Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2008 Apr 3.
Published in final edited form as: Nat Neurosci. 1999 Jun;2(6):528–534. doi: 10.1038/9183

Target-specific control of nicotinic receptor expression at developing interneuronal synapses in chick

P Devay 1, D S McGehee 1,2, C R Yu 3, L W Role 1
PMCID: PMC2280032  NIHMSID: NIHMS40670  PMID: 10448217

Abstract

Neuronal differentiation and development of synaptic specializations are strongly influenced by cellular interactions. We compared the effects of interaction with distinct autonomic targets on the molecular and biophysical differentiation of ‘upstream’ neuron–neuron synapses. Contact with cardiac tissue induced expression of nicotinic receptor channels (nAChRs) distinct from those induced by renal tissue in presynaptic autonomic neurons. The kinetics of cholinergic currents at interneuronal synapses are dictated by the peripheral target contacted. Analysis of the nAChR channel subtypes and subunits in individual neurons demonstrated that the profile of transmitter receptors expressed at mature neuron–neuron synapses develops from the convergent influences of input-derived (anterograde) and target-specific (retrograde) signals.

The formation, maintenance and remodeling of synapses involves regulated expression and targeting of specific transmitter receptors to sites of cellular contact. Presynaptic input and input-derived signals are potentially important regulators of receptor expression at neuron–neuron synapses. In particular, expression of specific subtypes of neuronal ionotropic glutamate and acetylcholine receptors are controlled by synaptic activity and/or neuregulin-type growth factors1,2.

When chick sympathetic neurons establish contact with their pre- and postsynaptic partners during embryonic development, the magnitude of inward current responses to acetylcholine (ACh) increases, the number, localization and biophysical profile of nAChR channels are altered, and mRNA levels for the predominant nAChR subunits (α3, α5, α7, β4) are upregulated3,4. Despite the general enhancement of nicotinic responses evident with ganglionic development in vivo, sympathetic neurons are heterogeneous in the levels and subtypes of nAChRs expressed3,4. Differences in receptor expression may be due to distinct, target-derived influences5,6, as neurons within individual ganglia innervate a variety of peripheral targets. In-vivo studies reveal aberrant receptor expression by autonomic neurons deprived of target contact7,8. Innervation of sympathetic neurons in vitro in the absence of target tissues reproduces only a subset of the changes that are observed with development in vivo9-11. The current study demonstrates retrograde, target-specific regulation of the levels and functional profile of receptors expressed at antecedent interneuronal synapses.

RESULTS

To test whether target contact alters the profile of nAChRs expressed by innervated autonomic neurons, we examined the nicotinic responses of embryonic chick sympathetic neurons innervated in vitro by explants of the pre-ganglionic, visceral motor nucleus (VMN) and cocultured with cardiac or renal target tissue. We first tested whether nicotinic transmission at VMN–sympathetic neuron synapses was altered by concurrent innervation of peripheral targets. Examination of spontaneous postsynaptic currents (sEPSCs) recorded in sympathetic neurons revealed differences in nAChR-mediated transmission depending on the presence or absence of target and on the particular target tissue contacted. In neurons contacting kidney, sEP-SCs were somewhat larger than those recorded in innervated neurons lacking target and were considerably larger and faster than those detected at synapses formed in the presence of cardiac explants (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Spontaneous synaptic currents from individual innervated sympathetic neurons: effect of target interactions. (a) Schematic diagram of cellular interactions and recording configurations (above); sample recordings from three innervated sympathetic neurons maintained in vitro in the presence or absence of the indicated targets (below). Synaptic currents were recorded from (left to right) an innervated sympathetic neuron in the absence of target tissue (input + SNs), an innervated sympathetic neuron contacting renal tissue (input + SNs + kidney) and an innervated sympathetic neuron contacting cardiac tissue (input + SNs + heart). Scale bar, 40 pA, 40 ms. (b) Histograms of the sEPSC amplitudes from the same three neurons (above). The sEPSC amplitude distributions are skewed, precluding the use of mean amplitude as a representative measure of sEPSC size. Cumulative amplitude distributions of the sEPSCs recorded from the same three neurons (below). The area of each distribution is calculated to yield an ‘amplitude index’ for each cell (see Methods). Amplitude indices for these three cells are 24.3, 38.7 and 8.9 respectively. (c) Distributions of the decay time constants of the sEPSCs recorded from the same three neurons.

