Skip to main content
PMC home page
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 1996 Jan;34(1):41–43. doi: 10.1128/jcm.34.1.41-43.1996

Discrimination of respiratory syncytial virus subgroups A and B by reverse transcription-PCR.

J Gottschalk 1, R Zbinden 1, L Kaempf 1, I Heinzer 1
PMCID: PMC228726  PMID: 8748269

Abstract

Reverse transcription (RT)-PCR with shared primers differentiating respiratory syncytial virus (RSV) subgroups A and B was developed for subtyping of RSV isolates. Results of RT-PCR were compared with those of an indirect immunofluorescence test using monoclonal antibodies. Viral RNA isolated from cell cultures infected with RSV served as a template for cDNA synthesis with random primers. For PCR, we used three synthetic oligonucleotides corresponding to the G protein mRNA sequence of subgroup A (bases 248 to 267; 3'ATGCAACAAGCCAGATCAAG), subgroup B (bases 314 to 333; 3'ACTCATCCAAACAACCCACA), or both (bases 511 to 530; 3'GGWACAAARTTGAACACTTC). PCR products of RSV subgroups A and B had molecular sizes of 283 and 217 bp, respectively. Specific cutting sites for RSV A and B in amplified cDNA were demonstrated by restriction fragment analysis with four restriction endonucleases. Our RT-PCR assay divided 68 RSV isolates into 47 strains of subgroup A and 21 strains of subgroup B in full agreement with subtyping by monoclonal antibodies. RT-PCR seems to be a good alternative to subtyping of RSV with monoclonal antibodies.

Full Text

The Full Text of this article is available as a PDF (311.0 KB).

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Anderson L. J., Hierholzer J. C., Tsou C., Hendry R. M., Fernie B. F., Stone Y., McIntosh K. Antigenic characterization of respiratory syncytial virus strains with monoclonal antibodies. J Infect Dis. 1985 Apr;151(4):626–633. doi: 10.1093/infdis/151.4.626. [DOI] [PubMed] [Google Scholar]
  2. Cane P. A., Pringle C. R. Molecular epidemiology of respiratory syncytial virus: rapid identification of subgroup A lineages. J Virol Methods. 1992 Dec 1;40(3):297–306. doi: 10.1016/0166-0934(92)90088-u. [DOI] [PubMed] [Google Scholar]
  3. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987 Apr;162(1):156–159. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
  4. Coates H. V., Alling D. W., Chanock R. M. An antigenic analysis of respiratory syncytial virus isolates by a plaque reduction neutralization test. Am J Epidemiol. 1966 Mar;83(2):299–313. doi: 10.1093/oxfordjournals.aje.a120586. [DOI] [PubMed] [Google Scholar]
  5. Collins P. L., Huang Y. T., Wertz G. W. Identification of a tenth mRNA of respiratory syncytial virus and assignment of polypeptides to the 10 viral genes. J Virol. 1984 Feb;49(2):572–578. doi: 10.1128/jvi.49.2.572-578.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Collins P. L., Wertz G. W. cDNA cloning and transcriptional mapping of nine polyadenylylated RNAs encoded by the genome of human respiratory syncytial virus. Proc Natl Acad Sci U S A. 1983 Jun;80(11):3208–3212. doi: 10.1073/pnas.80.11.3208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. García O., Martín M., Dopazo J., Arbiza J., Frabasile S., Russi J., Hortal M., Perez-Breña P., Martínez I., García-Barreno B. Evolutionary pattern of human respiratory syncytial virus (subgroup A): cocirculating lineages and correlation of genetic and antigenic changes in the G glycoprotein. J Virol. 1994 Sep;68(9):5448–5459. doi: 10.1128/jvi.68.9.5448-5459.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Hendry R. M., Pierik L. T., McIntosh K. Prevalence of respiratory syncytial virus subgroups over six consecutive outbreaks: 1981-1987. J Infect Dis. 1989 Aug;160(2):185–190. doi: 10.1093/infdis/160.2.185. [DOI] [PubMed] [Google Scholar]
  9. Johnson P. R., Spriggs M. K., Olmsted R. A., Collins P. L. The G glycoprotein of human respiratory syncytial viruses of subgroups A and B: extensive sequence divergence between antigenically related proteins. Proc Natl Acad Sci U S A. 1987 Aug;84(16):5625–5629. doi: 10.1073/pnas.84.16.5625. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. McConnochie K. M., Hall C. B., Walsh E. E., Roghmann K. J. Variation in severity of respiratory syncytial virus infections with subtype. J Pediatr. 1990 Jul;117(1 Pt 1):52–62. doi: 10.1016/s0022-3476(05)82443-6. [DOI] [PubMed] [Google Scholar]
  11. Mufson M. A., Orvell C., Rafnar B., Norrby E. Two distinct subtypes of human respiratory syncytial virus. J Gen Virol. 1985 Oct;66(Pt 10):2111–2124. doi: 10.1099/0022-1317-66-10-2111. [DOI] [PubMed] [Google Scholar]
  12. Orvell C., Norrby E., Mufson M. A. Preparation and characterization of monoclonal antibodies directed against five structural components of human respiratory syncytial virus subgroup B. J Gen Virol. 1987 Dec;68(Pt 12):3125–3135. doi: 10.1099/0022-1317-68-12-3125. [DOI] [PubMed] [Google Scholar]
  13. Pattemore P. K., Johnston S. L., Bardin P. G. Viruses as precipitants of asthma symptoms. I. Epidemiology. Clin Exp Allergy. 1992 Mar;22(3):325–336. doi: 10.1111/j.1365-2222.1992.tb03094.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Sullender W. M., Sun L., Anderson L. J. Analysis of respiratory syncytial virus genetic variability with amplified cDNAs. J Clin Microbiol. 1993 May;31(5):1224–1231. doi: 10.1128/jcm.31.5.1224-1231.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Sullender W. M., Wertz G. W. Synthetic oligonucleotide probes differentiate respiratory syncytial virus subgroups in a nucleic acid hybridization assay. J Clin Microbiol. 1991 Jun;29(6):1255–1257. doi: 10.1128/jcm.29.6.1255-1257.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Tsutsumi H., Onuma M., Nagai K., Yamazaki H., Chiba S. Clinical characteristics of respiratory syncytial virus (RSV) subgroup infections in Japan. Scand J Infect Dis. 1991;23(6):671–674. doi: 10.3109/00365549109024291. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES