slides were air dried, fixed in 4% PFA for 20 min and washed three times in PBS before performing digoxigenin-based in situ hybridization using both antisense and sense (as a control) TRH cRNA probes that included an overnight hybridization temperature of 65 C. The final color reaction was stopped by putting slides in water. For immunofluorescence, after fixing the slides again for 20 min in 4% PFA, slides were washed three times for 5 min each in cold PBS and antigens retrieved by boiling in Antigen Retrieval Solution (BioGenex, San Ramon, CA) for 10 min. Slides were then cooled and washed in water and PBS. Slides were washed three times for 10 min each in PBS and then transferred to humidified chambers where sections were blocked with 5% BSA in PBS containing 0.1% Triton X-100 for 1 h at room temperature. Slides were then washed three times in PBS and sections incubated with a goat anti-PAC1 receptor (32), a gift of Drs. S. Shioda and T. Nakamachi, diluted 1:1000 in 1% BSA and PBS containing 0.1% Triton X-100, overnight at 4 C. The next morning, slides were washed three times in PBS and sections incubated with donkey antigoat fluorescein isothiocyanate-secondary IgG antibodies (The Jackson Laboratory, Bar Harbor, ME), diluted 1:200 in 1% BSA, for 1 h at room temperature and in the dark. After three more washes in PBS, sections were mounted in Vectashield mounting medium (Vector Laboratories, Inc., Burlingame, CA) and analyzed with fluorescence microscopy.

Statistical analysis

Data are presented as mean ± sem. Statistical significance between the genotypes was determined using unpaired Student’s t tests. Significance was defined as P values < 0.05 (GraphPad Instat 3 and Microsoft Excel).

Results

PACAP-null mice are leaner than wild-type controls when raised at 21 C

Weekly measures of body mass revealed that PACAP-null mice housed at 21 C and fed a standard chow diet were lighter than their wild-type littermates (Fig. 1). Although high-fat feeding from weaning until 23 wk of age promoted weight gain in both wild-type and PACAP-null mice, there were no differences in body mass between the two groups maintained at 21 C. Additionally, there were no differences in mass between wild-type and PACAP-null mice fed either regular chow or high-fat diet when housed at 28 C (Fig. 1). Consistent with reduced body mass, DEXA analysis revealed significantly reduced total body fat in PACAP-null mice held at 21 C compared with wild-type controls, a reduction that was consistent across all adipose tissue depots measured (Fig. 2). Lean mass was not significantly reduced in the PACAP-null mice compared with wild-type controls (Fig. 2). As predicted by the reduced fat mass in the PACAP-null mice raised at 21 C, serum leptin levels were lower in PACAP-null mice compared with wild-type controls (Table 2).

Figure 1.

Figure 1

Open in a new tab

Body mass (A, B) of male PACAP-null and wild-type mice on chow or high-fat diet (HFD) up to 23 wk of age and food consumption of mice held at 28 C or 21 C (C, D) expressed as percentage of food eaten per average weight per day of weight.

Figure 2.

Figure 2

Open in a new tab

Body composition of male PACAP-null (white bars) and wild-type (black bars) mice fed normal chow and housed at an ambient temperature of 21 C. A, Body mass of PACAP-null mice compared with wild-type mice; B, body composition expressed as percent lean mass and percent fat mass in PACAP-null mice and control mice as measured by DEXA; C, mass of individual adipose tissue depots and liver measured at dissection. BAT, Brown adipose tissue; g, gonadal; rp, retroperitoneal; WAT, white adipose tissue. *, Significance (P < 0.05) between PACAP-null mice and wild-type mice.

Table 2.

Serum biochemistry and weights of fasted, male PACAP+/+ and PACAP−/− mice held at 21 C

PACAP+/+ PACAP−/−
Body mass (g) 25.14 ± 1.01 22.27 ± 0.53a
Blood glucose (mmol/liter) 6.03 ± 0.78 4.23 ± 0.33a
Insulin (ng/ml) 0.32 ± 0.08 0.21 ± 0.01
Free fatty acids (mmol/liter) 0.33 ± 0.05 0.43 ± 0.05
Triglycerides (mmol/liter) 0.63 ± 0.09 0.76 ± 0.10
β-Hydroxybutyrate (mmol/liter) 656.0 ± 135.4 955.57 ± 112.4
Cholesterol (mmol/liter) 1.68 ± 0.10 1.54 ± 0.09
HDL (mmol/liter) 0.87 ± 0.08 0.76 ± 0.06
Adiponectin (μg/ml) 20.58 ± 1.96 19.05 ± 1.10
Leptin (ng/ml) 1.47 ± 0.35 0.65 ± 0.19a
Liver mass (% body weight) 4.36 ± 0.23 4.22 ± 0.10
Open in a new tab
a

Significantly different from wild-type mice. 

PACAP-null mice have normal food consumption compared with control mice

PACAP-null mice consumed as much food as wild-type controls when assessed weekly until 23 wk of age (Fig. 1) in regular chow or high-fat-fed animals at 21 C or 28 C or by continuous measurement of food intake over a 72-h period (chow diet at 21 C) (see Fig. 4A).

Figure 4.

Figure 4

Open in a new tab

Metabolic analyses of PACAP-null (white bars) and wild-type (black bars) mice fed normal chow and housed at an ambient temperature of 21 C as measured using CLAMS over a 70-h period. A, Total amount of chow diet; B, water consumed during 70 h of continuous metabolic monitoring; C, average activity (determined by beam breaks) of PACAP-null mice (gray line) vs. wild-type mice (black line); D, average oxygen consumption (VO2, milliliters per minute per kilogram lean mass); E, respiratory quotient (RER) determined during 70 h of continuous metabolic monitoring.

Enhanced response to insulin occurs in PACAP-null mice

Because PACAP potently induces insulin release in a glucose-dependent manner in vitro and because a high-fat diet can lead to insulin insensitivity we were interested in assessing glucose and insulin tolerance in PACAP-null mice on the two different diet regimes. There were no significant differences between wild-type and PACAP-null mice fed either regular or high-fat diet in response to an oral glucose tolerance test (data not shown). As expected, high-fat feeding impaired glucose tolerance in mice of both genotypes when compared with chow-fed mice.

Serum insulin levels in PACAP-null mice fed regular chow were reduced to 30% of the level in wild-type controls whether the mice were fed (Fig. 3E) or fasted (Fig. 3F). Additionally, PACAP-null mice had an enhanced response to the insulin tolerance test. In fact, about 10% of the PACAP-null mice tested went into hypoglycemic shock as a result of the insulin injection and had to be treated with an injection of glucose and allowed to recover. However, this enhanced sensitivity to insulin disappeared if PACAP-null mice were fed a high-fat diet and housed at 28 C.

Figure 3.

Figure 3

Open in a new tab

A–D, Insulin tolerance tests in male PACAP-null and wild-type mice fed normal chow or a high-fat diet (HFD) and housed at an ambient temperature of 28 C or 21 C; E and F, fed (E) and fasted (F) plasma insulin concentrations in male PACAP-null mice vs. wild-type mice fed normal chow or a high-fat diet.

No alterations in energy consumption or expenditure occur in a 72-h continuous evaluation of metabolic status in PACAP-null mice

Although PACAP-null mice at 21 C have reduced body mass compared with wild-type controls, we observed no difference in 72-h food consumption, water consumption, activity levels, or oxygen consumption (VO2 milliliters per minute per kilogram lean mass) in PACAP-null mice compared with wild-type controls (Fig. 4). Additionally, the respiratory quotient was not significantly different between the two groups.

PACAP-null mice have reduced mRNA expression of thermogenic genes in iBAT but no change in adipogenic or lipogenic genes in WAT

Gene expression (mRNA) in iBAT revealed decreased expression of thermogenic genes: uncoupling protein 1 (UCP1), peroxisome proliferator-activated receptor (PPAR)γ coactivator 1α (PGC1α), and Dio2 and in the fatty acid translocase CD36 (Fig. 5). In gWAT, no significant alterations in gene expression level were observed for lipoprotein lipase (LPL), hormone-sensitive lipase (HSL), adipocyte fatty acid-binding protein (aP2), PPARγ2, or PPARγ1 in the PACAP-null mice compared with wild-type (Fig. 5).

Figure 5.

Figure 5

Open in a new tab

Gene expression analysis in BAT (A), and gWAT (B) of PACAP-null and wild-type mice fed a normal chow diet and housed at an ambient temperature of 21 C. mRNA levels were normalized to 18S RNA (BAT and gWAT) and are expressed as fold change compared with levels in wild-type (WT) mice. *, Significance (P < 0.05) between PACAP-null and wild-type mice.

Normal oxidative gene expression occurs in skeletal muscle of PACAP-null mice

Expression of selected genes revealed no alterations in the mRNA levels of several oxidative genes including carnitine palmitoyl transferase 1 (CPT1), long-chain acyl-coenzyme A dehydrogenase (LCAD), acyl-coenzyme A synthetase (ACS), uncoupling protein 2 (UCP2), UCP3, and PPARα and genes involved in glucose metabolism such as glucose transporter 4 (GLUT 4) and phosphoenolpyruvate carboxykinase (PEPCK) in skeletal muscle of PACAP-null mice compared with wild-type controls (data not shown).

PACAP-null mice held at 21 C had significantly lower fasting blood glucose levels, but serum lipid levels (free fatty acids, triglycerides, cholesterol, and high-density lipoprotein) and serum ketones (β-hydroxybutyrate) were not significantly different from wild-type controls (Table 2).

