Abstract
The effect of the lack of vestibular input on the membrane properties of central vestibular neurons was studied by using a strain of transgenic, vestibular-deficient mutant KCNE1−/− mice where the hair cells of the inner ear degenerate just after birth. Despite the absence of sensory vestibular input, their central vestibular pathways are intact. Juvenile and adult homozygous mutant have a normal resting posture, but show a constant head bobbing behaviour and display the shaker/waltzer phenotype characterized by rapid bilateral circling during locomotion. In juvenile mice, the KCNE1 mutation was associated with a strong decrease in the expression of the calcium-binding proteins calbindin, calretinin and parvalbumin within the medial vestibular nucleus (MVN) and important modifications of the membrane properties of MVN neurons. In adult mice, however, there was almost no difference between the membrane properties of MVN neurons of homozygous and control or heterozygous mutant mice, which have normal inner ear hair cells and show no behavioural symptoms. The expression levels of calbindin and calretinin were lower in adult homozygous mutant animals, but the amount of calcium-binding proteins expressed in the MVN was much greater than in juvenile mice. These data demonstrate that suppression of sensory vestibular inputs during a ‘sensitive period’ around birth can generate the circling/waltzing behaviour, but that this behaviour is not due to persistent abnormalities of the membrane properties of central vestibular neurons. Altogether, maturation of the membrane properties of central vestibular neurons is delayed, but not impaired by the absence of sensory vestibular information.
A central problem in the development of sensorimotor neural circuitry is the extent to which sensory information is involved in shaping the membrane properties of their target neurons in the central nervous system. To address that question, we used a particular strain of transgenic, vestibular-deficient mutant KCNE1−/− mice, which were obtained by Vetter et al. (1996) from the 129/Sv strain. These animals, which were proposed as a model of the Jervell and Lange–Nielsen syndromes described in humans (Rivas & Francis, 2005), have a null mutation of the KCNE1 potassium channel gene that leads to the degeneration of all hair cells of the inner ear just after birth, while sparing the central nervous system (Warth & Barhanin, 2002). As a result, KCNE1−/− homozygous mutant mice are deaf and their vestibular sensors cannot encode head movements; however, their central vestibular pathways are intact. In particular, the vestibular nerve fibres and cells in Scarpa's ganglion exhibit no sign of degeneration (Vidal et al. 2004). Contrary to control mice, adult KCNE1−/− mutant mice display neither ocular nystagmus nor any static postural syndrome following unilateral labyrinthectomy (Vidal et al. 2004). This result strongly suggests that the normal spontaneous discharge of afferent vestibular axons is absent in adult KCNE1−/− mice because labyrinthectomy would have interrupted this tonic activity and produced oculomotor and postural asymmetry.
As observed in adult rodents after a bilateral labyrinthectomy (De Waele et al. 1989), the homozygous KCNE1−/− mutants have a normal resting posture, but show quasi-constant head bobbing behaviour and drown when dropped into water (Vidal et al. 2004). In addition, contrary to bi-labyrinthectomized animals where the vestibular input and spontaneous discharge of afferent vestibular fibres are suppressed in adulthood, KCNE1−/− homozygous mice display a permanent shaker/waltzer phenotype, characterized by rapid bilateral circling (up to 1000 deg s−1) and a waltzing behaviour. This suggests that it is only during a ‘sensitive period’ around birth that suppression of sensory vestibular signal induces the shaker/waltzer behaviour in rodents (see Vidal et al. 2004, for discussion), and opens the question of whether abnormalities of the vestibular networks are responsible for the circling. Contrary to homozygous mice, the KCNE1+/− heterozygous mice have normal inner ear hair cells and show no behavioural symptoms (Vetter et al. 1996; Warth & Barhanin, 2002; Vidal et al. 2004), and therefore were used as controls. Altogether, this mutant offers a convenient model to investigate the effect of a congenital suppression of vestibular input on the maturation and maintenance of the membrane properties of central vestibular neurons. Central vestibular neurons play a major role in the processing of head and body, motion-related multisensory signals, which they use to generate motor commands for gaze and posture control. The membrane and pharmacological properties of central vestibular neurons in vertebrates have been recently reviewed (Straka et al. 2005). The neurons of the medial vestibular nucleus (MVN), which are mainly involved in gaze and posture control in the horizontal plane, can be categorized into two major subtypes (type A and type B neurons) in rodents according to their action potential profiles, after-hyperpolarizations (AHP) and interspike intervals. Type A MVN neurons exhibit a single, deep AHP followed by an inflection that delays the depolarization of the neuron and is due to a rectifying IA-like K+ current activated when the neuron is released from hyperpolarization. In contrast, type B MVN neurons show a double component AHP, i.e. an initial, fast AHP followed by a delayed, slow one. Adult guinea pig MVN neurons show about equal proportions of type A and B neurons (Beraneck et al. 2003). However, rat MVN neurons subdivide into about 1/3 of type A and 2/3 of type B neurons (Johnston et al. 1994; Him & Dutia, 2001) and sub-adult mice aged 30 days have a distribution of about 70–80% type B neurons and 20–30% type A neurons (Dutia & Johnston, 1998; Camp et al. 2006).
This classification mainly reflects differences in the K+ conductances expressed by the two subtypes (Gallagher et al. 1985; Serafin et al. 1991a, 1991b; Johnston et al. 1994; Dutia & Johnston, 1998). TEA-sensitive K+ currents, presumably the voltage-gated channel IK, play a key role in the repolarization of the action potential and generation of the fast component of the AHP in both type A and B MVN neurons. The subsequent large, monophasic AHP of type A neurons is mainly shaped by voltage- and Ca2+-dependent K+ channels of the BK subtype. The slow component of the double AHP of type B neurons disappears in calcium-free solution or after bath-application of apamin, suggesting that this is due to the SK type of Ca2+-dependent K+ channels. In addition, an IA-like K+ current is also modulated by Ca2+-dependent intracellular mechanisms (reviewed in Jerng et al. 2004). Altogether the amplitude and shape of the AHP and interspike intervals of MVN neurons, which determine their response dynamics (Beraneck et al. 2003), strongly depend on the intracellular free Ca2+ concentration.
Several ubiquitous calcium-binding proteins (CaBPs) regulate the intracellular free Ca2+ concentration in neurons. They include three members of the EF-hand family of CaBPs, calbindin-D28k (CB), calretinin (CR) and parvalbumin (PV), which strongly influence neuronal excitability (Schwaller et al. 2002; Gall et al. 2003; Roussel et al. 2006). CB, CR and PV act as passive buffers that limit increases in intracellular Ca2+ concentration. A large number of immunohistochemical studies have demonstrated that CB, CR and PV are expressed in the vestibular nuclei of mammals including rat, guinea pig, gerbil, cat and monkey (Sans et al. 1995; Kevetter, 1996; Baurle et al. 1997; Kevetter & Leonard, 1997; Puyal et al. 2002; Baizer & Baker, 2005, 2006). However, to our knowledge, only one study of PV expression exists for the mouse (Baurle et al. 1997).
Recently, we and others demonstrated that vestibular compensation following unilateral labyrinthectomy, which suppresses vestibular input and the spontaneous discharge of afferent vestibular fibres on the lesioned side, led to changes in the membrane properties of the deafferented MVN neurons in adult animals (Him & Dutia, 2001; Beraneck et al. 2003; reviewed in Straka et al. 2005). One month after unilateral labyrinthectomy in the guinea pig, the proportion of type A MVN neurons increases on the lesioned side (Beraneck et al. 2003) and decreases on the opposite side (Beraneck et al. 2004). In addition, unilateral labyrinthectomy triggers a long-term decrease of the number of CR-expressing MVN neurons on the lesioned side (Sans et al. 1995), that would be associated with an increase of intracellular Ca2+ concentration in MVN neurons (Masumura et al. 2007). Similarly, cochlear removal increases the free intracellular Ca2+ concentration of central cochlear neurons in embryonic chicken (Zirpel et al. 1995). This suggests that the modifications of the membrane properties of MVN neurons triggered by labyrinthectomy could be due to the impairment of their Ca2+ homeostasis induced by a decreased expression of CaBPs. Thus, it seems likely that the congenital absence of both the vestibular input and spontaneous discharge of afferent vestibular nerve fibres in homozygous KCNE1 mutant mice can provoke similar long-term changes in the membrane properties of developing central vestibular neurons.
In order to test that hypothesis, the resting membrane properties of MVN neurons were analysed in brainstem slices of juvenile KCNE1−/− and KCNE1+/− transgenic mice using whole-cell patch-clamp recordings. Single-cell RT-PCR of the mRNAs coding for CB, CR or PV was done on the cytoplasm of some of the recorded neurons. In the mouse MVN, the biophysical membrane properties of neurons develop gradually over the first weeks of life (Dutia & Johnston, 1998) concomitantly with oculomotor control (Faulstich et al. 2004) and are not mature until at least 30 days after birth. Therefore, intracellular recordings of MVN neurons were also done on brainstem slices taken from fully adult, 2- to 9-month-old homozygous and heterozygous KCNE1 mutant mice using sharp electrodes. This study verified that any abnormality of the membrane properties of MVN neurons that might characterize juvenile homozygous mutant mice persisted in adult animals. In addition, in order to evaluate whether changes in the intracellular Ca2+ concentration were sufficient to modify the membrane properties of MVN neurons, some of the patch-clamp recordings were performed while increasing the Ca2+ buffering properties of the intracellular solution of the patch pipette. Finally, we compared the expression of the CB, CR and PV proteins in MVN of juvenile and adult, homozygous and heterozygous KCNE1 transgenic mice using immunohistochemical methods.
Methods
The transgenic KCNE1 mutant mice were initially obtained by Vetter et al. (1996) from the 129/Sv strain. Following an initial gift of some of these mutant mice by Jacques Barhanin (Institut de Pharmacologie Moléculaire et Cellulaire, CNRS UMR 6097, Valbonne, France), a strain of KCNE1 mice has been maintained at the animal facility of the UFR Biomédicale des Saints-Pères (Université Paris Descartes, Paris, France) since 2000. The wild-type mice were ordered from Centre d'Elevage Roger Janvier (Le Genest Saint Isle, France). Mice of both sex were used randomly in this study.
As described above, the KCNE1−/− homozygous mutant mice are identified by their abnormal behaviour as early as 7 days of age (Vidal et al. 2004), while the KCNE1+/− heterozygous mutant mice show no behavioural symptoms. The close correlation between this phenotype and KCNE1−/− genotype was confirmed by genomic PCR experiments performed with DNA extracted from the tail of sixteen mutant mice. PCR amplification of the fragments of DNA (Scharf et al. 1986) corresponding to the KCNE1 gene was performed using both forward (AGGAAGTGTGTGGCAG) and reverse (TGACTCGATGTACACGTTG) primers. Amplification was obtained for KCNE1+/− heterozygous mutant mice, but not for KCNE1−/− homozygous mutant mice (not shown).
Electrophysiological experiments
The MVN neurons of mutant mice were recorded first using the whole-cell patch-clamp technique on brainstem slices taken from KCNE1−/− and KCNE1+/− juvenile mice (16 to 23 days old), with some juvenile wild-type mice of the Swiss strain used as an additional control. Two types of internal solution were used to fill the patch-clamp pipette: a control one containing 0.1 mm EGTA, and a modified solution where EGTA was replaced by 1 mm BAPTA. Replacement of the usual, low concentration of the Ca2+ buffer EGTA used in most studies of mouse MVN neurons (Sekirnjak & du Lac, 2006) by a 10-times higher concentration of the fast Ca2+ buffer BAPTA was aimed at limiting the intracellular concentration of Ca2+ and increasing its homeostasis (Gall et al. 2003; Roussel et al. 2006) in order to assess consequences on the membrane properties of MVN neurons.
A second set of MVN neurons were recorded extracellularly and/or intracellularly using sharp microelectrodes on slices taken from KCNE1−/− and KCNE1+/− adult mutant mice (2 to 9 months old), with adult wild-type mice used as an additional control. In both cases, MVN neurons were recorded on coronal brainstem slices, using the border of the IVth ventricle as a landmark as in previous studies (Beraneck et al. 2003). All efforts were made to minimize animal suffering as well as the number of animals used. All experiments followed the guidelines on the ethical use of animals from the European Communities Council Directive of 24 November 1986 (86/609/EEC).