We extended our analysis of the effects of target contact on nicotinic receptors and nAChR-mediated transmission at VMN–sympathetic neuron synapses. First, focusing on whether specific targets might differentially control expression of transmitter receptors by innervated sympathetic neurons, we assayed both ACh-evoked macroscopic currents and nAChR-mediated synaptic currents (Fig. 2). As shown previously, innervation of sympathetic neurons without target contact increased the number and altered the profile of expressed nAChR subtypes (refs. 2, 10 and D.S.M., P.D., L.W.R. & A.B. Brussard, unpublished data) Comparison of nAChR-mediated currents in innervated neurons contacting kidney, heart or no target revealed target-specific changes in nicotinic currents (n = 29, n = 31, n = 33, respectively; Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

Target-specific regulation of nAChR-mediated macroscopic and synaptic currents. Effects of target contact on synaptic nAChRs were examined in innervated neurons without target (n = 33), contacting kidney (n = 29) and contacting heart (n = 31). (a) ACh-evoked macroscopic currents recorded in innervated sympathetic neurons without target or in those contacting either renal or cardiac target tissue. Responses of innervated neurons lacking target were similar to those of neurons contacting cardiac tissue; their distributions were unimodal with means of 949 ± 143 pA (χ2 = 0.6, n = 17) and 785 ± 53 (χ2 = 0.3, n = 13), respectively. In contrast, the distribution of ACh-elicited macroscopic currents of innervated neurons contacting renal tissue was bimodal; most responses were significantly larger than those recorded in innervated neurons with or without target contact (1760 ± 39 pA; n = 7 of 11, χ2 = 0.02). (b) sEPSC amplitude index values for innervated sympathetic neurons maintained without target (top) or with either renal (middle) or cardiac tissue (bottom) are shown. The amplitude index distribution for targetless, innervated neurons was well fit by the sum of two Gaussian distributions, with 87% of the values within the first peak centered at 20.1 ± 0.6 (χ2 = 0.44). The distribution of sEPSC amplitude indices for innervated neurons contacting kidney was multimodal, with 52% of the values in the first and 34% in the second Gaussian peak (at 15.9 ± 1.6 and at 35.8 ± 1.6 respectively; χ2= 1.04) and 14% of the values ≥ 50. In contrast, the distribution of the amplitude index values for innervated neurons contacting heart was described by a single log-normal distribution centered at 11.63 ± 0.83 (χ2 = 0.61). (c) Plots of the decay time constants (τsyn) of sEPSCs recorded in innervated neurons contacting kidney or heart or in the absence of target. The time constants of synaptic events recorded in targetless neurons and in neurons contacting kidney reflect uniformly fast nAChR kinetics (no target, τsyn = 2.08 ± 0.05; n = 1546, χ2= 2.8; +kidney, τsyn = 2.23 ± 0.03, n = 2258, χ2 = 2.8). In contrast, sEPSCs in most neurons contacting heart reflect roughly equal contributions of both fast and slow events (48%, τf = 2.09 ± 0.03 ms; 42%, τs1 = 16.9 ± 0.8 ms) with the slowest synaptic currents (τs2 = 37.1 ± 3 ms) making up 9% of the currents recorded (n = 699; χ2 = 0.9).

Macroscopic currents elicited by maximal concentrations of ACh give a gross measure of nAChR expression. The ACh-evoked currents of innervated sympathetic neurons contacting kidney were approximately threefold larger than those of innervated neurons contacting heart. In innervated neurons maintained without target, macroscopic currents were intermediate between those of innervated neurons contacting kidney and those contacting heart (Fig. 2a).

To refine our analysis, we examined both synaptic physiology and nAChR-subunit gene expression in individual innervated neurons contacting either heart or kidney (Figs. 2b and c and 3). By assaying nAChR physiology and subunit gene expression in the same neuron, these experiments tested for target-specific regulation of both synaptic nAChR expression and associated nicotinic currents. The properties of synaptic nAChRs were assayed by analysis of the sEPSCs, as direct recording of single-channel currents at synaptic sites is not possible.

Fig. 3.

Fig. 3

Open in a new tab

Synaptic nAChR channel properties and subunit gene expression are regulated by target. After electrophysiology (Fig. 2), levels of nAChR subunit mRNA of each neuron were measured by quantitative PCR. (a) Effects of renal or cardiac target on nAChR expression. Innervated neurons with or without kidney target are characterized by uniformly fast kinetic sEPSCs and by significantly higher α3 and α7 and lower β4 expression than innervated neurons with both fast and slow kinetic synaptic events (that is, those contacting heart). Relative expression levels of α3 to α5 + α7 + β4 in individual innervated neurons with fast sEPSCs (+ kidney) are compared with those with both fast and slow τsyn (+heart). Data were analyzed using non-parametric statistics and are presented as ‘box plots’ (see Methods). (b) Relationship between nAChR-subunit expression and sEPSC amplitude in innervated neurons with or without different targets. In innervated neurons either lacking target or contacting kidney, amplitude index values are positively correlated with ratio of α3/(α5 + β4); r = 0.93 and 0.97, respectively). In contrast, the ratio of α3 to α5 and β4 is low in neurons contacting heart, regardless of sEPSC amplitude index. Likewise, the ratio of α3/α5 is positively correlated with amplitude index in innervated neurons contacting kidney, whereas this ratio is constant over the full range of amplitudes in innervated neurons contacting heart. (c) Target regulation of nAChR subunit expression in innervated neurons. Innervated neurons contacting kidney have significantly higher ratios of α3 to α5 and/or to β4 than innervated neurons contacting cardiac tissue. *p ≤ 0.01; **p ≤ 0.002.

Renal or cardiac tissue had opposite effects on amplitude distribution of interneuronal sEPSCs at synapses onto neurons contacting these target tissues (Fig. 2b). An sEPSC amplitude index was calculated for each synaptic pair from cumulative amplitude histograms of ~100 events (see Methods). The distribution of sEPSC amplitude indices of all innervated, kidney-contacting neurons were fit by summed Gaussian distributions with 52% of indices in the first mode, 34% in the second (centered at 15.9 ± 1.6 and 35.8 ± 1, respectively) and 14% of indices ≥ 50. In contrast, the amplitude indices for innervated neurons contacting heart were described by a single log-normal distribution centered at 11.63 ± 0.83. Thus, sEPSCs in innervated neurons contacting cardiac tissue were significantly smaller than those recorded in innervated neurons contacting kidney. Amplitude indices of synaptic currents recorded in targetless, innervated neurons were intermediate in the overall distribution, with 87% falling within the first peak of a bimodal, Gaussian distribution. Thus, the amplitudes of spontaneous synaptic currents recorded at VMN–sympathetic neuron synapses differed depending on the specific target tissue contacted by the sympathetic neuron.

Synaptic current decay kinetics (τsyn, a measure of synaptic nAChR opening duration) were also differentially regulated by contact with heart or with kidney tissue (Fig. 2c). In >80% of sympathetic neurons contacting kidney or lacking target contact, sEPSC analysis indicated fast open-time kinetics for nAChRs at these neuron–neuron synapses. In contrast, sEPSCs recorded in most neurons contacting heart were best fit by a combination of both fast and slow components, consistent with a mix of brief- and long-duration synaptic nAChR channels.

We tested whether differences in sEPSC amplitude and kinetics are due to differences in the profile of synaptic nAChR complexes and, as such, might be reflected in altered patterns of nAChR-subunit gene expression (Fig. 3). We measured levels of nAChR subunit mRNAs in each neuron by a quantitative PCR (qPCR) assay in which products were generated within the linear range of amplification. Confirming previous studies in vivo5 in cultured embryonic day 9 (E9) sympathetic neurons, α3, α5, α7 and β4 subunits predominated.

Quantitation of nAChR subunit mRNAs in individual innervated neurons following electrophysiology revealed correlated changes in gene expression and biophysical properties of the synaptic nAChRs. Levels of α3 and α7 in neurons with uniformly fast synaptic currents (that is, innervated neurons without target or with kidney contact) were significantly higher than in neurons with both fast and slow currents (that is, innervated neurons contacting heart). Furthermore, innervated neurons contacting heart that had slow synaptic nAChRs expressed significantly higher levels of β4 (Fig. 3a).

Previous studies demonstrated that autonomic neurons express a variety of nAChR complexes with distinct physiological profiles and subunit compositions6,7,9,12-19. In view of the contribution of the α3 subunit to these heteromeric receptors, we examined whether levels of α3 relative to those of α5, α7 and/or β4 might correlate with the differences in physiological profiles of synaptic nAChRs between innervated neurons contacting kidney and those with cardiac targets. Analysis of the ratio of α3 mRNA relative to α5, α7 and β4 mRNAs revealed statistically significant, target-specific regulation of nAChR gene expression. Changes in nAChR subunit mRNAs were co-regulated with changes in the synaptic nAChR current kinetics induced by different target tissues (renal versus cardiac; Fig. 3a). The co-ordinate decline in the relative levels of α3 versus α5, α7 or β4 subunits and the increase in the slow sEPSC contribution in sympathetic neurons innervating heart suggest target-specific induction of long-open-duration synaptic nAChRs that differ in subunit composition from nAChRs at interneuronal synapses on cells contacting kidney or without target.

Differences between innervated neurons contacting kidney and those contacting heart in the amplitude of nAChR-mediated synaptic current were also reflected in distinct expression profiles of nAChR subunit genes (Fig. 3b). Measurement of absolute levels of α3 and ratios of α3 to α5 and to β4 revealed positive correlations with sEPSC amplitude in innervated neurons contacting kidney. In contrast, in innervated neurons contacting heart, relative expression level of α3 either to α5 or to α5 plus β4 was constant, regardless of sEPSC amplitude. For innervated neurons without target, the curve of α3/α5 ratio versus sEPSC amplitude index was intermediate between that of innervated neurons contacting kidney and that of neurons contacting heart. This finding suggests that, in addition to the regulatory influence of innervation alone, each target tissue differentially regulates the profile of synaptic nAChRs2,7,9.

The above analysis focuses on the distinct effects of peripheral targets on both the profile of synaptic nAChR channels and the levels of nAChR subunit gene expression by upstream, innervated neurons. The regulation of nAChR expression by each target is sufficiently distinct that comparison of subunit gene expression, independent of physiological profile, also reveals significant differences in nAChR expression (Fig. 3c). Thus, the ratio of α3 expression to that of β4 and α5 is approximately threefold higher in innervated neurons contacting renal tissue compared to those contacting heart. Higher levels of α3 than α5 may determine the nAChR profile expressed by sympathetic neurons following synaptogenesis (Fig. 3c).