Adult PACAP-null mice are cold sensitive and have an altered thyroid axis response

PACAP-null mouse pups are known to be cold sensitive (19). To examine whether this phenotype exists in adults, we exposed adult mice to an acute cold challenge. Additionally, we measured a number of thyroidal parameters in adult C57BL/6 mice housed at 21 and 28 C and those that underwent the 4 C cold challenge.

Serum T3 and T4 concentrations were unaffected by housing adult wild-type mice at 28 C vs. 21 C (Fig. 6A). In contrast, PACAP-null adult mice acclimated at 28 C had significantly lower serum T4 concentration but managed to keep a normal serum T3. PACAP-null mice housed at 21 C had serum T4 and T3 concentrations that were not significantly different from wild-type controls (Fig. 6A). In the cold challenge at 4 C, PACAP-null mice had begun to lose the ability to maintain core body temperature by 3 h, and 50% of the PACAP-null mice had a drop in body temperature of 10 C by 5 h, whereas wild-type littermates were able to maintain body temperature for the full 5-h cold challenge (Table 3). This happened despite the fact that adult PACAP-null mice sustained levels of T4 and T3 comparable to wild-type mice at the end of a 5-h cold challenge (data not shown). Normal liver D1 activity confirmed systemic euthyroidism in the cold-exposed PACAP-null mice (Fig. 6B). Notably, BAT D2 activity, which is normally activated severalfold by 4 C cold exposure, was not different between wild-type and PACAP-null mice. However, brain D2 activity, which is also activated during cold exposure (33), was significantly lower in cold-challenged PACAP-null mice compared with wild-type controls (Fig. 6B), suggesting a muted central response to cold challenge. Although PACAP-null mice at 21 C have reduced levels of hypothalamic TRH compared with wild-type mice, there was no difference in hypothalamic TRH mRNA between PACAP-null mice and wild-type mice after 1 h at 4 C (Fig. 6C). Finally, we identified hypothalamic TRH-expressing cells that were immunoreactive to the PAC1 receptor antibody (Fig. 6, D and E).

Figure 6.

Figure 6

Open in a new tab

A, Plasma levels of total T4 (TT4) and T3 (TT3) in adult PACAP wild-type and null mice housed at either 21 C or 28 C; B, liver, BAT, and brain deiodinase activities in PACAP wild-type and null mice after a 5-h exposure to 4 C; C, relative levels of hypothalamic TRH mRNA prepared from adult wild-type and PACAP-null mice housed at 21 C or exposed to 4 C for 1 h; D and E, in situ hybridization of TRH mRNA (D) subsequently stained with anti-PAC1 receptor antibody (E) in wild-type mouse hypothalamus. Blue arrows indicate examples of cells that stain heavily for TRH but have little to no PAC1 receptor immunoreactivity; red arrows indicate examples of cells that coexpress detectable levels of both TRH and are anti-PAC1 receptor immunoreactive; yellow arrows indicate examples of cells that are heavily PAC1 receptor immunoreactive but have little to no TRH mRNA. *, Significance (P < 0.05) between PACAP-null and wild-type mice.

Table 3.

Rectal temperatures (C) of individual PACAP−/− and PACAP+/+ mice for up to 5 h in an acute 4 C temperature challenge

Mouse ID Rectal temperature (C)
Initial 1 h 2 h 3 h 4 h 5 h
PACAP−/− 1 38.6 36.8 36.0 35.6 34.6 31.2
PACAP−/− 2 38.5 36.0 35.7 35.7 34.4 a
PACAP−/− 3 38.7 37.0 36.0 35.3 33.5 36.7
PACAP−/− 4 38.6 35.5 33.4 31.9 a
PACAP−/− 5 38.7 35.7 35.9 34.6 35.7 33.3
PACAP−/− 6 38.3 36.0 35.5 35.8 34.6 a
PACAP+/+ 1 37.8 36.1 36.2 35.2 35.7 34.2
PACAP+/+ 2 38.2 37.0 36.4 35.2 35.3 34.5
PACAP+/+ 3 38.4 36.6 36.2 35.8 36.2 35.6
PACAP+/+ 4 38.0 36.2 34.9 35.4 36.7 36.9
PACAP+/+ 5 38.5 36.1 36.3 35.0 35.2 35.6
PACAP+/+ 6 38.0 36.0 35.9 35.3 35.1 35.6
PACAP+/+ 7 38.0 35.6 35.0 36.2 36.3 35.5
Open in a new tab
a

Mice that lost 10 or more degrees of body temperature from their initial temperature were removed from the experiment. 