Slice preparation and maintenance
For both juvenile and adult mice, the viability of brainstem slices was increased by using a low-calcium ACSF depleted of sodium chloride and loaded with sucrose during the slice preparation procedure (see Uno et al. 2003). The mice were decapitated under deep anaesthesia with pentobarbital (100 mg kg−1). The brain was quickly removed and placed in ice-cold, phosphate/bicarbonate-buffered artificial cerebro-spinal fluid (ACSF), which included (mm): 225 sucrose, 5 KCl, 1 NaH2PO4, 26 NaHCO3, 0.25 CaCl2, 1.3 MgCl2, 11 glucose and was bubbled with 95% O2–5% CO2 (pH 7.4). This sucrose-loaded ACSF was used up to the moment the slices were transferred to the incubating chamber.
For patch-clamp recordings in juvenile mice, four or five 220–250 μm thick, coronal slices containing the MVN were cut from the brainstem with a microslicer (Leica, Rueil-Malmaison, France) and transferred into an incubating vial maintained at 32–34°C and filled with a regular ACSF containing (mm): 124 NaCl, 5 KCl, 1 NaH2PO4, 26 NaHCO3, 2.5 CaCl2, 1.3 MgCl2, 11 glucose and bubbled with 95% O2 and 5% CO2 (pH = 7.4). Slices were then placed one at a time in the recording chamber maintained at 32–34°C, where the slice was superfused with regular ACSF at a constant flow rate of 3 ml min−1.
For sharp electrode recordings in adult mice, two to four 400 μm thick coronal slices containing the MVN were cut with a vibrating microtome (Campden Instruments Ldt, Loughborough, UK) and transferred for 45–60 min in an incubating chamber maintained at 35°C containing the same oxygenated, regular ACSF as above. All slices were then transferred into individually bubbled vials kept at room temperature before to be placed one at a time in the recording chamber. Recordings were performed at 32–33°C, while the slice was perfused with the regular ACSF at a constant flow rate of 3 ml min−1.
Electrophysiological recordings
For whole-cell patch-clamp recordings, pipettes were pulled from borosilicate glass tubing to a resistance of 5–7 MΩ. The control internal solution contained (mm): 140 potassium gluconate, 2 MgCl2, 10 Hepes, 0.1 EGTA, 4 Na2ATP, 0.4 Na2GTP (adjusted to pH 7.3 with KOH). In some experiments, the control calcium buffer EGTA (0.1 mm) was replaced with 1 mm BAPTA. MVN neurons were visualized with a Nomarski optic microscope (Nikon, Champigny-sur-Marne, France) under infrared illumination. Recordings were made with an Axoclamp 2B amplifier (Axon Instruments, Union City, CA, USA). Electrode resistance was bridge balanced throughout experiments. Membrane potentials were corrected by subtracting a liquid junction potential of 16 mV. All MVN neurons that had resting membrane potential more negative than −50 mV and a spike amplitude > 45 mV were selected for further analysis.
Sharp electrode recordings in adult mice were performed using 3 m potassium acetate containing microelectrodes that had a resistance of 80–150 MΩ. Both extracellular and intracellular recordings could be obtained with these electrodes. In some cases, both types of recordings were actually obtained one after the other from the same MVN neuron. Recordings were done with an Axoclamp 2A system (Axon Instruments) in the bridge mode. Both series resistance (bridge balance) and capacitance compensation were checked throughout the recording of each neuron. For intracellular recordings, MVN neurons that had resting membrane potentials more negative than −50 mV (not corrected for a negligible junction potential, see Beraneck et al. 2003) and a spike amplitude > 45 mV were retained for further analysis. MVN neurons whose membrane potential ranged from −50 to −40 mV were also included in the sample as long as they did not show any sign of deterioration and displayed a normal spike width (i.e. < 1.5 ms at threshold).
Whatever the recording mode, the spontaneous discharge was recorded for 5–8 min once a stable level had been reached (i.e. with no holding current injected through the recording electrode). Passive membrane properties were then tested using hyperpolarizing current steps according to the protocol developed earlier for guinea pig MVN neurons (Beraneck et al. 2003). Data acquisition and hyperpolarizing current injections were performed with a PC-compatible computer, using scripts written under the MATLAB 7.0 software (The MathWorks, Natick, MA, USA). Recordings were low-pass filtered at 2 kHz and digitized at 5 kHz (BNC-2090 + PCI-6052E, National Instruments, Austin, TX, USA). Consequently, the amplitudes of the digitized spikes were slightly variable, but oscilloscope traces verified that the size of the action potential was constant at any given membrane potential.
Data analysis
Basic membrane and firing properties were determined at rest using analysis programs written with MATLAB 7.0. The extracellularly recorded MVN neurons were only characterized by their mean spontaneous firing rate (in spikes s−1) and its coefficient of variation (CV), expressed as the ratio between the standard deviation and the mean of the interspike intervals.
Identical scripts put together by Beraneck et al. (2003) were used to analyse adult guinea pig MVN neurons and both patch-clamp and sharp electrode recordings of mice MVN neurons. As most MVN neurons are spontaneously active on slices, the potential was low-pass filtered at 1 Hz to obtain an estimate of its average resting level that was taken as the ‘mean resting membrane potential’ (Vm, in mV) of each neuron. This membrane potential value was corrected by measuring and subtracting the extracellular voltage offset found after withdrawal of the electrode from each neuron. Averages of the spike shapes and following interspike interval profiles were tabulated as in Beraneck et al. (2003) and Uno et al. (2003) to get for each neuron the spontaneous firing rate (in spikes s−1) and associated coefficient of variation (CV), the amplitude of the after-hyperpolarization (AHP, in mV), the spike threshold potential (in mV), the width (in ms, at threshold), height (in mV) of the spike and the concavity and convexity (in mV) of the voltage trace during the interspike interval. In order to classify MVN neurons as type A or B neurons, the program also computed the first derivative of the variation of the averaged membrane potential to obtain two quantitative parameters that relate to the qualitative classification used by Serafin et al. (1991a), namely: (1) the ‘dAHP’, which estimates the size/strength (in V s−1) of the double after-hyperpolarization of type B neurons, and (2) the ‘IA’, which is a measure (in mV s−1 or V s−1) of the rectification of the potential between spikes possibly related to an inactivating potassium A-like current (Beraneck et al. 2003). In this paper as in Idoux et al. (2006), the ‘IA’ will be termed AHPR, after-hyperpolarization rectification, since it is a less ambiguous descriptive term to qualify the membrane potential rectification following the spike. The membrane capacitance (in pF) and passive input resistance (in MΩ) of each neuron were measured using series of hyperpolarizing steps of decreasing amplitude relative to a membrane potential that was hyperpolarized about 10 mV below the discharge threshold.
For each population of MVN neurons recorded in juvenile and adult mice, respectively, the quantitative criteria defined by Beraneck et al. (2003) to classify adult guinea pig MVN neurons in type A or B neurons were used with minor modifications as described below. According to the methodology described in that paper, the range and average values of the three parameters used to set the quantitative criteria for classification (i.e. the convexity of the voltage trace during the interspike interval and the respective strengths of the IA-like rectification and double AHP) were assessed separately for the MVN neurons of juvenile mice and adult mice and compared with the values obtained from adult guinea pig MVN neurons. As shown below in the Results section, this procedure allowed the use of the same quantitative criteria in the guinea pig and adult mice; however, the quantitative criteria used to classify an MVN neuron as a type A neuron had to be modified for juvenile mice.
Statistical analysis
The whole statistical analysis was performed with the Systat 8.0 software (Systat Software GmbH, Erkrath, Germany). All results were expressed as mean ± standard deviation (s.d.). Normality of the distribution of each neuron parameters' value was tested in each group of MVN neuron by a one-sample Kolmogorov–Smirnov test, with the usual significance threshold (P ≤ 0.05). When large enough samples with normal distribution were compared, parametric tests were done, namely ANOVA for multiple comparisons and Student's t tests for two-by-two comparisons; otherwise the corresponding non-parametric tests were preferred, namely Kruskal–Wallis ANOVA and Mann–Whitney U tests for two-by-two comparisons. In all cases, the significance threshold was set at P ≤ 0.05. We compared parameters' distributions between homozygous and heterozygous mutant animals among juvenile and adult mice, and between neuronal types (A and B) inside each group of animals. We also compared parameters' distributions between juvenile and adult mice, and for patch-clamp recordings in juvenile mice between the neurons recorded with EGTA and those recorded with BAPTA. Even when the distributions were not normal, the mean and s.d. are given instead of the median for consistency.
Single cell reverse transcriptase (RT)-multiplex polymerase chain reaction (mPCR)
RT-mPCR targeting the calcium-binding proteins (CaBPs) calbindin-D28k (CB), calretinin (CR) and parvalbumin (PV) was performed on the cytoplasm of 90 MVN neurons from juvenile homozygous and heterozygous KCNE1 mutant mice as described by Lambolez et al. (1995). Briefly, the neurons were recorded using the patch-clamp technique with an autoclaved internal solution containing (mm): 140 potassium gluconate, 2 MgCl2, 10 Hepes and 0.1 EGTA (adjusted to pH 7.3 with KOH). Once the spontaneous discharge had been recorded for 5–8 min to allow characterization of the neuronal type, the cytoplasm was aspirated into the patch pipette. The pipette content was expelled into a 0.5 ml tube containing 2 μl of a solution composed of dNTPs (2.5 mm), random hexamer (25 ng), Tris (10 mm), MgCl2 (6 mm) and RNase-free water (pH 8). The reverse transcriptase (RT) reaction was done in a final volume of 10 μl by adding 0.5 μl of DTT (20 mm), 0.5 μl of RNasin (20 U, Promega, Charbonnières, France) and 0.5 μl of Superscript Reverse Transcriptase III (Invitrogen, Cergy Pontoise, France), which was incubated at 37°C overnight. The two steps of mPCR amplification of the fragments of cDNA corresponding to CB, CR and PV were done using sets of forward and reverse primers specific to mouse RNA sequences (Table 1). None of the primers had the capacity to amplify genomic DNA.
Table 1.
PCR primers and restriction enzymes used
| mRNA | Primer position | Forward primer sequence Reverse primer sequence | PCR product size (pb) | Restriction enzyme | Position of site | Fragment size (pb) |
|---|---|---|---|---|---|---|
| Calbindin | 249 | AGGCGCGAAAGAAGGCTGGAT | 433 | EcoR1 | 173 | 260 |
| 680 | TCCCACACATTTTGATTCCCTG | 170 | ||||
| Calretinin | 157 | GCTGACGGAAATGGGTACAT* | 210 | Mbo1 | 183 | 180 |
| 367 | CAAGGAAATTCTCTTCGGTCGG* | |||||
| Parvalbumin | 171 | AAGAACCCGGATGAGGTGAAG* | 360 | EcoR1 | 187 | 190 |
| 531 | ATGGCGTCATCCGAGGGC* | 170 |
For each mRNA coding for the three calcium-binding proteins, the table gives the starting position of the primers in the sequence, the primer sequences (5′ to 3′), the size of the amplified product (in base pairs), the characteristic restriction enzymes used to check the specificity of the product, the position of the restriction enzyme cut site, and the size of the cut fragments (in base pairs). The compatibility of primers was assessed with the Oligo software. Note that the primers are specific for cDNA amplification and that no genomic DNA amplification was observed.
(Primers designed by Cordero-Erausquin et al. 2004).
In the first PCR, the cDNAs of the three CaBPs were amplified simultaneously in the whole sample obtained after the RT reaction. Taq polymerase (2.5 U, Quiagen, Courtaboeuf, France) and 5–20 pmol of each of the six primers were added in the buffer supplied by the manufacturer (final volume 100 μl), and 30 cycles of PCR (94°C for 1 min; 60°C for 1 min; 72°C for 1 min) were run. In the second step of the PCR, each targeted cDNA was amplified individually using its specific primer pair by performing 35 cycles as described above, using 1 μl of the solution obtained after the first PCR as template (final volume 25 μl). These PCR products were analysed on 2% agarose gels. Their predicted sizes were (in base pairs) 433 for CB, 210 for CR, and 360 for PV. The specificity of the amplification was studied by restriction enzyme analysis (see Table 1 and Fig. 3).
Figure 3.