To distinguish from effects of target on receptor expression, we examined target-induced changes in neuronal nAChRs independent of presynaptic input. In these experiments, sympathetic neurons were maintained in vitro in the presence of renal or cardiac tissue targets but without presynaptic input. This allowed direct assay of the biophysical properties of nAChR channels in neurons with or without target (Fig. 4a and b). Kidney contact increased the amplitude of ACh-evoked macroscopic currents and induced the expression of high-conductance, brief-open-duration nAChR channels that were not detected in targetless sympathetic neurons (Fig. 4a and b). Two conductance classes (~35 pS and ~70 pS) dominated the single-channel amplitude histograms of non-innervated neurons contacting kidney. Consistent with expression of a large number of low-affinity nAChRs, channel activity showed little decline during patch recordings. Likewise, increasing ACh concentration from 500 μM to 2.5 mM—normally a supramaximal concentration—elicited further increases in macroscopic current amplitude in neurons contacting kidney (Fig. 4a and b and data not shown).

Fig. 4.

Fig. 4

Open in a new tab

Target contact differentially regulates the profile of nAChR channels and subunit gene expression in non-innervated sympathetic neurons. (a) Schematic diagram of cellular interactions and recording configurations (above) and sample macroscopic currents elicited by 2.5 mM ACh (below) from non-innervated sympathetic neurons maintained in the absence of target (SNs alone), neurons contacting kidney (SNs + kidney) and neurons contacting heart (SNs + heart). Amplitudes of currents evoked by 500 μM ACh were significantly larger in neurons contacting renal tissue (n = 27) than those elicited in neurons maintained without target (n = 49, p < 0.001). In contrast, macroscopic currents recorded in neurons contacting cardiac tissue are significantly smaller than control (n = 19, p < 0.004). Increasing ACh concentration from 500 μM to 2.5 mM significantly increased current in neurons with kidney, but had little effect under other culture conditions. Data were analyzed using non-parametric statistics and are presented as box plots (see Methods). Note the difference in scale on amplitude axes. (b) Uninnervated sympathetic neurons express three nAChR channel subtypes classified on the basis of distinct chord conductances, pharmacology and kinetics9,23,24. Representative traces from single-channel recordings in the three experimental groups (top). The peaks in the amplitude distributions from control neurons correspond to ~15, 30 and 50 pS nAChR channels (n = 11; bottom). Neurons contacting kidney express two major conductance classes with relatively brief opening times: one 30–35 pS and the other ≥ 70 pS (n = 25)9,23,24. In contrast, neurons contacting heart primarily express longer-duration nAChRs of ≲15 pS (n = 9). (c) The levels of nAChR subunit gene expression were measured in 30–40 neurons per experiment by qPCR of cytoplasmic RNA (see Methods and Fig. 5) and were plotted relative to actin mRNA levels. We assayed neurons contacting kidney (n = 8), contacting heart (n = 9) and without target (n = 15). Contact with kidney significantly increased α3, α5 and β4 from control (targetless) levels. In contrast, contact with cardiac tissue had little effect on α3 mRNA levels but significantly upregulated α5, α7 and β4 expression. *p ≤ 0.01; **p ≤ 0.001; ***p ≤ 0.0001.

The profile of nAChR single-channel currents recorded in neurons contacting cardiac tissue explants contrasted markedly with those obtained in targetless neurons or those with renal targets. The vast majority of nAChR opening events in patches from neurons innervating heart were of considerably longer duration than those detected in neurons contacting kidney and had low conductance (~15 pS; Fig. 4b).

Significant increases in the levels of expression of α3, α5 and β4 were revealed by qPCR analysis of nAChR-subunit mRNAs in all neurons contacting renal explants. Contact with cardiac target upregulated the expression of α5, α7 and β4 without affecting α3 expression (Fig. 4c).

Preliminary studies suggest that distinct mechanisms underlie differential effects of target on nicotine receptor expression. Application of a cardiac membrane fraction to input- and target-naive sympathetic neurons mimicked the effects of heart coculture on nAChR expression, whereas soluble cardiac-derived factor(s) were without effect (for example, IAch + heart membrane, 475 ± 62 pA, n = 18 versus neurons alone, 744 ± 66 pA, n = 29). In contrast, neither soluble nor membrane-bound renal factors mimicked kidney contact (not shown). Analysis of potential mechanisms underlying the regulation of nAChR expression by kidney suggests that synaptic interaction between sympathetic neurons and renal target is required. Concurrent addition of α-and β-adrenergic receptor antagonists to sympathetic neuron–kidney cocultures eliminated inductive effects of kidney on nAChR subunit profile (for example, α3 mRNA in SNs + kidney, 240 ± 30% of control; in SNs + kidney + adrenergic blockers, 105 ± 10% of control, n = 3).

DISCUSSION

The principal conclusion of this study is that nAChR subunit expression is differentially regulated by target-derived signals. We further demonstrated that this target-specific regulation of nAChR channels occurs at both synaptic and non-synaptic sites. Changes in nAChR subunit expression in innervated and non-innervated neurons suggest that target-dependent regulation of neuronal nAChRs involves alterations in the subunit composition of both synaptic and non-synaptic nAChR complexes.