Discussion

To probe the role of PACAP in homeostatic responses for the maintenance of energy balance, we examined mice in which the PACAP gene was disrupted. First, obesity or hyperphagia was never expressed in PACAP-null mice compared with control mice regardless of ambient temperature or diet. Second, PACAP-null mice were leaner than wild-type mice if maintained on a regular chow diet and at an ambient temperature of 21 C. The reduced weight was not due to a loss of lean mass but to decreased fat mass, which was accompanied by reduced leptin and insulin levels, as expected. Third, PACAP-null mice compared with wild-type mice had normal glucose tolerance but an enhanced response to an insulin tolerance test. The effect was eliminated when animals were housed at 28 C and fed a high-fat diet. Fourth, adult PACAP-null mice were cold sensitive at 4 C, losing body temperature faster than wild-type mice. Fifth, the cold-sensitive phenotype in PACAP-null mice suggested that the thyroid axis also might be affected because we observed a significant reduction in expression of hypothalamic TRH mRNA and deiodinase mRNA in brown fat and a decrease in activity of deiodinase type 2 in brain of PACAP-null mice vs. controls. Our results suggest that the central regulation of core body temperature is a primary defect in mice lacking PACAP, rather than a disruption in the regulation of food intake or activity.

Another study examined feeding in PACAP-null mice and observed reduced food intake if fed a high-carbohydrate (63% kcal) diet, but the same intake as control mice if fed a high-fat diet (34). Although our results confirm the high-fat study, we did not find food intake differences in PACAP-null mice fed a standard chow diet that contains 70% kcal as carbohydrate. Although we did not observe any changes in food intake in the PACAP-null mice, we did identify that PACAP-null mice fed regular chow and housed at 21 C were leaner than wild-type controls. The reduced body mass was due entirely to a reduction in body fat, because their lean mass matched that of the wild-type mice. However, the reduction in fat mass did not result in altered expression of genes associated with lipogenic or adipogenic processes in WAT of PACAP-null mice compared with wild-type controls.

Because energy consumption in PACAP-null mice was equivalent to wild-type mice, a reduction of fat mass in these mice suggests that energy expenditure was increased. Continuous metabolic analysis (72 h) of the PACAP-null mice did not reveal significant differences in oxygen consumption or in the type of substrate used (respiratory exchange ratio) compared with wild-type controls. Although average activity levels in the dark and light phase were not significantly different between the genotypes, observation of the recording trace over the 72-h period revealed a tendency for increased activity of PACAP-null mice during the dark phase compared with wild-type control mice, but this is not mirrored in the oxygen consumption trace. Previous studies in the PACAP-null mice would not predict an increase in adaptive thermogenesis, because PACAP-null pups have been shown to be cold sensitive and have reduced norepinephrine in iBAT (19). The β-adrenergic receptors of the sympathetic nervous system mediate adaptive thermogenesis by triggering an increase in UCP1 in brown fat to produce heat rather than ATP (35). Here we used real-time PCR to show a quantitative reduction in UCP1 mRNA and normal expression of hormone-sensitive lipase mRNA in PACAP-null mice compared with wild-type mice. Despite a lack of significant data to demonstrate an increase in energy expenditure, the striking reduction in body fat across all adipose tissue depots suggests that the PACAP-null mice are either not able to effectively store lipid in adipose tissue or are using stored triglycerides at a higher rate than wild-type mice. The continuous monitoring system may not be sensitive enough to identify subtle increases in energy expenditure that, although undetectable, may impact on adiposity and body weight in PACAP-null mice over a prolonged period of time. Interestingly, the lean phenotype of PACAP-null mice is eliminated with high-fat feeding or housing at 28 C. This may be related to the cold-sensitive phenotype of the PACAP-null mice, which we show persists in adulthood, because adult PACAP-null mice are intolerant to an acute cold challenge.

We suggest that the loss of white fat in PACAP-null mice could be explained by an alternative method of generating heat in mice that are cold sensitive as described by Ukropec et al. (36). These authors found that if cold-sensitive UCP1-null mice were adapted slowly to 4 C, the mice could activate white fat to produce thermogenic activity as shown by changes in Ca2+ cycling, oxygen consumption, and fatty acid oxidation. Similar to the Ukropec study, our mice did not show a significant increase in oxygen consumption at 20–21 C or in muscle parameters and yet showed a reduction in white fat mass. Only at 12 C and lower could a change in oxygen consumption be detected using similar equipment (CLAMS) to ours. This phenomenon also could explain why we found a normal mass of white fat in PACAP-null mice maintained at 28 C, because mice would not need to induce thermogenesis at the near thermoneutral temperature of 28 C. The reduced level of leptin in our PACAP-null mice maintained at 21 C may also be a contributing factor to our phenotype (37).