Analysis of mPCR products A, example of agarose gel electrophoresis of the PCR products amplified from the cytoplasm of a single MVN neuron in which mRNAs encoding all three calcium-binding proteins were detected (CB calbindin, CR calretinin, PV parvalbumin). B, example of agarose gel electrophoresis of each product before (uncut) and after digestion by the specific restriction enzymes listed in Table 1. The PCR products were separated on 2% agarose gels and stained with ethidium bromide. In both A and B, the leftmost column shows bands corresponding to reference cDNAs of known lengths given by the number of base pairs (bp) they include.
Positive and negative controls were systematically included in each RT-mPCR session (not shown). The positive control was 1 ng total RNA extracted from the brain of a C57Bl6 12-day-old mouse (RNeasy Mini, Quiagen). The negative control was a sample of the extracellular solution aspirated through a new patch pipette at the end of each recording session. The content of this control pipette underwent the same RT-mPCR process as the cytoplasm of the recorded neurons. For each RT-mPCR session, any targeted cDNA that was not detected in the positive control or was detected in the negative control was excluded from analysis. Statistical analyses of the difference between the proportions of neurons where cDNAs corresponding to the three CaBPs were detected in each groups of mice were performed using χ2 tests.
Immunohistochemistry
Immunohistochemistry for the three CaBPs was performed on a set of five KCNE1+/− and five KCNE1−/− juvenile mutant mice (21 days), and on a sample of six adult (3 months) homozygous and heterozygous mutant mice (3 for each type). Animals were anaesthetized by an intraperitoneal injection of 15 μl g−1 of 3% chloral hydrate diluted in 0.9% NaCl solution, and perfused transcardially with a cold 0.9% NaCl solution followed by a cold fixative solution consisting of 4% paraformaldehyde in 0.15 m phosphate buffer (pH 7.4). The brainstem–cerebellum block was removed and post-fixed overnight in the same fixative solution. Coronal brainstem sections (16 μm thick) were then cut with a Leica cryostat.
The sections were washed thoroughly twice in Tris-buffered saline (TBS; 0.1 m Trizma base with 0.9% NaCl, pH 7.4) at room temperature, then pre-incubated for 2 h in TBS containing 1% Triton X-100 (TBS–TX) and 10% normal donkey serum (NDS) for CB and CR immunhistochemistry, or normal goat serum (NGS) for PV immunohistochemistry. Sections were then incubated 42 h at 4°C with one of each primary antibody prepared in TBS–TX containing 2% NDS or NGS: a monoclonal mouse anti-CB (ref. 300; dilution 1: 600; Swant, Bellinzona, Switzerland), a monoclonal mouse anti-CR (ref. 6B3; dilution 1: 500; Swant) or a polyclonal rabbit anti-PV (ref. PV-28; dilution 1: 400; Swant). After several washes with TBS containing 0.1% Tween 20 (TBS–TW), sections were saturated in the dark for 1 h at room temperature in TBS–TX containing 10% NDS or NGS. Then, sections were incubated in TBS–TX containing 2% NDS with Cy3 anti-mouse IgG (ref. 715-165-150; dilution, 1: 400; Jackson ImmunoResearch Europe, Newmarket, UK) for CB and CR immunohistochemistry, or TBS–TX containing 2% NGS with Cy3 anti-rabbit IgG (ref. 111-165-003; dilution 1: 400; Jackson ImmunoResearch Europe) for PV immunohistochemistry. After several washes with TBS–TW, sections were mounted on glass slides in Vectashield mounting medium (Vector Laboratories, Burlingame, CA, USA).
Two controls were performed (not shown): the first consisted of incubations without the primary antibodies and with one or the other of the secondary antibodies, and the second was to omit the secondary antibodies from the incubation medium, maintaining one or the other of the primary antibodies. No specific signal was ever detected.
Data analysis
Fluorescence in the MVN was measured under a microscope equipped with fluorescence illumination using a rhodamine filter set (Eclipse E800, Nikon) and ×40 optic. Sections were mapped on video images (coolSNAP camera) and digitized with a computerized image analysis system (Metamorph, Roper Scientific, Evry, France). For each section, the boundaries of the MVN were assessed at low magnification from the cresyl violet-counterstained sections. The intensity of the Cy3 signal was automatically quantified using the same conditions of exposure time and illumination for each CaBP in rectangular areas of about 30 000 μm2. Fluorescence intensity was corrected by subtracting blank value from fluorescence. The mean arithmetic fluorescence (AF ±s.d.) was calculated from a minimum of 12 sections taken on the two sides of the brainstem for each animal. The number of CR-immunostained neurons, identified by their nucleus, was also quantified.
Statistical analysis
Differences between the four groups of mice were assessed using non-parametric tests (SigmaStat, Systat Software GmbH). Kruskal–Wallis ANOVA was used first, followed by two-by-two comparisons using the Mann–Whitney U test. The threshold for statistical significance was set at P ≤ 0.05.
Results
Patch-clamp recordings of MVN neurons in juvenile mice
The data presented in this paragraph were obtained from a database of 149 MVN neurons recorded with either the EGTA-containing (control condition, 108 neurons) or BAPTA-containing intracellular solution (41 neurons). The MVN neurons recorded with EGTA included 30 neurons obtained from seventeen KCNE1−/− homozygous mutant mice (mean age ±s.d. 18 ± 3 days), 54 neurons from twenty-four KCNE1+/− heterozygous mutant mice (17 ± 2 days) and 24 neurons from fourteen wild-type mice of the Swiss strain (15 ± 3 days). The MVN neurons recorded with BAPTA included 22 neurons obtained from seven KCNE1−/− mice (18 ± 2 days) and 19 neurons from six KCNE1+/− mice (18 ± 3 days). The mean age of the animals was similar for the four groups of neurons obtained from mutant homozygous and heterozygous mice with either EGTA or BAPTA in the pipette, but the mean age of the wild-type mice was significantly lower (Kruskal–Wallis ANOVA, P = 0.005).
MVN neurons recorded with the EGTA-containing intracellular solution
Table 2 shows the mean values (±s.d.) of the parameters used to characterize MVN neurons in homozygous and heterozygous mutant mice. MVN neurons of heterozygous mutant mice were not significantly different from those of wild-type mice of the Swiss strain, except for the concavity of the voltage trace during the interspike interval, which was weaker in wild-type mice (−0.27 ± 0.64 mV versus−0.78 ± 1.30 mV, P = 0.026). This difference might be due to the lower age of the wild-type mice since the concavity of the voltage trace during the interspike interval and IA-like rectification tends to increase during development (see Dutia & Johnston, 1998), or the different genetic backgrounds of the animals. Nevertheless, MVN neurons of heterozygous mutant mice were otherwise similar to those of normal mice. Therefore, the effects of the mutation were assessed by comparing the data obtained on homozygous and heterozygous mutant animals.
Table 2.
Parameters of the resting spontaneous activity of MVN neurons recorded in juvenile mice using EGTA-containing intracellular solution
| KCNE1+/− heterozygous mutant mice | KCNE1−/− homozygous mutant mice | |||||||
|---|---|---|---|---|---|---|---|---|
| Parameters | All neurons | Type A | Type B+ | Type B0 | All neurons | Type A | Type B+ | Type B0 |
| Number and proportion | 54 (100%) | 9 (17%) | 26 (48%) | 19 (35%) | 30 (100%) | 3 (10%) | 13 (43%) | 14 (47%) |
| Membrane potential (mV) | −61.5 ± 4.5 | −61.3 ± 4.1 | −62.4 ± 5.2† | −60.3 ± 3.7† | −60.9 ± 3.9 | −62.8 ± 4.0 | −60.5 ± 4.1 | −60.8 ± 3.8 |
| Spike threshold (mV) | −47.3 ± 6.5 | −45.1 ± 5.2 | −49.0 ± 6.1 | −46.0 ± 7.2 | −46.9 ± 5.7 | −47.4 ± 1.7 | −47.6 ± 7.0 | −46.1 ± 5.0 |
| Firing rate (spikes s−1) | 8.2 ± 5.7* | 5.0 ± 2.8# | 9.8 ± 6.3§# | 7.5 ± 5.2§# | 13.3 ± 10.8* | 6.7 ± 1.6 | 17.9 ± 14.8§ | 10.5 ± 4.1§ |
| Coefficient of variation | 0.18 ± 0.15* | 0.25 ± 0.12# | 0.14 ± 0.11# | 0.20 ± 0.20 | 0.11 ± 0.09* | 0.14 ± 0.09 | 0.12 ± 0.11 | 0.09 ± 0.08 |
| AHPR (mV s−1) | 32 ± 46 | 117 ± 24# | 9 ± 20# | 22 ± 31# | 27 ± 49 | 128 ± 33# | 28 ± 47# | 4 ± 10# |
| dAHP (V s−1) | 0.24 ± 0.35 | 0.00 ± 0.00# | 0.50 ± 0.36#† | 0.00 ± 0.00† | 0.42 ± 0.99 | 0.00 ± 0.00# | 0.97 ± 1.34#† | 0.00 ± 0.00† |
| Spike width (ms) | 1.83 ± 0.64 | 1.88 ± 0.33# | 1.45 ± 0.28§#† | 2.31 ± 0.77§† | 1.52 ± 0.61 | 1.67 ± 0.45# | 1.21 ± 0.57§#† | 1.78 ± 0.58§† |
| Spike height (mV) | 63.5 ± 9.6* | 63.3 ± 5.3 | 65.9 ± 9.9§ | 60.4 ± 10.3 | 59.3 ± 9.9* | 66.4 ± 2.3 | 57.2 ± 8.6§# | 59.7 ± 11.6 |
| AHP (mV) | 20.8 ± 5.7 | 24.8 ± 3.0# | 19.5 ± 5.1# | 20.6 ± 6.6 | 20.3 ± 4.9 | 25.6 ± 4.5 | 19.0 ± 5.5 | 20.3 ± 3.8 |
| Concavity (mV) | −0.78 ± 1.30* | −1.69 ± 1.09# | −0.66 ± 1.49# | −0.52 ± 0.93§# | −0.35 ± 0.78* | −1.42 ± 0.81# | −0.49 ± 0.96#† | 0.00 ± 0.00§#† |
| Convexity (mV) | 1.00 ± 0.76 | 0.55 ± 0.28# | 1.18 ± 0.86# | 0.97 ± 0.69§ | 1.17 ± 0.72 | 0.58 ± 0.41# | 1.08 ± 0.91 | 1.39 ± 0.48§# |
Significant differences between the whole sets of neurons recorded on KCNE1−/−versus KCNE1+/− mutant mice.
Significant differences between KCNE1−/− and KCNE1+/− mutant mice for specific types of MVN neurons.
Significant differences between type A neurons and at least 1 of type B+ and type B0 neurons in either KCNE1−/− or KCNE1+/− mice.
Significant differences between type B+ and type B0 neurons in either KCNE1−/− or KCNE1+/− mice. All numerical values that take part in significant differences are shown in bold.
Classification of MVN neurons in juvenile mice
The range and average values of the parameters used for type A or B neurons classification (i.e. the convexity of the voltage trace during the interspike interval and the respective values of AHPR and dAHP) were determined on the 54 MVN neurons of heterozygous mutant mice (Table 2). While the convexity (1.00 ± 0.76 mV) and dAHP (0.24 ± 0.35 V s−1) were in the same range as those of adult guinea pig MVN neurons (Beraneck et al. 2003), the average AHPR (when present) was much weaker in juvenile mice (79 ± 38 mV s−1 instead of 590 ± 530 mV s−1). Because of this obvious difference, the AHPR threshold used to define type A neurons was set at a lower value of 80 mV s−1 instead of 150 mV s−1 using a three-dimensional graph similar to that shown in Fig. 4 of Beraneck et al. (2003). Altogether, MVN neurons of juvenile mice were classified as type B MVN neurons if they displayed a double AHP at rest (type B+ neurons, 48%), and also when no double AHP was visible if their AHPR was lower than 80 mV s−1 (type B0 neurons, 35%). Type B+ and B0 neurons will be considered separately below because significant differences were found between these two subpopulations. The neurons that did not show a double AHP at rest and had an AHPR of 80 mV s−1 or more were classified as type A neurons (17%). Figure 1 shows examples of spontaneous discharges, averaged action potentials and their first derivative for type A, B+ and B0 MVN neurons recorded at rest in heterozygous and homozygous KCNE1 mutant mice.