Neuronal nAChR channels expressed by sympathetic ganglion neurons can be distinguished on the basis of biophysics and/or pharmacology. Although post-translational mechanisms may contribute to functional diversity of native nAChRs, various combinations of recombinant subunits yield nAChR channels with distinct conductance and kinetic properties12,13. Thus alterations in levels of expression and/or assembly of specific nAChR subunits may underlie observed changes in synaptic and non-synaptic nAChR physiology.

The α3 subunit seems to be a key component of the various nAChR subtypes expressed by autonomic neurons14-17. Studies in heterologous systems indicate that homomeric and heteromeric complexes of α7 subunits can be formed18,19. In addition, inclusion of α5 in hetero-oligomeric nAChRs comprising other α and β subunits yields receptors with lower agonist affinity and larger conductance20-24. In view of the diversity of potential nAChR subunit combinations, what might the current findings reveal about the composition of the physiologically distinct nAChRs induced by contact with distinct target tissues? Both targets induced significant changes relative to controls in the levels and profile of nAChRs expressed in synaptically naive sympathetic neurons. Induction of a novel class of high-conductance, brief-opening nAChRs, expression of receptors with low apparent affinity and significant upregulation of α3, α5 and β4 are consistent with a substantial increase in the number of α5-containing nAChR complexes in neurons contacting kidney. The expression of all but the smallest conductance class of nAChRs recorded in controls was suppressed in neurons contacting heart, despite increased levels of expression of α5, α7 and β4.

The key feature of the profile of subunit gene expression in neurons contacting heart may be the lack of induction of α3, rather than the increased level of expression of α5, α7 and β4. Thus, if α3 is a required component of nAChR complexes, and if its incorporation into more than one subtype of channel requires its expression in relative excess compared with other subunits, then only a single class of complexes might be formed. We propose that α3 co-assembles preferentially with β4 relative to α5. Thus, in sympathetic neurons contacting cardiac tissue, the predominant complex formed is a small-conductance channel comprising α3 and β4. Likewise, we propose that, by increasing relative α3 expression, contact with kidney expands the nAChR subtypes expressed to include α5-containing complexes in addition to the more-favored α3/β4 complexes. Thus, the novel ~70 pS channels detected in neurons contacting renal tissue may represent α5-containing nAChRs. In sum, we propose that a surplus of α3 supports assembly of less-favored nAChR complexes, even when the levels of α5, α7 and/or β4 are also increased by target contact.

Synaptic currents recorded from innervated neurons contacting kidney differed from those recorded in innervated neurons contacting heart. Likewise, the profile of subunit expression significantly differed between these two conditions. In particular, both absolute levels of α3 and the ratios of α3 to α5, α7 and β4 were significantly higher in innervated neurons contacting kidney than in those contacting heart. Although specific subunit compositions of nAChRs expressed by innervated neurons are unknown, comparison of nAChR subunit expression with the physiological properties of the synaptic nAChRs clearly indicates co-ordinate and differential regulation of both parameters by target contact.

In the context of previous work, the current findings support models of target-induced changes in neuronal nicotinic receptors. First, previous single-channel and single-subunit deletion studies indicate that the 15 pS channel, which dominates the nAChR profile in non-innervated sympathetic neurons contacting heart, includes only α3 and β4 subunits15,20,22,23. Second, previous single-channel, subunit-deletion and heterologous expression studies indicate that the inclusion of α5 in nAChR complexes yields receptors with large conductance, brief open-duration and low agonist sensitivity18,21-23. The increased number of large-amplitude sEPSCs recorded in sympathetic neurons contacting kidney is also consistent with enhanced inclusion of α5 in synaptic nAChRs. Furthermore, studies of recombinant nAChR channels in heterologous expression systems suggest that assembly of functional nAChRs from simple α/β pairs is more efficient than formation of α/β complexes that include α518,21-23. Finally, the most striking evidence for target-dependent specification of nAChR channels at ganglionic synapses is the distinct kinetics of sEPSCs recorded in innervated neurons contacting heart versus those of sEPSCs in neurons contacting kidney. Slow components of synaptic currents recorded in innervated neurons contacting heart reflect the prolonged open-time kinetics of the underlying channels. Such channels with long open duration are detected neither in non-innervated neurons or in innervated neurons maintained in the absence of target (Fig. 2)6,11. In contrast, nAChR channels with τo ≥ 15 ms are expressed by acutely dispersed neurons taken from animals at developmental stages at which both presynaptic input and target contact are established in vivo9,18,20.

In conjunction with previous studies, these results demonstrate that both target and input control the expression of nicotinic receptors at interneuronal synapses—the former by retrograde, as yet unidentified signals5,7 and the latter via anterograde factors that likely include neuregulins2,7,10. This study demonstrates that target tissues differentially control neurotransmitter receptor profiles at ‘upstream’ neuron–neuron synapses. Retrograde influence of peripheral targets on the strength of synaptic inputs is a striking example of how neuronal circuits and synaptic efficacy can be tailored to the specific functions they serve.