Cold sensitivity also could be related to alterations in the thyroid axis. PACAP neurons have been shown to be associated with TRH neurons in the hypothalamic paraventricular nucleus and could influence TRH secretion (38,39). Here we show that hypothalamic neurons with a large amount of RNA do not express the PAC1 receptor, although many cells that are PAC1 receptor immunoreactive express a low level of TRH. Recently, a connection between hypothalamic D2 activity and T3 signaling in the arcuate nucleus, a hypothalamic region known to express PACAP, has been made (38,40). D2 activity in the PACAP-null brain after cold challenge is significantly lower compared with wild-type mice. Given that D2 is a substantial source of brain T3 (41), lower D2 activity is likely to result in a lower level of active T3 in the brain. In cold exposure, the reduction in D2/T3 in the brain reduces the negative feedback on TRH, allowing a continuous drive of the thyroid axis during the cold (33). However, a reduction of local T3 and metabolism in the area of the brain (preoptic area and anterior hypothalamus) that is associated with the thermostat might affect the central perception of body core temperature and sensitivity to cold.

Thermogenesis includes both nonshivering and shivering components. Shivering could account for the lean phenotype of the PACAP-null mice and would not necessarily be detected by the CLAMS. To address this issue, we measured oxidative gene expression in skeletal muscle and observed behavioral responses to the acute cold challenge. We did not observe significant changes in the expression of oxidative genes in skeletal muscle, which might be expected to be increased in a hyperactive muscle associated with increased shivering. Additionally, although PACAP-null mice were not able to maintain core temperature as wild-type mice in an acute cold challenge, we did not observe any obvious behavioral abnormalities in PACAP-null mice during the cold challenge that followed similar behavior patterns as wild-type controls in response to cold, including huddling, fur erection, and reduced exploring. Finally, there was no difference in lean mass of PACAP-null mice housed at 21 C to suggest a reduced capacity for compensatory increases in shivering thermogenesis.

A final question is the relationship between the enhanced insulin sensitivity and decreased body weight and adiposity in PACAP-null mice in the present study. Previously, another PACAP-null mouse line has been shown to have enhanced insulin sensitivity due to a lack of induced catecholamine response to hypoglycemia (6). Additionally, other mouse models with targeted disruption of either the PAC1 or VPAC2 receptor have increased insulin sensitivity (18,42,43,44). In our study, PACAP-null mice demonstrated a striking reduction in blood glucose levels in response to insulin in both the chow-fed and high-fat-fed groups. However, a combination of warm housing temperature and high-fat diet eliminated the insulin-sensitive phenotype. These results suggest that the basis of excessive hypoglycemia in response to exogenous insulin is not reduced body mass because regardless of normal or reduced weight, insulin injections caused severe hypoglycemia in PACAP-null mice. These data support the previous observations that PACAP-null mice cannot increase endogenous glucose production appropriately, likely due to a primary defect in catecholamine or glucagon response to hypoglycemia (6). One possibility is that a high ambient temperature combined with a high-fat diet provided the necessary warmth and fat stores such that the sympathetic nervous system did not need to be activated; hence, the catecholamines and glycogen reserves were not challenged.

Characterization of PACAP and PACAP receptor knockout mice has provided insights into the physiological roles of PACAP, which are clearly widespread and complex. Several studies using PACAP-null mice have demonstrated that a lack of PACAP results in abnormalities of metabolic homeostasis, and this is likely mediated by disruption of neuronal PACAP. The presence of PACAP neurons in hypothalamic nuclei known to be involved in the regulation of energy balance suggests that PACAP could be involved in these processes. In addition to energy intake and expenditure, the hypothalamus also regulates many functions including temperature, activity, water balance, and neuroendocrine factors that affect the pituitary gland.

Our results suggest that although PACAP is not necessary to regulate appetite and normal energy intake, PACAP is clearly required for normal energy homeostasis, likely in the central regulation of temperature.

Acknowledgments

We thank the exceptional efforts of the animal care staff at the University of Victoria for accommodating the high-temperature studies. Additionally, we thank Alan Graham and Julie Gentry for their help with importing animals, Martin Dale for his exceptional technical assistance, and Drs. S. Shioda and T. Nakamachi for providing PAC1-receptor antibodies.

Footnotes

This work was supported by a grant from the Canadian Institutes of Health Research to N.M.S. and a Doctoral Research Award to B.A.A., a grant from Diabetes UK to A.J.V.-P. and S.L.G., and funding from HEPADIP FP6 (LSHM-CT2005-018734) to A.J.V.-P.

Current address of S.L.G.: Northern Medical Program, University of Northern British Columbia, Prince George, British Columbia, Canada V2N 4Z9.

Disclosure Statement: The authors have nothing to disclose.