Figure 1.
Characterization of MVN neurons in juvenile heterozygous and homozygous KCNE1 mutant mice A–C, examples of spontaneous action potential discharges (a), averaged action potentials (b) and first derivatives of the averaged action potentials (c) of type A (A), B+ (B) and B0 (C) MVN neurons recorded in juvenile KCNE1+/− heterozygous mutant mice. D–F, similar examples of type A (A), B+ (B) and B0 (C) MVN neurons recorded from juvenile KCNE1−/− homozygous mutant mice. Most MVN neurons were spontaneously active in slices (a). The different neuronal types were distinguished by the strength (in V s−1) of the rectification following their after-hyperpolarization (AHPR) and of their double AHP (dAHP) measured from the first derivatives (c) of the averaged action potentials (b). The neurons showing an AHPR > 0.08 V s−1 and no double AHP at rest were classified as type A neurons (A and D), the neurons with a double AHP and an AHPR < 80 mV s−1 at rest were classified as type B+ neurons (B and E), and the neurons with no visible double AHP and an AHPR < 80 mV s−1 at rest were classified as type B0 neurons (C and F).
Differential characteristics of type A and type B MVN neurons in juvenile mice
Comparisons between the three types of MVN neurons recorded in heterozygous mutant mice revealed several significant differences (Table 2). Compared with type B+ neurons, type A neurons showed a larger AHP (P = 0.004), a wider spike (P = 0.002), a stronger concavity (P = 0.001) and a weaker convexity (P = 0.019) of the voltage trace during the interspike interval. Similar differences were found between type A and type B MVN neurons of adult guinea pigs (Beraneck et al. 2003). In addition, however, the spontaneous firing rate of type A MVN neurons of heterozygous juvenile mice was lower (P = 0.031) and more irregular (P = 0.009) than that of type B+ neurons. The AHP, convexity, spontaneous firing rate and CV values of type B0 neurons were intermediate between those of type A and B+ neurons (Table 2), but the concavity of their voltage trace during the interspike interval was similar to that of type B+ neurons and weaker than that of type A neurons (P = 0.003). In contrast, their spikes were particularly wide, in the same range as those of type A neurons and wider than those of type B+ neurons (P < 0.001). Finally, type B0 neurons were more depolarized at rest than type B+ neurons (P = 0.033), while type A neurons had an intermediate resting membrane potential between B0 and B+.
Comparison between MVN neurons of heterozygous and homozygous juvenile mutant mice
Compared with MVN neurons of heterozygous mutant mice (Table 2), MVN neurons of homozygous mutant mice displayed an increased (P = 0.005) and a more regular (P = 0.022) spontaneous firing rate, narrower spikes (P = 0.014), and a weaker concavity of the voltage trace during the interspike interval (P = 0.027). In addition, there was a non-significant trend for the spikes of MVN neurons to be smaller in homozygous mice (P = 0.061). The respective proportions of type A (10%), B+ (43%) and B0 (47%) neurons in homozygous mutant mice were similar to those in heterozygous mutant mice. The increase in firing rate and decrease in spike width were significant only for type B+ (respective P values of 0.046 and 0.003) and B0 neurons (respective P values of 0.032 and 0.035), while the decrease in spike height was restricted to type B+ neurons (P = 0.006). Conversely, in homozygous mutant mice, the decrease of the concavity and increase of the convexity of the voltage trace during the interspike interval were significant only for type B0 neurons (respective P values of 0.003 and 0.024). Altogether, differential effects of the mutation were observed according to the neuronal type, namely type B neurons were the only ones to be significantly affected (Table 2).
MVN neurons recorded with the BAPTA-containing intracellular solution
Effects of BAPTA on the MVN neurons of heterozygous mutant mice
Two main effects were observed when BAPTA-containing intracellular solution was used to record MVN neurons of heterozygous mutant mice (compare Tables 2 and 3). The height of their spikes increased (P = 0.023), and there was a non-significant trend (P = 0.074) for the AHPR to become stronger since it reached 59 ± 57 mV s−1 (range 0–192 mV s−1). The trend for an increase of the AHPR was associated with a decrease of the proportion of MVN neurons showing no IA-like rectification at rest, which fell from 59% to 26% (5 out of 19 neurons). As a consequence, BAPTA increased the proportion of MVN neurons classified as type A neurons, from 17% in control condition to 42%. Thus, using BAPTA had strong effects on the membrane properties of MVN neurons.
Table 3.
Parameters of the resting spontaneous activity of MVN neurons recorded in juvenile mice using BAPTA-containing intracellular solution
| KCNE1+/− heterozygous mutant mice | KCNE1−/− homozygous mutant mice | |||||||
|---|---|---|---|---|---|---|---|---|
| Parameters | All neurons | Type A | Type B+ | Type B0 | All neurons | Type A | Type B+ | Type B0 |
| Number and proportion | 19 (100%) | 8 (42%) | 6 (32%) | 5 (26%) | 22 (100%) | 3 (14%) | 12 (55%) | 7 (32%) |
| Membrane potential (mV) | −61.2 ± 3.3 | −60.5 ± 1.9§ | −61.9 ± 4.8 | −61.3 ± 3.3 | −59.6 ± 4.5 | −54.7 ± 1.7§# | −60.1 ± 2.1# | −60.9 ± 6.8 |
| Spike threshold (mV) | −46.0 ± 4.7 | −44.9 ± 3.7 | −48.7 ± 4.5 | −44.3 ± 5.4 | −47.7 ± 7.0 | −42.6 ± 1.6# | −47.5 ± 6.9 | −50.4 ± 7.9# |
| Firing rate (spikes s−1) | 6.5 ± 4.7 | 5.0 ± 2.6 | 7.2 ± 6.4 | 7.4 ± 5.0 | 8.2 ± 6.3 | 8.8 ± 8.4 | 8.3 ± 7.1 | 7.9 ± 4.7 |
| Coefficient of variation | 0.16 ± 0.10 | 0.17 ± 0.10 | 0.19 ± 0.11 | 0.13 ± 0.09 | 0.22 ± 0.21 | 0.15 ± 0.12 | 0.25 ± 0.26 | 0.20 ± 0.11 |
| AHPR (mV s−1) | 59 ± 57* | 123 ± 42# | 23 ± 32# | 31 ± 31# | 22 ± 50* | 122 ± 80# | 3 ± 9# | 11 ± 20# |
| dAHP (V s−1) | 0.46 ± 1.01 | 0.00 ± 0.00# | 1.40 ± 1.39#† | 0.00 ± 0.00† | 0.40 ± 0.80 | 0.00 ± 0.00# | 0.73 ± 0.97#† | 0.00 ± 0.00† |
| Spike width (ms) | 1.57 ± 0.58* | 1.48 ± 0.53§ | 1.23 ± 0.36§† | 2.01 ± 0.61† | 2.23 ± 0.75* | 2.42 ± 0.44§# | 1.76 ± 0.49§#† | 2.98 ± 0.59† |
| Spike height (mV) | 71.2 ± 11.4* | 75.0 ± 11.8 | 70.2 ± 13.3 | 68.3 ± 10.3 | 60.3 ± 16.0* | 54.6 ± 18.7 | 64.7 ± 11.9 | 55.2 ± 21.0 |
| AHP (mV) | 22.4 ± 5.2* | 25.1 ± 5.8# | 17.9 ± 1.2# | 24.1 ± 4.6§ | 18.1 ± 5.4* | 19.1 ± 3.0 | 19.5 ± 6.0 | 15.2 ± 4.1§ |
| Concavity (mV) | −0.93 ± 1.14 | −2.07 ± 1.23# | −0.41 ± 0.61# | −0.31 ± 0.43# | −0.28 ± 0.55 | −1.11 ± 0.60# | −0.09 ± 0.28# | −0.26 ± 0.62# |
| Convexity (mV) | 0.89 ± 0.49 | 0.64 ± 0.30 | 0.93 ± 0.56 | 1.11 ± 0.53 | 0.97 ± 0.64 | 0.48 ± 0.17 | 1.22 ± 0.73 | 0.75 ± 0.40 |
Significant differences between the whole sets of neurons recorded on KCNE1−/−versus KCNE1+/− mutant mice.
Significant differences between KCNE1−/− and KCNE1+/− mutant mice for specific types of MVN neurons.
Significant differences between type A neurons and at least 1 of type B+ and type B0 neurons in either KCNE1−/− or KCNE1+/− mice.
Significant differences between type B+ and type B0 neurons in either KCNE1−/− or KCNE1+/− mice. All numerical values that take part in significant differences are shown in bold.
Effects of BAPTA on the MVN neurons of homozygous mutant mice
Analysis of the effects of the BAPTA-containing solution on MVN neurons of homozygous mutant mice revealed strong interactions between the effects of the mutation and the different calcium buffering properties of the two intracellular solutions (Table 3). Altogether, the neurons of homozygous mutant mice were much more affected than those of heterozygous mice. In the BAPTA-containing solution, the mutation was associated with a significant decrease in spike height (P = 0.017). There was also a non-significant trend (P = 0.061) for the concavity of the voltage trace during the interspike interval to decrease compared with that found with EGTA. However, these modifications were observed on all neuronal types, contrary to what happened with EGTA. Interestingly, the increase in the spontaneous discharge rate and regularity of type B neurons observed in homozygous mice when EGTA was used was cancelled in the presence of BAPTA (Tables 2 and 3). The situation was even more complex for the width of the neurons' spikes. Indeed, while the mutation induced a strong decrease in the width of spikes when EGTA was used, when BAPTA-containing solution was used the spikes of MVN neurons of homozygous mutant mice were much wider than those of neurons recorded in heterozygous mice (P = 0.012, Tables 2 and 3). In other words, opposite effects of the mutation on spike width were obtained depending on the calcium buffering properties of the solution used in the patch pipette. Consequently, a large difference (P < 0.001) in spike width was obtained between the neurons of homozygous mice recorded in BAPTA- and EGTA-containing intracellular solutions.
Further interaction between the effects of the BAPTA-containing solution and those of the mutation was observed for the IA-like rectification. Indeed, the increase in AHPR of MVN neurons provoked by BAPTA in heterozygous mutant mice did not occur for MVN neurons of homozygous mutant mice (Tables 2 and 3). As a consequence, BAPTA did not increase the proportion of type A MVN neurons in homozygous mice, since only 14% of MVN neurons were classified as type A neurons in that situation (versus 42% for MVN neurons recorded with BAPTA on heterozygous mice). In the presence of BAPTA, the AHPR of MVN neurons was weaker in homozygous mice than in heterozygous mice (P = 0.017), and this change was associated with a decrease in the amplitude of the AHP (P = 0.012, Table 3) observed in type A and B0 MVN neurons. Finally, a specific depolarizing effect of the mutation on the resting membrane potential of type A MVN neurons (P = 0.025) occurred when BAPTA was used.
Altogether, complex interactions were observed between the effects of the KCNE1 mutation and those of BAPTA addition into the patch pipette. Part of the changes observed in juvenile homozygous versus heterozygous mutant mice was antagonized when BAPTA was used, but other effects of the KCNE1 mutation persisted in that situation.
Membrane resistance and capacitance of MVN neurons in juvenile mice
In control condition, i.e. with EGTA in the patch pipette, the average membrane resistance of MVN neurons of heterozygous juvenile mice assessed by hyperpolarizing pulses of 100 ms duration (not shown) was 632 ± 372 MΩ, while their capacitance was 25.3 ± 12.6 pF (n = 43). There was no significant difference in membrane resistance or capacitance between the three neuronal types. Neither the mutation nor the use of BAPTA instead of EGTA within the patch pipette significantly modified these values. For instance, the average membrane resistance of MVN neurons recorded with EGTA was 499 ± 247 MΩ (n = 20) for homozygous mice, while it was 730 ± 494 MΩ (n = 8) with BAPTA. For heterozygous mice, the membrane resistance of MVN neurons recorded with BAPTA was 461 ± 267 MΩ (n = 15).
Sharp electrode recordings of MVN neurons from adult mice
Data presented in this paragraph were obtained from a database of 97 MVN neurons recorded with sharp, high-resistance electrodes on 400 μm thick brainstem slices taken from adult mice 2 to 9 months old. Sixty neurons were only recorded extracellularly while 37 were recorded intracellularly. Among those 37 neurons, 12 were also recorded extracellularly before impalement.