METHODS

Primary cultures

Sympathetic neurons from E9 chick embryos were cultured as described10. Presynaptic input was provided by addition of microexplants of the dorsal portion of chick E8 spinal cord11.

Cardiac tissue was dissected from E11 chick embryos, teased into ~0.5-mm pieces and added to neuronal cultures after two days in vitro. Maintenance of a differentiated phenotype was assessed by immunohistochemistry using an anti-desmin antibody (Boehringer Mannheim). Synaptic interactions between individual sympathetic neurons and cardiocytes were confirmed by increased ‘beating’ rate with depolarization of the sympathetic input.

Renal tissue was dissected from E14 chick embryos, gently dispersed by two strokes in a homogenizer with a loose pestle and added to the dispersed neuronal cultures two days after plating. Integrity of the renal explants was confirmed by immunohistochemical staining with antibodies to keratin (keratin AE3; Boehringer Mannheim) and epithelial adhesion molecules prominently expressed in kidney (L-CAM, Sigma). Chick sympathetic neurons maintained in vitro retain their adrenergic phenotype and do not form functional synapses with one another whether alone or co-cultured with presynaptic input (ref. 10 and unpublished data) and/or with either cardiac or renal tissue explants (see below and data not shown).

PCR assays

Levels of nAChR subunit mRNAs were quantified relative to β-actin mRNA by PCR assay of single cell or multiple cell extracts. Assays were carried out in the linear range of amplification (Fig. 4). The cytoplasm of ~30 neurons (the target contact studies) or individual neurons was removed by applying negative pressure to a patch electrode. RNA was collected from the samples by breaking the pipet tip in an Eppendorf tube containing reaction buffer. mRNA was reverse-transcribed directly in 30 μl final volume for collected neurons by 300 U SuperScript II (GibcoBRL) in the presence of 40 U RNasin (Promega), 20 μM random hexamers (GibcoBRL) and 0.5 μM of each dNTP for 1 h at 37°C. For assay of individual neurons, reverse transcription was scaled down to 5 μl final volume. An aliquot of cDNA was amplified for 2 × 35 cycles in 50 μl with 0.5 U taq Polymerase (Boehringer Mannheim), in the presence of 1 μM of sense and antisense primers, 200 μM of each dNTP, including [α-32P] dATP and 1.5 mM MgCl2 (94°C, 30 s; 45°C, 30 s; 72°C, 45 s) carrying over 10 μl of the amplification reaction. cDNA from single cells was amplified in a third round of 20 cycles. PCR products were separated from the unincorporated radioactivity by electrophoresis. DNA bands were excised, and incorporated radioactivity was quantified in a scintillation counter. Relative amplification efficiencies of each subunit cDNA were determined in control reactions, and mRNA measurements were corrected accordingly. Efficiency of amplification depends on the primer-template interaction, that is, n = N0En, where N is the amount of product, N0 is the amount of template, E is the efficiency and n is the number of cycles. The amplification efficiencies for the nAChR subunit cDNAs relative to α3 were 2.63 for α5, 1.62 for α7 and 1 for β4.

Primers, their sequence position and sequence references in GenBank were as follows: actin (L08165) sense (860)ATCTTTCTTGGGTATGGA, antisense (1135)ACATCTGCTGGAAGGTGG; α3 (ref. 25) sense (897) CAGAACACCCAAGACACA, antisense (1390)TGAAAATGAAAACAGAGG; α5(J05642) sense (480)AACCTTCTTTCCCTTTGACC, antisense (1083) TTCCTTTTTTCCTCCTTCTGA; α7 (X52295) sense (974)GGGGAAAAATGCCTAAAT, antisense (1478) GACAGCCTCTACAAAGTT; β4 (J05643) sense (745)TATCCGTGCTGCTTGCTTTG, anti-sense (1256)CACTCTGGTCGTTGTCATCA.

Electrophysiology

Whole-cell recording and single-channel recording used the patch-clamp technique26. For whole-cell recording, the internal solution included 150 mM KCl, 2 mM MgCl2, 10 mM HEPES, and 1 mM EGTA at pH 7.2, supplemented with 5 mM Mg-ATP and 0.3 mM GTP. External solutions were composed of 140 mM NaCl, 3 mM KCl, 1 mM MgCl2, 1 mM CaCl2, and 10 mM HEPES at pH 7.2. ACh at 500 μM or 2.5 mM was dissolved in external solution and was applied by focal pressure ejection within 10 μm of the soma. The holding potential in whole-cell voltage-clamp recordings was set to –60 mV. Single-channel recordings used the cell-attached configuration with pipets containing external solution with 2.5 μM ACh. All recordings were carried out in the presence of 2 μM TTX. Synaptic currents were blocked by 50 μM mecamylamine, consistent with nAChR-mediated synaptic transmission (data not shown). Sampling of individual sEPSCs was carried out using analysis software written in Axobasic by A. Kyrozis and modified by R. Girod. Analysis was limited to events with rise times of < 3 ms. The decay time constants for sEPSCs were determined using the Simplex algorithm. Cumulative amplitude distributions for each cell were analyzed by plotting the amplitude of each event versus the fraction of total sEPSCs larger than that event. Area beneath the curve was integrated to provide an assessment of the sEPSC amplitude for each neuron (amplitude index) and to permit comparison among cells.