First Published Online December 27, 2007

Abbreviations: BAT, Brown adipose tissue; CLAMS, continuous laboratory animal monitoring system; D1 and D2, type 1 and type 2 deiodinase; DEXA, dual-energy x-ray absorptiometry; gWAT, gonadal WAT; iBAT, interscapular BAT; PACAP, pituitary adenylate cyclase-activating polypeptide; PFA, paraformaldehyde; WAT, white adipose tissue.

References

  1. Miyata A, Arimura A, Dahl RR, Minamino N, Uehara A, Jiang L, Culler MD, Coy DH 1989 Isolation of a novel 38-residue hypothalamic polypeptide which stimulates adenylate cyclase in pituitary cells. Biochem Biophys Res Commun 164:567–574 [DOI] [PubMed] [Google Scholar]
  2. Miyata A, Jiang L, Dahl RD, Kitada C, Kubo K, Fujino M, Minamino N, Arimura A 1990 Isolation of a neuropeptide corresponding to the N-terminal 27 residues of the pituitary adenylate cyclase activating polypeptide with 38 residues (PACAP38). Biochem Biophys Res Commun 170:643–648 [DOI] [PubMed] [Google Scholar]
  3. Harmar AJ, Arimura A, Gozes I, Journot L, Laburthe M, Pisegna JR, Rawlings SR, Robberecht P, Said SI, Sreedharan SP, Wank SA, Waschek JA 1998 International Union of Pharmacology. XVIII. Nomenclature of receptors for vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide. Pharmacol Rev 50:265–270 [PMC free article] [PubMed] [Google Scholar]
  4. Laburthe M, Couvineau A, Nicole P 2003 Molecular pharmacology and structure-function analysis of PACAP/VIP receptors. In: Vaudry H, Arimura A, eds. Pituitary adenylate cyclase-activating polypeptide. New York, NY: Kluwer Academic Publishers; 69–93 [Google Scholar]
  5. Filipsson K, Kvist-Reimer M, Ahren B 2001 The neuropeptide pituitary adenylate cyclase-activating polypeptide and islet function. Diabetes 50:1959–1969 [DOI] [PubMed] [Google Scholar]
  6. Hamelink C, Tjurmina O, Damadzic R, Young WS, Weihe E, Lee HW, Eiden LE 2002 Pituitary adenylate cyclase-activating polypeptide is a sympathoadrenal neurotransmitter involved in catecholamine regulation and glucohomeostasis. Proc Natl Acad Sci USA 99:461–466 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Nussdorfer GG, Malendowicz LK 1998 Role of VIP, PACAP, and related peptides in the regulation of the hypothalamo-pituitary-adrenal axis. Peptides 19:1443–1467 [DOI] [PubMed] [Google Scholar]
  8. Murakami Y, Koshimura K, Yamauchi K, Nishiki M, Tanaka J, Kato Y 2001 Roles and mechanisms of action of pituitary adenylate cyclase-activating polypeptide (PACAP) in growth hormone and prolactin secretion. Endocr J 48:123–132 [DOI] [PubMed] [Google Scholar]
  9. Absood A, Chen D, Wang ZY, Hakanson R 1992 Vascular effects of pituitary adenylate cyclase activating peptide: a comparison with vasoactive intestinal peptide. Regul Peptides 40:323–329 [DOI] [PubMed] [Google Scholar]
  10. Freson K, Hashimoto H, Thys C, Wittevrongel C, Danloy S, Morita Y, Shintani N, Tomiyama Y, Vermylen J, Hoylaerts MF, Baba A, Van Geet C 2004 The pituitary adenylate cyclase-activating polypeptide is a physiological inhibitor of platelet activation. J Clin Invest 113:905–912 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Mercer A, Ronnholm H, Holmberg J, Lundh H, Heidrich J, Zachrisson O, Ossoinak A, Frisen J, Patrone C 2004 PACAP promotes neural stem cell proliferation in adult mouse brain. J Neurosci Res 76:205–215 [DOI] [PubMed] [Google Scholar]
  12. Nishimoto M, Furuta A, Aoki S, Kudo Y, Miyakawa H, Wada K 2007 PACAP/PAC1 autocrine system promotes proliferation and astrogenesis in neural progenitor cells. Glia 55:317–327 [DOI] [PubMed] [Google Scholar]
  13. Sherwood NM, Gray SL, Cummings KJ 2003 Consequences of PACAP gene knockout. In: Vaudry H, Arimura A, eds. Pituitary adenylate cyclase-activating polypeptide. New York, NY: Kluwer Academic Publishers; 347–360 [Google Scholar]