Extracellular recordings of MVN neurons in adult mice
Altogether, extracellular recordings were obtained from 72 MVN neurons of adult mice. They included 21 neurons from five KCNE1−/− homozygous mutant mice (mean age 114 ± 69 days), 30 neurons from six KCNE1+/− heterozygous mutant mice (94 ± 24 days) and 21 neurons from five wild-type mice used as complementary controls (174 ± 35 days). Wild-type mice were significantly older than homozygous (P = 0.002) and heterozygous (P < 0.001) mutant mice but there was no significant difference between the data obtained on heterozygous and wild-type mice, which were therefore pooled together. Altogether, the effects of the mutation were assessed by comparing the 21 MVN neurons recorded in homozygous mutant mice with the 51 MVN neurons recorded in heterozygous mutant and wild-type mice (i.e. ‘normal’ control mice).
All MVN neurons recorded on homozygous mutant mice were spontaneously active while 2 out of 51 (4%) of the control neurons were silent at rest. While the spontaneous firing rate of extracellularly recorded MVN neurons was similar for homozygous mutant (21.0 ± 16.0 spikes s−1) and control mice (21.8 ± 14.9 spikes s−1), the discharge was significantly (P = 0.012) more irregular in homozygous mutant mice (CV = 0.27 ± 0.25) than in control mice (CV = 0.17 ± 0.19).
Intracellular recordings of MVN neurons in adult mice
Intracellular recordings were obtained for 37 MVN neurons, including 16 neurons obtained from eight KCNE1−/− homozygous mice (mean age 133 ± 57 days), 9 neurons from five KCNE1+/− heterozygous mutant mice (mean age 102 ± 26 days) and 12 neurons from six wild-type mice (mean age 155 ± 49 days). The wild-type mice were significantly older than the heterozygous mutant mice (P = 0.014). Since there was no significant difference between the data obtained on heterozygous and wild-type mice, they were pooled together, and the effects of the mutation were assessed by comparing the 16 neurons recorded in homozygous mutant mice with the 21 neurons recorded in heterozygous mutant and wild-type mice (i.e. ‘normal’ control mice).
Classification of MVN neurons in adult mice
The parameters of spontaneous resting activity of intracellularly recorded MVN neurons in homozygous mutant and control mice are shown in Table 4. As for juvenile mice, the range and average values of the three parameters used for the classification of neurons as type A or B (Beraneck et al. 2003) were assessed on the 21 neurons obtained on control mice. Contrary to what happened in juvenile mice, none of these values was different from those obtained on MVN neurons of adult guinea pigs (Beraneck et al. 2003). The MVN neurons of adult mice were therefore classified as type A (52%) or B (43%) neurons using the same quantitative parameters as for guinea pig neurons, with a threshold AHPR for type A neurons set at 0.15 V s−1. Figure 2 shows examples of spontaneous action potential discharges, averaged action potentials and their first derivative for type A and B MVN neurons recorded at rest in adult, homozygous mutant and control mice.
Table 4.
Parameters of the resting spontaneous activity of MVN neurons recorded in adult mice using sharp electrodes
| Control mice (wild-type and KCNE1+/−) | KCNE1−/− homozygous mutant mice | |||||
|---|---|---|---|---|---|---|
| Parameters | All neurons | Type A | Type B | All neurons | Type A | Type B |
| Number and proportion | 21 (100%) | 11 (52%) | 9 (43%) | 16 (100%) | 9 (56%) | 6 (38%) |
| Membrane potential (mV) | −53.2 ± 7.7 | −52.6 ± 8.1 | −53.6 ± 8.2 | −48.5 ± 7.8 | −49.5 ± 5.4 | −48.2 ± 10.9 |
| Spike threshold (mV) | −42.3 ± 5.8 | −42.6 ± 5.8 | −41.8 ± 6.5 | −39.5 ± 6.9 | −40.8 ± 5.2 | −38.6 ± 9.2 |
| Firing rate (spikes s−1) | 25.1 ± 19.7 | 30.2 ± 27.3 | 20.7 ± 8.9 | 21.3 ± 16.8 | 23.4 ± 19.6 | 18.8 ± 15.3 |
| Coefficient of variation | 0.16 ± 0.22 | 0.26 ± 0.30 | 0.07 ± 0.07 | 0.29 ± 0.27 | 0.24 ± 0.26 | 0.36 ± 0.31 |
| AHPR (V s−1) | 0.57 ± 0.63 | 1.08 ± 0.49# | 0.03 ± 0.04# | 0.85 ± 1.20 | 0.97 ± 0.64# | 0.05 ± 0.05# |
| dAHP (V s−1) | 0.53 ± 0.83 | 0.00 ± 0.00# | 1.08 ± 0.97# | 1.32 ± 2.47 | 0.00 ± 0.00# | 3.48 ± 3.10# |
| Spike width (ms) | 0.79 ± 0.17 | 0.89 ± 0.16# | 0.70 ± 0.12# | 0.83 ± 0.25 | 0.90 ± 0.30 | 0.75 ± 0.16 |
| Spike height (mV) | 51.8 ± 9.3 | 52.4 ± 6.7 | 50.2 ± 11.9 | 50.4 ± 11.0 | 46.7 ± 5.4 | 57.4 ± 13.8 |
| AHP (mV) | 17.8 ± 4.0 | 17.2 ± 3.0 | 18.5 ± 5.2 | 17.1 ± 4.4 | 18.7 ± 4.1 | 15.3 ± 4.7 |
| Concavity (mV) | −1.21 ± 1.12 | −2.04 ± 0.86# | −0.28 ± 0.43# | −1.71 ± 0.90 | −2.32 ± 1.70# | −1.07 ± 2.18# |
| Convexity (mV) | 0.76 ± 0.85* | 0.24 ± 0.35# | 1.40 ± 0.85# | 0.21 ± 0.25* | 0.09 ± 0.07# | 0.38 ± 0.34# |
Significant differences between the whole sets of neurons recorded on KCNE1−/−versus KCNE1+/− mutant mice.
Significant differences between type A and type B neurons in either KCNE1−/− or KCNE1+/− mice. All numerical values that take part in significant differences are shown in bold.
Figure 2.
Characterization of MVN neurons in adult control and homozygous KCNE1 mutant mice A and B, examples of spontaneous action potential discharges (a), averaged action potentials (b) and first derivatives of the averaged action potentials (c) of type A (A) and B (B) MVN neurons recorded in adult control mice. C and D, similar examples of type A (A) and B (B) MVN neurons recorded from adult KCNE1−/− homozygous mutant mice. Most MVN neurons were spontaneously active in slices (a). The different neuronal types were distinguished according to the strength (in V s−1) of the rectification following their after-hyperpolarization (AHPR) and of their double AHP (dAHP) measured from the first derivatives (c) of the averaged action potentials (b). The neurons showing an AHPR > 0.15 V s−1 and no double AHP at rest were classified as type A neurons, while the neurons with a double AHP and an AHPR < 0.15 V s−1 at rest were classified as type B neurons.
MVN neurons recorded in control mice included 11 type A neurons (52%), 9 type B neurons (43%) and 1 type C neuron displaying both a double AHP and an AHPR > 0.15 V s−1 (5%). Type A compared with type B neurons had a wider spike (P = 0.011), and a less pronounced convexity of the voltage trace during the interspike interval (P = 0.001 in both cases), as in adult guinea pigs (Beraneck et al. 2003). No other difference between the neuronal types was observed, and in particular the average amplitude of the AHP was similar in type A and B neurons (P = 0.65).
Comparison between the membrane properties of MVN neurons in juvenile versus adult control animals
Compared with the MVN neurons of juvenile mice (Table 2), the MVN neurons of adult mice displayed a much higher spontaneous firing rate of 25.1 ± 19.7 spikes s−1versus 8.2 ± 5.7 spikes s−1 (P < 0.001), which were associated with more depolarized average membrane (P < 0.001) and spike threshold potentials (P = 0.003). The amplitude of the AHP was about 3 mV higher in MVN neurons of adult mice (P = 0.032). The spikes were on average 57% narrower in adult mice compared with juvenile mice (P < 0.001), while their height was reduced by 18% at 51.8 ± 9.3 mV. MVN neurons of adult mice displayed also a much stronger AHPR that reached 0.57 ± 0.63 V s−1 instead of 0.032 ± 0.046 V s−1 (P < 0.001); the increased AHPR was associated with a stronger concavity of the voltage trace during the interspike interval (P = 0.032), and a strong, though not significant trend (P = 0.051) for the convexity to be weaker. Finally and as expected for methodological reasons, the membrane resistance and capacitance of intracellularly recorded MVN neurons of adult mice (respectively, 171 ± 114 MΩ and 96 ± 61 pF, n = 21) were much lower and higher, respectively, than those of the neurons of juvenile mice recorded using the whole-cell patch-clamp technique. There was no significant difference of membrane resistance or capacitance between the two neuronal types.
Comparison between MVN neurons of heterozygous and homozygous adult mutant mice
Contrary to what was observed in juvenile mice, the intracellularly recorded MVN neurons of adult homozygous mutant mice were not much different from their control counterparts (Table 4). The respective proportions of the different MVN neuronal types were similar to those obtained in control mice, with nine type A neurons (56%), six type B neurons (38%) and one type C neuron (6%). As for the juvenile mice, the mutation induced a slight depolarization of the resting membrane potential of MVN neurons, which was, however, not significant (P = 0.088). The level of their spontaneous firing rate was not modified, but there was a non-significant trend suggesting that their discharge is more irregular (P = 0.067, Table 4) in accordance with what was observed with extracellular recordings (see above). The only parameter that was significantly modified by the mutation was the convexity of the voltage trace during the interspike interval, smaller in homozygous mutant mice (0.21 ± 0.25 mV) than in control adult mice (0.76 ± 0.85 mV, P = 0.042). The membrane resistance and capacitance of MVN neurons were not modified either by the mutation, with respective average values of 133 ± 123 MΩ and 80 ± 71 pF (n = 16).
Single-cell expression of CaBP mRNAs in MVN neurons from juvenile mice
The cytoplasm of 45 MVN neurons of KCNE1+/− heterozygous mice and 45 MVN neurons of KCNE1−/− homozygous mice recorded with the patch-clamp technique was harvested under visual control, and the pipette content used for reverse transcription (RT) and multiplex polymerase chain reaction (mPCR, see Methods). This RT-mPCR selectively amplified at the single-cell level the cDNAs corresponding to the mRNAs encoding calbindin D28k (CB), calretinin (CR) and parvalbumin (PV). Figure 3 shows an example of the results obtained for a single neuron in which mRNAs encoding all three CaBPs were detected.
Thirty-four out of the 45 MVN neurons obtained from heterozygous mutant mice (76%) and 33 out of the 45 neurons obtained from homozygous mutant mice (73%) expressed mRNAs encoding at least one of the three CaBPs. Seventeen (38%) and 15 (33%) of the neurons obtained from heterozygous and homozygous mutant mice, respectively, expressed mRNAs encoding two of the three CaBPs. Finally, mRNAs encoding all three CaBPs were expressed together by four of the neurons obtained from heterozygous mutant mice (9%) and one of the neurons obtained from homozygous mutant mice (2%). The proportions of neurons where the mRNAs encoding CB, CR and PV were detected were 21%, 71% and 59%, respectively, in heterozygous mutant mice. For the homozygous mutant mice, the respective proportions were 12%, 64% and 55%. In both groups of mice, the proportion of neurons expressing the mRNAs encoding CB was lower (P < 0.001) than that of neurons expressing the mRNAs encoding CR or PV.
Altogether, these results suggest that the expression of mRNAs encoding the CaBPs tends to be lower in MVN neurons of homozygous mutant mice compared with the heterozygous mutant mice, but not significantly according to the χ2 test. There was no significant difference either in the proportions of neurons that expressed mRNAs for the various CaBPs according to the different types of MVN neurons.
CaBP expression in MVN from juvenile and adult mice
Figures 4 and 5 present the data obtained using immunohistochemistry on the expression of CB, CR and PV proteins in the MVN of homozygous and heterozygous mutant mice.
Figure 4.
Fluorescent immunostaining of calcium-binding proteins in the MVN of juvenile heterozygous and homozygous KCNE1 mutant mice A–F, digital photographs illustrating typical calbindin (A and B), calretinin (C and D) and parvalbumin (E and F) immunostaining obtained in the MVN of heterozygous (A, C and E) and homozygous (B, D and F) KCNE1 juvenile mutant mice. Note the cell bodies immunostained for calretinin in C and D. Scale bars, 50 μm. G, graph showing the mean arithmetic fluorescence (arbitrary units) obtained for each of the three calcium-binding proteins (CB calbindin, CR calretinin, PV parvalbumin) in homozygous and heterozygous juvenile mutant mice. H, graph giving the mean number of calretinin-immunostained neurons per MVN in homozygous and heterozygous juvenile mutant mice. In G and H, error bars show the standard deviations, and asterisks indicate significant differences between homozygous and heterozygous mutant mice (*P < 0.05).
Figure 5.
Fluorescent immunostaining of calcium-binding proteins in the MVN of adult heterozygous and homozygous KCNE1 mutant mice A–F, digital photographs illustrating typical calbindin (A and B), calretinin (C and D) and parvalbumin (E and F) immunostaining obtained in the MVN of heterozygous (A, C and E) and homozygous (B, D and F) KCNE1 adult mutant mice. Note the cell bodies immunostained for calretinin in C and D. Scale bars, 50 μm. G, graph showing the mean arithmetic fluorescence (arbitrary units) obtained for each of the three calcium-binding proteins (CB calbindin, CR calretinin, PV parvalbumin) in homozygous and heterozygous adult mutant mice. H, graph giving the mean number of calretinin-immunostained neurons per MVN in homozygous and heterozygous adult mutant mice. In G and H, error bars show the standard deviations, and asterisks indicate significant differences between homozygous and heterozygous mutant mice (**P < 0.005).
Calbindin immunostaining
CB fluorescent immunostaining restricted to cellular processes was evident throughout the MVN of both juvenile (Fig. 4A and B) and adult (Fig. 5A and B) homozygous and heterozygous mutant mice. The mean arithmetic fluorescence (AF) for CB was lower by 31% in juvenile (Fig. 4G, P = 0.024) and 23% in adult (Fig. 5G, P < 0.001) homozygous mutant mice compared with heterozygous mutant controls. In contrast, there was no significant difference in CB expression between juvenile and adult heterozygous mutant mice (P = 0.27).
Calretinin immunostaining
CR immunostaining was present in the cell bodies of MVN neurons and in cellular processes throughout the MVN of both juvenile (Fig. 4C and D) and adult (Fig. 5C and D) homozygous and heterozygous mutant mice. Most of the CR-immunostained neurons and dendritic processes were located near the IVth ventricle. The mean AF for CR was lower by 29% in juvenile (Fig. 4G, P = 0.023) and 13% in adult (Fig. 5G, P = 0.004) homozygous mutant mice compared with heterozygous mutant mice of the same age. In homozygous mutant mice, there were also significantly less CR-immunostained neurons per MVN than in heterozygous mutant mice of the same age (Figs 4H and 5H). This decrease reached 32% in juvenile and 48% in adult mice. While the mean AF for CR increased significantly from juvenile to adult mice for homozygous as well as heterozygous mutant animals (P < 0.001 in both cases), the number of CR-immunostained neurons per MVN was similar for juvenile (23.4 ± 5.9) and adult (25.0 ± 5.0) heterozygous mutant mice.
Parvalbumin immunostaining
For PV, a densely immunostained neuropil was evident throughout the MVN of both juvenile (Fig. 4D and E) and adult (Fig. 5D and E) heterozygous and homozygous mutant mice, while only a few cell bodies were stained. In contrast to the two other CaBPs, the mean AF was not significantly different between heterozygous and homozygous mutant mice of either juvenile (Fig. 4G) or adult age (Fig. 5G). There was, however, a strong, significant increase in the mean expression of PV from juvenile to adult mice for heterozygous as well as homozygous mutant animals (P < 0.001 in both cases).
Summary of electrophysiological and immunohistochemical data
Altogether, the data confirm that the MVN neurons of juvenile and adult mice include type A and B neurons, and that the three CaBPs calbindin (CB), calretinin (CR) and parvalbumin (PV) are expressed in the mouse MVN. In juvenile mice, the KCNE1 mutation was associated with modifications of the membrane properties of MVN neurons and a strong decrease in the expression of CaBPs within the MVN.
In adult mice, however, there was almost no difference between the membrane properties of MVN neurons of homozygous and heterozygous mutant KCNE1 mice. The expression levels of CB and CR remained lower in homozygous than in heterozygous mutant animals, but the amount of CaBPs expressed in the MVN was much greater than in juvenile mice.
Discussion
Membrane and firing properties of MVN neurons in wild-type and heterozygous mutant mice
The electrophysiological results confirm previous data from Dutia & Johnston (1998) and Camp et al. (2006), which demonstrated that mouse MVN neurons can be classified in type A and B neurons as in rat and guinea-pig (Serafin et al. 1991a; Beraneck et al. 2003). The low spontaneous discharge rate of MVN neurons in juvenile mice is also in agreement with those former studies. In adult mice aged 2 to 9 months, the quantitative criteria of Beraneck et al. (2003) on adult guinea pigs could be used to separate type A and B MVN neurons recorded with sharp electrodes. As in the guinea pig, about equal proportions of type A and B neurons were found, which suggests that the higher proportion of type B neurons found at younger ages (up to 1 month) by Dutia & Johnston (1998) disappears when the animal reaches full maturity.
In juvenile (16 to 23 days old) mice, the AHPR (after-hyperpolarization rectification) threshold above which an MVN neuron was classified as a type A neuron was decreased compared with adult mice or guinea pigs (Beraneck et al. 2003), because the average AHPR of neurons was almost 8 times lower than in adult animals. This difference confirms that the concavity of the voltage trace during the interspike interval and IA-like rectification of MVN neurons increase during development as seen in Dutia & Johnston (1998), but might also be due to the different recording methods used in juvenile (patch-clamp) versus adult mice (sharp electrodes). Indeed, the few patch-clamp recordings obtained on adult mice several months old suggest that the AHPR is much weaker than when sharp electrodes are used. In addition, the type B MVN neurons of juvenile mice were separated into two subtypes, namely the B+ and B0 neurons, according to whether or not they displayed a double AHP at rest. Nevertheless, significant differences in the effects of the KCNE1 mutation were found between these two groups of type B neurons. Altogether, the membrane and discharge properties of type B0 MVN neurons were intermediate between those of type A and type B+ neurons.
Effects of the KCNE1 mutation in juvenile mice
In homozygous KCNE1 mutant juvenile mice, no functional vestibular sensory input reaches MVN neurons and the afferent vestibular nerve fibres appear to be silent (Vidal et al. 2004). This leads to an increased spontaneous discharge rate of MVN neurons, a decrease of their spike width and height and a decreased concavity of the voltage trace during the interspike interval compared with control, heterozygous KCNE1 mutant mice. Most changes were restricted to type B MVN neurons, with some differential effects between type B+ and B0 neurons. The latter displayed stronger modifications of the shape of their voltage trace during the interspike interval, including a significant decrease in concavity and increase in convexity. However, the AHPR and double AHP of MVN neurons of homozygous mutant mice were left unchanged, and therefore the respective proportions of type A, B+ and B0 neurons were not modified.
The modifications of the membrane properties of MVN neurons in homozygous juvenile mutant mice were accompanied by a strong decrease in the expression of CB and CR proteins in the MVN. A similar, but not significant, trend was observed for PV. As shown previously in rodents, cat and monkey (Sans et al. 1995; Kevetter, 1996; Baurle et al. 1997; Kevetter & Leonard, 1997; Puyal et al. 2002; Baizer & Baker, 2005, 2006), CB and PV proteins were expressed mostly by neuronal fibres, while somatic expression of CR was visible in many MVN neurons as well as within neuronal processes. In accordance with the overall expression data, the number of CR-immuno-stained neurons per MVN was smaller in homozygous than in heterozygous mutant mice. Interestingly, the RT-mPCR data did not reveal any significant difference in the respective proportions of MVN neurons expressing the mRNAs encoding CB, CR and PV between homozygous and heterozygous mutant mice. This suggests that the absence of functional sensory input does not modify the level of transcription of these mRNAs, and that the decrease in the expression of CR by MVN neurons results mostly from post-transcriptional regulations. Previous studies demonstrated that CB, CR and PV are expressed in the MVN by various subsets of vestibular sensory afferent fibres (Kevetter & Leonard, 1997; Puyal et al. 2002), which may explain why CaBP expression is decreased in homozygous KCNE1 mutant mice devoid of functional vestibular input. In addition, CB and PV are expressed by fibres originating from cerebellar Purkinje cells (Kevetter & Leonard, 1997; Puyal et al. 2002; Schwaller et al. 2002) that might be indirectly affected by the absence of functional sensory afferents.
In adult rodents, the sudden suppression of sensory vestibular input and spontaneous discharge in the afferent fibres by unilateral labyrinthectomy triggers a decrease in the somatic expression of CR by MVN neurons (Sans et al. 1995) and a decrease of the overall expression of CB and CR in the MVN (Kevetter & Leonard, 1997). In addition, the lesion and subsequent vestibular compensation are associated on the ipsilesional side with changes in the membrane properties and spike firing of MVN neurons that affect mainly type B neurons, and include an increase in their spontaneous discharge rate and resting membrane potential (Him & Dutia, 2001; Beraneck et al. 2003). Hence, the congenital absence of vestibular input in homozygous KCNE1 mutant mice and deafferentation of central vestibular neurons in adult mice both induced a decrease in the expression of CaBPs in the MVN, as well as modifications of the biophysical properties of type B neurons that are associated with an increase of their spontaneous firing rate. In addition, there were also differences between the effects of congenital and experimental deafferentation. The absence of sensory vestibular input was associated in juvenile mice with decreased spike width and height, a decreased concavity of the voltage trace during the interspike interval, but no significant change of the resting membrane potential. In contrast, unilateral labyrinthectomy triggered in MVN neurons an increase in the concavity of the voltage trace during the interspike interval that led to a reduction in the proportion of type B neurons, and an increase of the spike width and AHP amplitude of all neurons. It is noteworthy that these differential effects are matched by distinctive behavioural deficits, namely the congenital absence of vestibular input in juvenile homozygous KCNE1 mutant mice causes the shaker/waltzer phenotype characterized by head bobbing, rapid circling and a waltzing behaviour that persists for the whole life of the animal, while unilateral vestibular lesion in adult rodents triggers a transient postural and oculomotor asymmetry and permanent deficits of vestibular reflexes, but no head bobbing or waltzing behaviour.
Altogether, the comparison between the effects of congenital absence of sensory input in juvenile mice and unilateral vestibular deafferentation in adult animals suggests that among MVN neurons, the type B neurons are the most sensitive to the activity of sensory vestibular inputs. In addition, the data suggest a fundamental distinction between the asymmetric, transient postural and oculomotor effects induced by unilateral vestibular deafferentation and the head bobbing and waltzing behaviours linked to bilateral suppression of vestibular inputs. Interestingly, bilateral labyrinthectomy in adult guinea pigs triggers no postural or oculomotor asymmetry (Ris & Godaux, 1998) but induces a permanent head bobbing and instability during locomotion. However, no waltzing behaviour can be observed. Thus, the waltzing behaviour of juvenile homozygous KCNE1 mutant mice would be a specific consequence of the congenital, bilateral absence of sensory vestibular inputs during a sensitive period of development.
Finally, we and others demonstrated that following unilateral vestibular deafferentation in adult rodents, vestibular compensation resulted not only from changes in the intrinsic membrane properties of MVN neurons, but also from changes in the efficacy of synaptic inputs and a reorganization of vestibular-related neuronal networks (Vibert et al. 1999a, b; Guilding & Dutia, 2005). Consequently, modifications of the efficacy of synaptic inputs reaching MVN neurons or reorganizations of vestibular-related networks might also be involved in the behavioural consequences of the KCNE1 mutation.