Statistical analysis

Amplitude index and synaptic current distributions were analyzed with Micrococal Origin. Normally distributed data of equal sample size were assessed for statistical significance by t-test. Some of the data are presented using non-parametric analysis, as the raw data do not conform to a normal distribution (Kolmogorov-Smirnov, Lilliefors test on standardized data, NPAR module of Systat and non-parametric algorithms in Micrococal Origin27). In this format, each box includes all the data points of an experimental group. The bottom symbol shows the minimum value of the data group, the second symbol marks the first percentile, and the bottom of the vertical line marks the fifth percentile. The box denotes the range of data within the middle 50%; the bottom marks the twenty-fifth percentile, the middle line the fiftieth (nearest symbol indicates arithmetic mean) and the top, the seventy-fifth percentile. The top of the vertical line marks the ninety-fifth percentile, and symbols above it indicate the ninety-ninth and one-hundreth percentiles. Following the required log–linear transformation, statistical significance was evaluated by ANOVA with a post-hoc test for multiple comparisons and group means with unequal sample size. Unless otherwise noted, the asterisk (*) indicates statistical significance at the p < 0.02–0.001 level in between-group comparisons.

Fig. 5.

Fig. 5

Open in a new tab

Characterization of qPCR assay used to measure α3, α5, α7 and β4 mRNA levels in individual neurons. (a) Above, an agarose gel showing the amplified actin, α3, α5, α7 and β4 PCR products from a single innervated neuron. Below, agarose gel of a standard curve of PCR products amplified from decreasing amounts of subunit cDNAs. (b) Amplification of subunit mRNAs from a single neuron for 2 × 35 + 1 × 20 cycles yields DNA product within the linear range of standard curves generated with 0.05 to 1 fg of template. (c) Standard curve over the entire range. Amplified product was quantified based on [32P]dNTP incorporation.

Acknowledgments

We thank P. Flood for help in initial aspects of these studies, M. Kopal and A. Tang for technical assistance, J. Turner for editorial assistance and our colleagues S. Siegelbaum and A. MacDermott for comments on this work. We also thank N. Mendell for mathematical statistics consults and D. Talmage for detailed review of molecular methods and analyses. This work was supported by NS29071 to L.W.R. and P.D. and by NS35090 to D.S.M.

References

  • 1.Ozaki M, Sasner M, Yano R, Lu HS, Buonanno A. Neuregulin-beta induces expression of an NMDA-receptor subunit. Nature. 1997;390:691–694. doi: 10.1038/37795. [DOI] [PubMed] [Google Scholar]
  • 2.Yang X, Kuo Y, Devay P, Yu C, Role L. A cysteine-rich isoform of neuregulin controls nicotinic receptor expression in neurons during synaptogenesis. Neuron. 1998;20:255–270. doi: 10.1016/s0896-6273(00)80454-7. [DOI] [PubMed] [Google Scholar]
  • 3.Devay P, Qu X, Role LW. Regulation of nAChR-subunit gene expression relative to the development of pre- and postsynaptic projections of embryonic chick sympathetic neurons. Dev Biol. 1994;162:56–70. doi: 10.1006/dbio.1994.1066. [DOI] [PubMed] [Google Scholar]
  • 4.Moss BL, Schuetze SM, Role LW. Functional properties and developmental regulation of nicotinic acetylcholine receptors on embryonic chicken sympathetic neurons. Neuron. 1989;3:597–607. doi: 10.1016/0896-6273(89)90270-5. [DOI] [PubMed] [Google Scholar]
  • 5.Jacob MH, Berg DK. Effects of preganglionic denervation and postganglionic axotomy on acetylcholine receptors in the chick ciliary ganglion. J Cell Biol. 1987;105:1847–1854. doi: 10.1083/jcb.105.4.1847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Brenner HR, Martin AR. Reduction in acetylcholine sensitivity of axotomized ciliary ganglion cells. J Physiol (Lond) 1976;260:159–175. doi: 10.1113/jphysiol.1976.sp011509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Schwartz Levey M, Brumwell CL, Dryer SE, Jacob MH. Innervation and target tissue interactions differentially regulate acetylcholine receptor subunit mRNA levels in developing neurons in situ. Neuron. 1995;14:153–162. doi: 10.1016/0896-6273(95)90249-x. [DOI] [PubMed] [Google Scholar]
  • 8.Halversen SW, Berg DK. Regulation of acetylcholine receptors on chick ciliary ganglion neurons by components from the synaptic target tissue. J Neurosci. 1991;11:2177–2186. doi: 10.1523/JNEUROSCI.11-07-02177.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Moss BL, Role LW. Enhanced ACh sensitivity is accompanied by changes in ACh receptor channel properties and segregation of ACh receptor subtypes on sympathetic neurons during innervation in vivo. J Neurosci. 1993;13:13–29. doi: 10.1523/JNEUROSCI.13-01-00013.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Role LW. Neural regulation of acetylcholine sensitivity in embryonic sympathetic neurons. Proc Natl Acad Sci USA. 1988;85:2825–2829. doi: 10.1073/pnas.85.8.2825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gardette R, Listerud M, Brussaard AB, Role LW. Developmental changes in transmitter sensitivity and synaptic transmission in innervated embryonic chicken sympathetic neurons in vitro. Dev Biol. 1991;147:83–95. doi: 10.1016/s0012-1606(05)80009-0. [DOI] [PubMed] [Google Scholar]
  • 12.McGehee D, Role L. Physiological diversity of acetylcholine receptor channels expressed in vertebrate neurons. Annu Rev Physiol. 1995;57:521–546. doi: 10.1146/annurev.ph.57.030195.002513. [DOI] [PubMed] [Google Scholar]
  • 13.Role L, Berg DK. Nicotinic receptors in the development and modulation of CNS synapses. Neuron. 1996;16:1077–1085. doi: 10.1016/s0896-6273(00)80134-8. [DOI] [PubMed] [Google Scholar]
  • 14.Corriveau RA, Berg DK. Coexpression of multiple acetylcholine receptor genes in neurons: quantification of transcripts during development. J Neurosci. 1993;13:2662–2671. doi: 10.1523/JNEUROSCI.13-06-02662.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Listerud M, Brussaard AB, Devay P, Colman DR, Role LW. Functional contribution of neuronal AChR subunits revealed by antisense oligonucleotides. Science. 1991;254:1518–1521. doi: 10.1126/science.1720573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Conroy WG, Berg DK. Neurons can maintain multiple classes of nicotinic acetylcholine receptors distinguished by different subunit compositions. J Biol Chem. 1995;270:4424–4431. doi: 10.1074/jbc.270.9.4424. [DOI] [PubMed] [Google Scholar]
  • 17.Horch HL, Sargent PB. Perisynaptic surface distribution of multiple classes of nicotinic acetylcholine receptors on neurons in the chicken ciliary ganglion. J Neurosci. 1995;15:7778–7795. doi: 10.1523/JNEUROSCI.15-12-07778.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yu C, Role L. Functional contribution of the α7 subunit to multiple subtypes of nicotinic receptors in embryonic chick sympathetic neurons. J Physiol (Lond) 1998;509:651–665. doi: 10.1111/j.1469-7793.1998.651bm.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Anand R, Peng X, Lindstrom J. Homomeric and native α7 acetylcholine receptors exhibit remarkably similar but non-identical pharmacological properties, suggesting that the native receptor is a heteromeric protein complex. FEBS Lett. 1993;327:241–246. doi: 10.1016/0014-5793(93)80177-v. [DOI] [PubMed] [Google Scholar]
  • 20.Yu CR, Role LW. Functional contribution of the alpha5 subunit to neuronal nicotinic channels expressed by chick sympathetic ganglion neurones. J Physiol (Lond) 1998;509:667–681. doi: 10.1111/j.1469-7793.1998.667bm.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ramirez-Latorre J, et al. Functional contributions of alpha5 subunit to neuronal acetylcholine receptor channels. Nature. 1996;380:347–351. doi: 10.1038/380347a0. [DOI] [PubMed] [Google Scholar]
  • 22.Sivilotti LG, et al. Recombinant nicotinic receptors, expressed in Xenopus oocytes, do not resemble native rat sympathetic ganglion receptors in single-channel behavior. J Physiol (Lond) 1997;500:123–138. doi: 10.1113/jphysiol.1997.sp022004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wang F. Assembly of human neuronal nicotinic receptor alpha5 subunits with alpha3, beta2 & beta4 subunits. J Biol Chem. 1996;271:17656–17665. doi: 10.1074/jbc.271.30.17656. [DOI] [PubMed] [Google Scholar]
  • 24.Yu C, Brussaard AB, Yang X, Listerud M, Role LW. Uptake and functional modification of specific nAChR channels by subunit specific antisense oligonucleotides in developing primary neurons. Dev Genet. 1993;14:296–304. doi: 10.1002/dvg.1020140407. [DOI] [PubMed] [Google Scholar]
  • 25.Nef P, Oneyser C, Alliod C, Courturier S, Ballivet M. Genes expressed in the brain define three distinct neuronal nicotinic acetylcholine receptors. EMBO J. 1988;7:595–601. doi: 10.1002/j.1460-2075.1988.tb02852.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hamill OP, Marty A, Neher E, Sakmann B, Sigworth FJ. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch. 1981;391:85–100. doi: 10.1007/BF00656997. [DOI] [PubMed] [Google Scholar]
  • 27.Hogg RV, Craig AT. Introduction to Mathematical Statistics. 3. Macmillan; New York: 1970. pp. 348–378. [Google Scholar]

RESOURCES