  14. Hashimoto H, Shntani N, Tanaka K, Mori W, Irose M, Matsuda T, Sakaue M, Miyazaki J, Niwa H, Tashiro F, Yamamoto K, Koga K, Tomimoto S, Kunugi A, Suetake S, Baba A 2001 Altered psychomotor behaviors in mice lacking pituitary adenylate cyclase-activating polypeptide (PACAP). Proc Natl Acad Sci USA 98:13355–13360 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Otto C, Martin M, Wolfer DP, Kipp HP, Maldonado R, Schutz G 2001 Altered emotional behavior in PACAP-type-I-receptor-deficient mice. Mol Brain Res 92:78–84 [DOI] [PubMed] [Google Scholar]
  16. Gray SL, Cummings KJ, Jirik FR, Sherwood NM 2001 Targeted disruption of the pituitary adenylate cyclase-activating polypeptide gene results in early postnatal death associated with dysfunction of lipid and carbohydrate metabolism. Mol Endocrinol 15:1739–1747 [DOI] [PubMed] [Google Scholar]
  17. Zigman JM, Elmquist JK 2003 From anorexia to obesity: the yin and yang of body weight control. Endocrinology 144:3749–3756 [DOI] [PubMed] [Google Scholar]
  18. Brabet P, Jamen F, Rodriguez-Henche N, Bertrand G, Bockaert J 2003 PACAP receptor knockout and transgenics: What have we learnt? In: Vaudry H, Arimura A, eds. Pituitary adenylate cyclase-activating polypeptide. New York, NY: Kluwer Academic Publishers; 321–346 [Google Scholar]
  19. Gray SL, Yamaguchi N, Vencová P, Sherwood NM 2002 Temperature-sensitive phenotype in mice lacking pituitary adenylate cyclase-activating polypeptide. Endocrinology 143:3946–3954 [DOI] [PubMed] [Google Scholar]
  20. Yada T, Sakurada M, Filipsson K, Kikuchi M, Ahren B 2000 Intraperitoneal PACAP administration decreases blood glucose in GK rats, and in normal and high fat diet mice. Ann NY Acad Sci 921:259–263 [DOI] [PubMed] [Google Scholar]
  21. Yada T, Nakata M, Shioda S 2000 Insulinotropin PACAP potentiates insulin action. Stimulation of glucose uptake in 3T3-LI adipocytes. Ann NY Acad Sci 921:473–477 [DOI] [PubMed] [Google Scholar]
  22. Gu HF 2002 Genetic variation screening and association studies of the adenylate cyclase activating polypeptide 1 (ADCYAP1) gene in patients with type 2 diabetes. Hum Mutat 19:572–573 [DOI] [PubMed] [Google Scholar]
  23. Segal JP, Stallings NR, Lee CE, Zhao L, Socci N, Viale A, Harris TM, Soares MB, Childs G, Elmquist JK, Parker KL, Friedman JM 2005 Use of laser-capture microdissection for the identification of marker genes for the ventromedial hypothalamic nucleus. J Neurosci 25:4181–4188 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Morley JE, Horowitz M, Morley PM, Flood JF 1992 Pituitary adenylate cyclase activating polypeptide (PACAP) reduces food intake in mice. Peptides 13:1133–1135 [DOI] [PubMed] [Google Scholar]
  25. Chance WT, Thompson H, Thomas I, Fischer JE 1995 Anorectic and neurochemical effects of pituitary adenylate cyclase activating polypeptide in rats. Peptides 16:1511–1516 [DOI] [PubMed] [Google Scholar]
  26. Mizuno Y, Kondo K, Terashima Y, Arima H, Murase T, Oiso Y 1998 Anorectic effect of pituitary adenylate cyclase activating polypeptide (PACAP) in rats: lack of evidence for involvement of hypothalamic neuropeptide gene expression. J Neuroendocrinol 10:611–616 [DOI] [PubMed] [Google Scholar]
  27. Tachibana T, Tomonaga S, Oikawa D, Saito S, Takagi T, Saito ES, Boswell T, Furuse M 2003 Pituitary adenylate cyclase activating polypeptide and vasoactive intestinal peptide inhibit feeding in the chick brain by different mechanisms. Neurosci Lett 348:25–28 [DOI] [PubMed] [Google Scholar]
  28. Tachibana T, Saito S, Tomonaga S, Takagi T, Saito ES, Boswell T, Furuse M 2003 Intracerebroventricular injection of vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide inhibits feeding in chicks. Neurosci Lett 339:203–206 [DOI] [PubMed] [Google Scholar]
  29. Matsuda K, Maruyama K, Nakamachi T, Miura T, Shioda S 2006 Effects of pituitary adenylate cyclase-activating polypeptide and vasoactive intestinal polypeptide on food intake and locomotor activity in the goldfish, Carassius auratus. Ann NY Acad Sci 1070:417–421 [DOI] [PubMed] [Google Scholar]