Interaction between the calcium buffering activity and membrane properties of MVN neurons in juvenile mutant mice
In juvenile homozygous mutant mice, the decreased expression of CR by MVN neurons would induce an increase in their free intracellular calcium concentration, which would augment the neuronal excitability and spontaneous discharge of type B neurons. The concomitant decrease of their spike width and height might result from greater activation of the voltage- and Ca2+-dependent K+ channels that terminate the action potential. This hypothesis was supported in part by the modifications of the membrane properties and spontaneous activity of MVN neurons induced when recordings were done with BAPTA-containing patch-clamp pipettes. Like CB and CR, BAPTA is a fast calcium buffer, while EGTA and PV are slow-onset, less effective calcium buffers (Edmonds et al. 2000; Schwaller et al. 2002). In accordance with the fact that CR and BAPTA have quite similar Ca2+-binding properties (Edmonds et al. 2000), we expected interactions between the KCNE1 mutation that decreases the expression of CR by MVN neurons and the addition of BAPTA instead of EGTA into the patch pipette. Indeed, part of the changes observed in juvenile homozygous versus heterozygous mutant mice was antagonized when the calcium buffering capacities of MVN neurons were increased by using BAPTA for electrophysiological recordings. The spontaneous discharge rate of the MVN neurons of homozygous mutant mice was reduced back to control value, and their spike width was increased, as expected in the presence of a lower free intracellular calcium concentration. However, some effects of the KCNE1 mutation on other parameters of MVN neurons such as the decrease in spike height and concavity of the voltage trace during the interspike interval persisted when EGTA was replaced by BAPTA. In homozygous mutant mice, the AHPR and double AHP, which are also modulated by calcium-dependent ionic mechanisms (Jerng et al. 2004; Bond et al. 2005), were not different from those obtained with EGTA-containing pipettes.
In control, heterozygous mutant mice, using BAPTA had strong effects per se on the membrane properties of MVN neurons. The height of the spike was increased, and the AHPR was greater when the BAPTA-containing solution was used, which led to a significant increase in the proportion of type A neurons among MVN neurons. Finally, the amplitude of the AHP tended to increase. These three effects of replacement of EGTA by BAPTA were all reversed by the KCNE1 mutation. Indeed, for the MVN neurons recorded with BAPTA in juvenile homozygous mutant mice, the proportion of type A neurons, the spike height and amplitude of the AHP were again similar to those obtained for the MVN neurons of control, heterozygous mutant mice recorded with EGTA.
Altogether, two main conclusions can be drawn from the complex interactions observed between the effects of the KCNE1 mutation and those of BAPTA addition into the patch pipette. The fact that replacement of EGTA by BAPTA modified the respective proportions of type A and B MVN neurons in juvenile mice suggests that as proposed in the introduction, the intracellular calcium buffering properties of MVN neurons could be one of the main determinants of their membrane properties and classification as type A or B neurons. In addition, the multiple interactions demonstrated between the effects of the KCNE1 mutation and changes of the calcium buffer within the patch pipette in juvenile mice confirms that the KCNE1 mutation modifies the biophysical membrane properties of at least some of the MVN neurons via modifications of their intracellular calcium buffering properties.
Effects of the mutation on MVN neurons in adult mice
In contrast with the strong effects of the KCNE1 mutation on MVN neurons described in juvenile mice, there were only few differences between the parameters of the resting activity of MVN neurons in heterozygous and homozygous adult mutant mice. Indeed, in adult animals, the mutation is only associated with a higher irregularity of the spontaneous discharge rate of MVN neurons, a trend for depolarization, and a significant decrease in the convexity of their voltage trace during the interspike interval. Hence, the effects of the congenital absence of vestibular sensory afferents on central vestibular neurons would be compensated during the course of development. This phenomenon is not due to the progressive recovery of a spontaneous discharge by sensory vestibular nerve fibres, since unilateral labyrinthectomy has no effect in adult KCNE1−/− mutant mice (Vidal et al. 2004). Nevertheless, the adult homozygous mutant mice still show the shaker/waltzer phenotype, which indicates that this phenotype is not directly due to modifications of the biophysical membrane properties of MVN neurons.
Compared with MVN neurons of juvenile mice, the central vestibular neurons of adult mice displayed a much higher spontaneous firing rate and more depolarized resting membrane potentials, a larger AHP, smaller and thinner action potentials, an increased AHPR and concavity and a decreased convexity of their voltage trace during the interspike interval. While part of these modifications must correspond to developmental maturation, others might be due to the different recording techniques used in juvenile versus adult mice. As pointed out above, the differences in the shape of the interspike interval and the higher firing rates might result from intracellular penetration of the sharp electrodes used in adult animals.
The immunohistochemical data show that between juvenile and adult mice, there was a strong increase in CR and PV expression levels in the MVN for both heterozygous and homozygous KCNE1 mutant mice, but neither the level of CB expression nor the number of CR-immunostained MVN neurons were modified. The increased expressions of CR and PV with age are in agreement with previous experiments in the rat (Puyal et al. 2002). As in juvenile mice, however, there were still significant differences in CB and CR expressions between homozygous and heterozygous mutant mice, despite the fact that the membrane and firing properties of MVN neurons were much more similar in the two groups of adult mutant mice. These data confirm that during development, maturation of MVN neurons is associated with an increased expression of CaBP in the MVN. In adult homozygous mutant mice, the level of CaBP expression was similar to that of juvenile heterozygous mutant mice, and would thus be sufficient to make the initial effects of the congenital absence of sensory vestibular afferents on MVN neurons of juvenile mice disappear.
Comparison with other mutant rodents
As pointed out above, the changes in the biophysical membrane properties of MVN neurons seen in juvenile KCNE1 homozygous mutant mice cannot be directly responsible for their shaker/waltzer phenotype and circling behaviour because these modifications do not persist in adult mutant mice that still display the phenotype.
Interestingly, the circling phenotype is observed in many strains of mutant mice and rats, where it is generally associated with hyperactivity. In most of the cases, a preferred direction of rotation can be distinguished. In particular, all mutant rodents showing genetic alterations of inner ear development present a circling behaviour together with congenital auditory and vestibular dysfunctions (Holme et al. 2002). However, since experimental vestibular deprivation early in development leads to delays and alterations in the maturation of postural control, but does not induce the shaker/waltzer behaviour (Geisler & Gramsbergen, 1998), the circling behaviour is not a direct consequence of congenital or early suppression of sensory vestibular inputs.
As in the homozygous KCNE1 mutant mice, the circling ci2 mutant rats display the circling phenotype as well as congenital auditory and vestibular defects (Kaiser et al. 2001). Several studies demonstrated that the mutation was associated with various neurochemical, immunohistochemical and electrophysiological alterations within the basal ganglia, which are known to be strongly involved in motor control. Indeed, the rotational behaviour and locomotor hyperactivity of the ci2 mutant rat were correlated with a lower tissue content of dopamine in the striatum ipsilateral to the preferred direction of circling (Loscher et al. 1996; Richter et al. 1999). As shown by microdialysis experiments, the ci2 mutants exhibit an asymmetric, contralateral increase in striatal dopamine release during stress-induced circling behaviour (Fedrowitz et al. 2000). Although the discharge rate and firing pattern of striatal neurons were not modified, the average spontaneous discharge rate of substantia nigra pars reticulata neurons was increased on both sides of the brain (Fedrowitz et al. 2003).
On the other hand, Lessenich et al. (2001) described another strain of circling ci3 mutant rats that display the circling behaviour, but have normal auditory and vestibular functions. The ci3 mutants showed an asymmetry of dopaminergic activity in the striatum as in ci2 mutants. Our own data confirm that the alterations of MVN neuron membrane properties induced by early degeneration of vestibular end-organs do not persist in adult KCNE1 homozygous mutant mice, and hence cannot be the only cause for their shaker/waltzer circling phenotype.
Altogether, the circling behaviour of mutant mice and rats would primarily result from the combination of complex alterations of neurochemical and electrophysiological activity within the striatum, substantia nigra and other structures of the basal ganglia. However, in homozygous KCNE1−/− mutant mice and ci2 mutant rats, these alterations would be triggered by the congenital absence of sensory vestibular input. In other words, while the alterations of basal ganglia activity that generate the circling behaviour could be an automatic consequence of congenital vestibular deafferentation, the ci3 mutant rats also demonstrate that the circling behaviour can also appear independently of any vestibular deficit.
Conclusion
The juvenile KCNE1 homozygous mutant mouse is a useful model to study the contribution of peripheral vestibular inputs to the physiological properties of central vestibular neurons, and provides suggestions for possible mechanisms of vestibular compensation following unilateral labyrinthectomy. The changes in the biophysical membrane properties of MVN neurons observed in juvenile KCNE1 homozygous mutant mice correlate with a decrease in CaBP expression levels within the MVN. In addition, data analysis shows that the membrane properties and classification of MVN neurons into type A and B neurons strongly depend on their intracellular calcium buffering capacities. In adult KCNE1 homozygous mutant mice, however, the membrane properties of MVN neurons appear to be normal. Our data confirm that the circling/waltzing behaviour observed in numerous mutant rodents can result from the congenital suppression of sensory vestibular signal during a ‘sensitive period’ around birth, but demonstrate that it is not due to persistent abnormalities of the membrane properties of central vestibular neurons. In addition, these results show that maturation of the membrane properties of central vestibular neurons is delayed and disturbed in juvenile mice by the absence of sensory vestibular input, but not really impaired in adult mutant mice.
Acknowledgments
We thank J. Barhanin who provided us with the mutant mice. We give special thanks to M. Wiatr for her help in performing the RT-mPCR experiments and M. Pouradier and I. Vassias for technical assistance. We also thank M. Beraneck for his helpful comments on the manuscript. This work was supported by grants from the CNRS, Université Paris Descartes, Pierre Fabre Médicament and the CNES. E.I. was supported by the French Foundation for Medical Research.
References
- Baizer JS, Baker JF. Immunoreactivity for calcium-binding proteins defines subregions of the vestibular nuclear complex of the cat. Exp Brain Res. 2005;164:78–91. doi: 10.1007/s00221-004-2211-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Baizer JS, Baker JF. Immunoreactivity for calretinin and calbindin in the vestibular nuclear complex of the monkey. Exp Brain Res. 2006;172:103–113. doi: 10.1007/s00221-005-0318-1. [DOI] [PubMed] [Google Scholar]
- Baurle J, Helmchen C, Grusser-Cornehls U. Diverse effects of Purkinje cell loss on deep cerebellar and vestibular nuclei neurons in Purkinje cell degeneration mutant mice: a possible compensatory mechanism. J Comp Neurol. 1997;384:580–596. [PubMed] [Google Scholar]
- Beraneck M, Hachemaoui M, Idoux E, Ris L, Uno A, Godaux E, Vidal PP, Moore LE, Vibert N. Long-term plasticity of ipsilesional medial vestibular nucleus neurons after unilateral labyrinthectomy. J Neurophysiol. 2003;90:184–203. doi: 10.1152/jn.01140.2002. [DOI] [PubMed] [Google Scholar]
- Beraneck M, Idoux E, Uno A, Vidal PP, Moore LE, Vibert N. Unilateral labyrinthectomy modifies the membrane properties of contralesional vestibular neurons. J Neurophysiol. 2004;92:1668–1684. doi: 10.1152/jn.00158.2004. [DOI] [PubMed] [Google Scholar]
- Bond CT, Maylie J, Adelman JP. SK channels in excitability, pacemaking and synaptic integration. Curr Opin Neurobiol. 2005;15:305–311. doi: 10.1016/j.conb.2005.05.001. [DOI] [PubMed] [Google Scholar]
- Camp AJ, Callister RJ, Brichta AM. Inhibitory synaptic transmission differs in mouse type A and B medial vestibular nucleus neurons, in vitro. J Neurophysiol. 2006;95:3208–3218. doi: 10.1152/jn.01001.2005. [DOI] [PubMed] [Google Scholar]
- Cordero-Erausquin M, Pons S, Faure P, Changeux JP. Nicotine differentially activates inhibitory and excitatory neurons in the dorsal spinal cord. Pain. 2004;109:308–318. doi: 10.1016/j.pain.2004.01.034. [DOI] [PubMed] [Google Scholar]
- De Waele C, Graf W, Josset P, Vidal PP. A radiological analysis of the postural syndromes following hemilabyrinthectomy and selective canal and otolith lesions in the guinea pig. Exp Brain Res. 1989;77:166–182. doi: 10.1007/BF00250579. [DOI] [PubMed] [Google Scholar]
- Dutia MB, Johnston AR. Development of action potentials and apamin-sensitive after-potentials in mouse vestibular nucleus neurones. Exp Brain Res. 1998;118:148–154. doi: 10.1007/s002210050266. [DOI] [PubMed] [Google Scholar]
- Edmonds B, Reyes R, Schwaller B, Roberts WM. Calretinin modifies presynaptic calcium signaling in frog saccular hair cells. Nat Neurosci. 2000;3:786–790. doi: 10.1038/77687. [DOI] [PubMed] [Google Scholar]
- Faulstich BM, Onori KA, du Lac S. Comparison of plasticity and development of mouse optokinetic and vestibulo-ocular reflexes suggests differential gain control mechanisms. Vision Res. 2004;44:3419–3427. doi: 10.1016/j.visres.2004.09.006. [DOI] [PubMed] [Google Scholar]
- Fedrowitz M, Lindemann S, Loscher W, Gernert M. Altered spontaneous discharge rate and pattern of basal ganglia output neurons in the circling (ci2) rat mutant. Neuroscience. 2003;118:867–878. doi: 10.1016/s0306-4522(02)00939-9. [DOI] [PubMed] [Google Scholar]
- Fedrowitz M, Potschka H, Richter A, Loscher W. A microdialysis study of striatal dopamine release in the circling rat, a genetic animal model with spontaneous lateralized rotational behavior. Neuroscience. 2000;97:69–77. doi: 10.1016/s0306-4522(00)00040-3. [DOI] [PubMed] [Google Scholar]
- Gall D, Roussel C, Susa I, D'Angelo E, Rossi P, Bearzatto B, Galas MC, Blum D, Schurmans S, Schiffmann SN. Altered neuronal excitability in cerebellar granule cells of mice lacking calretinin. J Neurosci. 2003;23:9320–9327. doi: 10.1523/JNEUROSCI.23-28-09320.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gallagher JP, Lewis MR, Shinnick-Gallagher P. An electrophysiological investigation of the rat medial vestibular nucleus in vitro. In: Correia MJ, Perachio AA, editors. Progress in Clinical and Biological Research. New York: Alan R. Liss; 1985. pp. 293–304. [PubMed] [Google Scholar]
- Geisler HC, Gramsbergen A. Motor development after vestibular deprivation in rats. Neurosci Biobehav Rev. 1998;22:565–569. doi: 10.1016/s0149-7634(97)00045-6. [DOI] [PubMed] [Google Scholar]
- Guilding C, Dutia MB. Early and late changes in vestibular neuronal excitability after deafferentation. Neuroreport. 2005;16:1415–1418. doi: 10.1097/01.wnr.0000176519.42218.a6. [DOI] [PubMed] [Google Scholar]
- Him A, Dutia MB. Intrinsic excitability changes in vestibular nucleus neurons after unilateral deafferentation. Brain Res. 2001;908:58–66. doi: 10.1016/s0006-8993(01)02600-2. [DOI] [PubMed] [Google Scholar]
- Holme RH, Kiernan BW, Brown SD, Steel KP. Elongation of hair cell stereocilia is defective in the mouse mutant whirler. J Comp Neurol. 2002;450:94–102. doi: 10.1002/cne.10301. [DOI] [PubMed] [Google Scholar]
- Idoux E, Serafin M, Fort P, Vidal PP, Beraneck M, Vibert N, Muhlethaler M, Moore LE. Oscillatory and intrinsic membrane properties of guinea pig nucleus prepositus hypoglossi neurons in vitro. J Neurophysiol. 2006;96:175–196. doi: 10.1152/jn.01355.2005. [DOI] [PubMed] [Google Scholar]
- Jerng HH, Pfaffinger PJ, Covarrubias M. Molecular physiology and modulation of somatodendritic A-type potassium channels. Mol Cell Neurosci. 2004;27:343–369. doi: 10.1016/j.mcn.2004.06.011. [DOI] [PubMed] [Google Scholar]
- Johnston AR, MacLeod NK, Dutia MB. Ionic conductances contributing to spike repolarization and after-potentials in rat medial vestibular nucleus neurones. J Physiol. 1994;481:61–77. doi: 10.1113/jphysiol.1994.sp020419. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kaiser A, Fedrowitz M, Ebert U, Zimmermann E, Hedrich HJ, Wedekind D, Loscher W. Auditory and vestibular defects in the circling (ci2) rat mutant. Eur J Neurosci. 2001;14:1129–1142. doi: 10.1046/j.0953-816x.2001.01726.x. [DOI] [PubMed] [Google Scholar]
- Kevetter GA. Pattern of selected calcium-binding proteins in the vestibular nuclear complex of two rodent species. J Comp Neurol. 1996;365:575–584. doi: 10.1002/(SICI)1096-9861(19960219)365:4<575::AID-CNE5>3.0.CO;2-1. [DOI] [PubMed] [Google Scholar]
- Kevetter GA, Leonard RB. Use of calcium-binding proteins to map inputs in vestibular nuclei of the gerbil. J Comp Neurol. 1997;386:317–327. [PubMed] [Google Scholar]
- Lambolez B, Audinat E, Bochet P, Rossier J. Patch-clamp recording and RT-PCR on single cells. In: Boulton A, Baker G, Walz W, editors. Neuromethods, Patch-Clamp Applications and Protocols. Totowa: Humana Press; 1995. pp. 193–231. [Google Scholar]
- Lessenich A, Lindemann S, Richter A, Hedrich HJ, Wedekind D, Kaiser A, Loscher W. A novel black-hooded mutant rat (ci3) with spontaneous circling behavior but normal auditory and vestibular functions. Neuroscience. 2001;107:615–628. doi: 10.1016/s0306-4522(01)00390-6. [DOI] [PubMed] [Google Scholar]
- Loscher W, Richter A, Nikkhah G, Rosenthal C, Ebert U, Hedrich HJ. Behavioural and neurochemical dysfunction in the circling (ci) rat: a novel genetic animal model of movement disorder. Neuroscience. 1996;47:1135–1142. doi: 10.1016/0306-4522(96)00248-5. [DOI] [PubMed] [Google Scholar]
- Masumura C, Horii A, Mitani K, Kitahara T, Uno A, Kubo T. Unilateral vestibular deafferentation-induced changes in calcium signaling-related molecules in the rat vestibular nuclear complex. Brain Res. 2007;1138:129–135. doi: 10.1016/j.brainres.2006.12.072. [DOI] [PubMed] [Google Scholar]
- Puyal J, Devau G, Venteo S, Sans N, Raymond J. Calcium-binding proteins map the postnatal development of rat vestibular nuclei and their vestibular and cerebellar projections. J Comp Neurol. 2002;451:374–391. doi: 10.1002/cne.10366. [DOI] [PubMed] [Google Scholar]
- Richter A, Ebert U, Nobrega JN, Vallbacka JJ, Fedrowitz M, Loscher W. Immunohistochemical and neurochemical studies on nigral and striatal functions in the circling (ci) rat, a genetic animal model with spontaneous rotational behavior. Neuroscience. 1999;89:461–471. doi: 10.1016/s0306-4522(98)00321-2. [DOI] [PubMed] [Google Scholar]
- Ris L, Godaux E. Neuronal activity in the vestibular nuclei after contralateral or bilateral labyrinthectomy in the alert guinea pig. J Neurophysiol. 1998;80:2352–2367. doi: 10.1152/jn.1998.80.5.2352. [DOI] [PubMed] [Google Scholar]
- Rivas A, Francis HW. Inner ear abnormalities in a Kcnq1 (Kvlqt1) knockout mouse: a model of Jervell and Lange–Nielsen syndrome. Otol Neurotol. 2005;26:415–424. doi: 10.1097/01.mao.0000169764.00798.84. [DOI] [PubMed] [Google Scholar]
- Roussel C, Erneux T, Schiffmann SN, Gall D. Modulation of neuronal excitability by intracellular calcium buffering: From spiking to bursting. Cell Calcium. 2006;39:455–466. doi: 10.1016/j.ceca.2006.01.004. [DOI] [PubMed] [Google Scholar]
- Sans N, Moniot B, Raymond J. Distribution of calretinin mRNA in the vestibular nuclei of rat and guinea pig and the effects of unilateral labyrinthectomy: a non-radioactive in situ hybridization study. Brain Res Mol Brain Res. 1995;28:1–11. doi: 10.1016/0169-328x(94)00181-d. [DOI] [PubMed] [Google Scholar]
- Scharf SJ, Horn GT, Erlich HA. Direct cloning and sequence analysis of enzymatically amplified genomic sequences. Science. 1986;233:1076–1078. doi: 10.1126/science.3461561. [DOI] [PubMed] [Google Scholar]
- Schwaller B, Meyer M, Schiffmann S. ‘New’ functions for ‘old’ proteins: the role of the calcium-binding proteins calbindin D-28k, calretinin and parvalbumin, in cerebellar physiology. Studies with knockout mice. Cerebellum. 2002;1:241–258. doi: 10.1080/147342202320883551. [DOI] [PubMed] [Google Scholar]
- Sekirnjak C, du Lac S. Physiological and anatomical properties of mouse medial vestibular nucleus neurons projecting to the oculomotor nucleus. J Neurophysiol. 2006;95:3012–3023. doi: 10.1152/jn.00796.2005. [DOI] [PubMed] [Google Scholar]
- Serafin M, de Waele C, Khateb A, Vidal PP, Muhlethaler M. Medial vestibular nucleus in the guinea-pig. I. Intrinsic membrane properties in brainstem slices. Exp Brain Res. 1991a;84:417–425. doi: 10.1007/BF00231464. [DOI] [PubMed] [Google Scholar]
- Serafin M, de Waele C, Khateb A, Vidal PP, Muhlethaler M. Medial vestibular nucleus in the guinea-pig. II. Ionic basis of the intrinsic membrane properties in brainstem slices. Exp Brain Res. 1991b;84:426–433. doi: 10.1007/BF00231465. [DOI] [PubMed] [Google Scholar]
- Straka H, Vibert N, Vidal PP, Moore LE, Dutia MB. Intrinsic membrane properties of vertebrate vestibular neurons: function, development and plasticity. Prog Neurobiol. 2005;76:349–392. doi: 10.1016/j.pneurobio.2005.10.002. [DOI] [PubMed] [Google Scholar]
- Uno A, Idoux E, Beraneck M, Vidal PP, Moore LE, Wilson VJ, Vibert N. Static and dynamic membrane properties of lateral vestibular nucleus neurons in guinea pig brain stem slices. J Neurophysiol. 2003;90:1689–1703. doi: 10.1152/jn.00201.2003. [DOI] [PubMed] [Google Scholar]
- Vetter DE, Mann JR, Wangemann P, Liu J, McLaughlin KJ, Lesage F, Marcus DC, Lazdunski M, Heinemann SF, Barhanin J. Inner ear defects induced by null mutation of the isk gene. Neuron. 1996;17:1251–1264. doi: 10.1016/s0896-6273(00)80255-x. [DOI] [PubMed] [Google Scholar]
- Vibert N, Bablian A, Serafin M, Gasc JP, Muhlethaler M, Vidal PP. Plastic changes underlying vestibular compensation in the guinea-pig persist in isolated, in vitro whole brain preparations. Neuroscience. 1999a;93:413–432. doi: 10.1016/s0306-4522(99)00172-4. [DOI] [PubMed] [Google Scholar]
- Vibert N, Bablian A, Bantikyan A, Serafin M, Muhlethaler M, Vidal PP. Post-lesional plasticity in the central nervous system of the guinea-pig: a “top-down” adaptation process? Neuroscience. 1999b;94:1–5. doi: 10.1016/s0306-4522(99)00323-1. [DOI] [PubMed] [Google Scholar]
- Vidal PP, Degallaix L, Josset P, Gasc JP, Cullen KE. Postural and locomotor control in normal and vestibularly deficient mice. J Physiol. 2004;559:625–638. doi: 10.1113/jphysiol.2004.063883. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Warth R, Barhanin J. The multifaceted phenotype of the knockout mouse for the KCNE1 potassium channel gene. Am J Physiol Regul Integr Comp Physiol. 2002;282:R639–R648. doi: 10.1152/ajpregu.00649.2001. [DOI] [PubMed] [Google Scholar]
- Zirpel L, Lachica EA, Lippe WR. Deafferentation increases the intracellular calcium of cochlear nucleus neurons in the embryonic chick. J Neurophysiol. 1995;74:1355–1357. doi: 10.1152/jn.1995.74.3.1355. [DOI] [PubMed] [Google Scholar]