Abstract
Reverse transcription (RT)-PCR with shared primers differentiating respiratory syncytial virus (RSV) subgroups A and B was developed for subtyping of RSV isolates. Results of RT-PCR were compared with those of an indirect immunofluorescence test using monoclonal antibodies. Viral RNA isolated from cell cultures infected with RSV served as a template for cDNA synthesis with random primers. For PCR, we used three synthetic oligonucleotides corresponding to the G protein mRNA sequence of subgroup A (bases 248 to 267; 3'ATGCAACAAGCCAGATCAAG), subgroup B (bases 314 to 333; 3'ACTCATCCAAACAACCCACA), or both (bases 511 to 530; 3'GGWACAAARTTGAACACTTC). PCR products of RSV subgroups A and B had molecular sizes of 283 and 217 bp, respectively. Specific cutting sites for RSV A and B in amplified cDNA were demonstrated by restriction fragment analysis with four restriction endonucleases. Our RT-PCR assay divided 68 RSV isolates into 47 strains of subgroup A and 21 strains of subgroup B in full agreement with subtyping by monoclonal antibodies. RT-PCR seems to be a good alternative to subtyping of RSV with monoclonal antibodies.
Full Text
The Full Text of this article is available as a PDF (311.0 KB).
Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Anderson L. J., Hierholzer J. C., Tsou C., Hendry R. M., Fernie B. F., Stone Y., McIntosh K. Antigenic characterization of respiratory syncytial virus strains with monoclonal antibodies. J Infect Dis. 1985 Apr;151(4):626–633. doi: 10.1093/infdis/151.4.626. [DOI] [PubMed] [Google Scholar]
- Cane P. A., Pringle C. R. Molecular epidemiology of respiratory syncytial virus: rapid identification of subgroup A lineages. J Virol Methods. 1992 Dec 1;40(3):297–306. doi: 10.1016/0166-0934(92)90088-u. [DOI] [PubMed] [Google Scholar]
- Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987 Apr;162(1):156–159. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
- Coates H. V., Alling D. W., Chanock R. M. An antigenic analysis of respiratory syncytial virus isolates by a plaque reduction neutralization test. Am J Epidemiol. 1966 Mar;83(2):299–313. doi: 10.1093/oxfordjournals.aje.a120586. [DOI] [PubMed] [Google Scholar]
- Collins P. L., Huang Y. T., Wertz G. W. Identification of a tenth mRNA of respiratory syncytial virus and assignment of polypeptides to the 10 viral genes. J Virol. 1984 Feb;49(2):572–578. doi: 10.1128/jvi.49.2.572-578.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Collins P. L., Wertz G. W. cDNA cloning and transcriptional mapping of nine polyadenylylated RNAs encoded by the genome of human respiratory syncytial virus. Proc Natl Acad Sci U S A. 1983 Jun;80(11):3208–3212. doi: 10.1073/pnas.80.11.3208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- García O., Martín M., Dopazo J., Arbiza J., Frabasile S., Russi J., Hortal M., Perez-Breña P., Martínez I., García-Barreno B. Evolutionary pattern of human respiratory syncytial virus (subgroup A): cocirculating lineages and correlation of genetic and antigenic changes in the G glycoprotein. J Virol. 1994 Sep;68(9):5448–5459. doi: 10.1128/jvi.68.9.5448-5459.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hendry R. M., Pierik L. T., McIntosh K. Prevalence of respiratory syncytial virus subgroups over six consecutive outbreaks: 1981-1987. J Infect Dis. 1989 Aug;160(2):185–190. doi: 10.1093/infdis/160.2.185. [DOI] [PubMed] [Google Scholar]
- Johnson P. R., Spriggs M. K., Olmsted R. A., Collins P. L. The G glycoprotein of human respiratory syncytial viruses of subgroups A and B: extensive sequence divergence between antigenically related proteins. Proc Natl Acad Sci U S A. 1987 Aug;84(16):5625–5629. doi: 10.1073/pnas.84.16.5625. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McConnochie K. M., Hall C. B., Walsh E. E., Roghmann K. J. Variation in severity of respiratory syncytial virus infections with subtype. J Pediatr. 1990 Jul;117(1 Pt 1):52–62. doi: 10.1016/s0022-3476(05)82443-6. [DOI] [PubMed] [Google Scholar]
- Mufson M. A., Orvell C., Rafnar B., Norrby E. Two distinct subtypes of human respiratory syncytial virus. J Gen Virol. 1985 Oct;66(Pt 10):2111–2124. doi: 10.1099/0022-1317-66-10-2111. [DOI] [PubMed] [Google Scholar]
- Orvell C., Norrby E., Mufson M. A. Preparation and characterization of monoclonal antibodies directed against five structural components of human respiratory syncytial virus subgroup B. J Gen Virol. 1987 Dec;68(Pt 12):3125–3135. doi: 10.1099/0022-1317-68-12-3125. [DOI] [PubMed] [Google Scholar]
- Pattemore P. K., Johnston S. L., Bardin P. G. Viruses as precipitants of asthma symptoms. I. Epidemiology. Clin Exp Allergy. 1992 Mar;22(3):325–336. doi: 10.1111/j.1365-2222.1992.tb03094.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sullender W. M., Sun L., Anderson L. J. Analysis of respiratory syncytial virus genetic variability with amplified cDNAs. J Clin Microbiol. 1993 May;31(5):1224–1231. doi: 10.1128/jcm.31.5.1224-1231.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sullender W. M., Wertz G. W. Synthetic oligonucleotide probes differentiate respiratory syncytial virus subgroups in a nucleic acid hybridization assay. J Clin Microbiol. 1991 Jun;29(6):1255–1257. doi: 10.1128/jcm.29.6.1255-1257.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tsutsumi H., Onuma M., Nagai K., Yamazaki H., Chiba S. Clinical characteristics of respiratory syncytial virus (RSV) subgroup infections in Japan. Scand J Infect Dis. 1991;23(6):671–674. doi: 10.3109/00365549109024291. [DOI] [PubMed] [Google Scholar]