  30. Tachibana T, Saito ES, Takahashi H, Saito S, Tomonaga S, Boswell T, Furuse M 2004 Anorexigenic effects of pituitary adenylate cyclase-activating polypeptide and vasoactive intestinal peptide in the chick brain are mediated by corticotrophin-releasing factor. Regul Peptides 120:99–105 [DOI] [PubMed] [Google Scholar]
  31. Christoffolete MA, Ribeiro R, Singru P, Fekete C, da Silva WS, Gordon DF, Huang SA, Crescenzi A, Harney JW, Ridgway EC, Larsen PR, Lechan RM, Bianco AC 2006 Atypical expression of type 2 iodothyronine deiodinase in thyrotrophs explains the thyroxine-mediated pituitary thyrotropin feedback mechanism. Endocrinology 147:1735–1743 [DOI] [PubMed] [Google Scholar]
  32. Matsuno R, Ohtaki H, Nakamachi T, Watanabe J, Yofu S, Hayashi D, Takeda T, Nonaka N, Seki M, Nakamura M, Itabashi K, Shioda S 2007 Distribution and localization of pituitary adenylate cyclase-activating polypeptide-specific receptor (PAC1R) in the rostral migratory stream of the infant mouse brain. Regul Peptides 145:80–87 [DOI] [PubMed] [Google Scholar]
  33. Fekete C, Lechan RM 2007 Negative feedback regulation of hypophysiotropic thyrotropin-releasing hormone (TRH) synthesizing neurons: role of neuronal afferents and type 2 deiodinase. Front Neuroendocrinol 28:97–114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Nakata M, Kohno D, Shintani N, Nemoto Y, Hashimoto H, Baba A, Yada T 2004 PACAP deficient mice display reduced carbohydrate intake and PACAP activates NPY-containing neurons in the rat hypothalamic arcuate nucleus. Neurosci Lett 370:252–256 [DOI] [PubMed] [Google Scholar]
  35. Bachman ES, Dhillon H, Zhang C-Y, Cinti S, Bianco AC, Kobilka BK, Lowell BB 2002 βAR signaling required for diet-induced thermogenesis and obesity resistance. Science 297:843–845 [DOI] [PubMed] [Google Scholar]
  36. Ukropec J, Anunciado RP, Ravussin Y, Hulver MW, Kozak LP 2006 UCP1-independent thermogenesis in white adipose tissue of cold-acclimated Ucp1−/− mice. J Biol Chem 281:31894–31908 [DOI] [PubMed] [Google Scholar]
  37. Ukropec J, Anunciado RV, Ravussin Y, Kozak LP 2006 Leptin is required for uncoupling protein-1-independent thermogenesis during cold stress. Endocrinology 147:2468–2480 [DOI] [PubMed] [Google Scholar]
  38. Legradi G, Hannibal J, Lechan RM 1997 Association between pituitary adenylate cyclase-activating polypeptide and thyrotropin-releasing hormone in the rat hypothalamus. J Chem Neuroanat 13:265–279 [DOI] [PubMed] [Google Scholar]
  39. Das M, Vihlen CS, Legradi G 2007 Hypothalamic and brainstem sources of pituitary adenylate cyclase-activating polypeptide nerve fibers innervating the hypothalamic paraventricular nucleus in the rat. J Comp Neurol 500:761–776 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Coppola A, Liu Z-W, Andrews ZB, Paradis E, Roy M-C, Friedman JM, Ricquier D, Richard D, Horvath TL, Gao XB, Diano S 2007 A central thermogenic-like mechanism in feeding regulation: an interplay between arcuate nucleus T3 and UCP2. Cell Metab 5:21–33 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Crantz FR, Silva JE, Larsen PR 1982 An analysis of the sources and quantity of 3,5,3′-triiodothyronine specifically bound to nuclear receptors in rat cerebral cortex and cerebellum. Endocrinology 110:367–375 [DOI] [PubMed] [Google Scholar]
  42. Asnicar MA, Koster A, Heiman ML, Tinsley F, Smith DP, Galbreath E, Fox N, Ma YL, Blum WF, Hsiung HM 2002 Vasoactive intestinal polypeptide/pituitary adenylate cyclase-activating peptide receptor 2 deficiency in mice results in growth retardation and increased basal metabolic rate. Endocrinology 143:3994–4006 [DOI] [PubMed] [Google Scholar]
  43. Persson K, Ahren B 2002 The neuropeptide PACAP contributes to the glucagon response to insulin-induced hypoglycaemia in mice. Acta Physiol Scand 175:25–28 [DOI] [PubMed] [Google Scholar]
  44. Jamen F, Persson K, Bertrand G, Rodriguez-Henche N, Puech R, Bockaert J, Ahren B, Brabet P 2000 PAC1 receptor-deficient mice display impaired insulinotropic response to glucose and reduced glucose tolerance. J Clin Invest 105:1307–1315 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES