Prostaglandin E₂ inhibits calcium current in two sub-populations of acutely isolated mouse trigeminal sensory neurons

Abstract

Prostaglandins are important mediators of pain and inflammation. We have examined the effects of prostanoids on voltage-activated calcium currents (I_Ca) in acutely isolated mouse trigeminal sensory neurons, using standard whole cell voltage clamp techniques. Trigeminal neurons were divided into two populations based on the presence (Type 2) or absence (Type 1) of low voltage-activated T-type I_Ca. The absence of T-type I_Ca is highly correlated with sensitivity to μ-opioid agonists and the VR1 agonist capsaicin. In both populations of cells, high voltage-activated I_Ca was inhibited by PGE₂ with an EC₅₀ of about 35 nm, to a maximum of 30 %. T-type I_Ca was not inhibited by PGE₂. Pertussis toxin pre-treatment abolished the effects of PGE₂ in Type 2 cells, but not in Type 1 cells, whereas treatment with cholera toxin prevented the effects of PGE₂ in Type 1 cells, but not in Type 2 cells. Inhibition of I_Ca by PGE₂ was associated with slowing of current activation and could be relieved with a large positive pre-pulse, consistent with inhibition of I_Ca by G protein βγ subunits. Reverse transcription-polymerase chain reaction of mRNA from trigeminal ganglia indicated that all four EP prostanoid receptors were present. However, in both Type 1 and Type 2 cells the effects of PGE₂ were only mimicked by the selective EP₃ receptor agonist ONO-AE-248, and not by selective agonists for EP₁ (ONO-DI-004), EP₂ (ONO-AE1–259) and EP₄ (ONO-AE1–329) receptors. These data indicate that two populations of neurons in trigeminal ganglia differing in their calcium channel expression, sensitivity to μ-opioids and capsaicin also have divergent mechanisms of PGE₂-mediated inhibition of calcium channels, with Gi/Go type G proteins involved in one population, and Gs type G proteins in the other.

The pain produced in response to many forms of noxious stimulation can be facilitated by prostaglandins (Ferreira, 1972). Prostanoids, including prostaglandin E₂ (PGE₂; Willis, 1969; Greaves et al. 1971), are generated in response to injury or inflammation and can increase the excitability of sensory nerves (Handwerker, 1976; Chahl & Iggo, 1977; Mense, 1981) in vivo and in vitro (Baccaglini & Hogan, 1983; Pitchford & Levine, 1991). The heightened responsiveness to other noxious stimuli produced by PGE₂ is known as sensitization and is reflected at a cellular level by modulation of a number of different ion channels (see below) and the facilitation of neuropeptide release (Nicol et al. 1992; Vasko et al. 1994; Cui & Nicol, 1995). In sensory neurons from various species, PGE₂ shifts the activation of tetrodotoxin-resistant sodium currents (TTX-R I_Na) to more negative potentials (Gold et al. 1996; England et al. 1996), potentiates capsaicin-induced currents (Pitchford & Levine, 1991; Lopshire & Nicol, 1998) and increases the activation of the hyperpolarization-activated cation current (I_h; Ingram & Williams, 1994, 1996), all of which will increase the excitability of sensory neurons. PGE₂ also attenuates voltage-dependent (Nicol et al. 1997) and calcium-activated potassium currents (Fowler et al. 1985). The effects of PGE₂ on sensory neuron excitability (Ferreira & Nakamura, 1979) and neuropeptide release (Cui & Nicol, 1995; Hingtgen et al. 1995) have largely been attributed to elevation of cAMP. Cyclic AMP acts both directly (Ingram & Williams, 1994, 1996) and via protein kinase A to mediate its cellular sensitizing effects (Pitchford & Levine, 1991; England et al. 1996; Lopshire & Nicol, 1998; Gold et al. 1998; Evans et al. 1999). These effects are consistent with the predominant coupling of prostanoid receptors to Gs proteins (Narumiya et al. 1999).

High voltage-activated I_Ca (HVA I_Ca) and low voltage-activated T-type I_Ca contribute to the excitability of sensory neurons (e.g. Yoshida et al. 1978; White et al. 1989; Abdulla & Smith, 1997) and HVA I_Ca contributes directly to action potential-dependent neurotransmitter release from primary afferent terminals. The inhibition of sensory neuron voltage-dependent calcium channels at the primary afferent synapse is thought to be important in mediating the spinal analgesic effects of opioid agonists (Hori et al. 1992) and invertebrate neurotoxin analgesics (Xiao & Bennett, 1995). Consistent with its role as a pro-nociceptive mediator, PGE₂ has been reported to increase HVA I_Ca in embryonic avian sensory neurons (Nicol et al. 1992), although the mechanism was not determined. In contrast, in rat sympathetic neurons (Ikeda 1992; Ito et al. 2000), bovine adrenal chromaffin cells (Currie & Fox, 2000) and rat melanotrophs (Tanaka et al. 1998), PGE₂ inhibits calcium channels. In the light of these contrasting findings, we examined the effects of PGE₂ on HVA I_Ca in mammalian sensory neurons. We found that PGE₂ inhibited HVA I_Ca in almost all acutely isolated mouse trigeminal sensory neurons, and that PGE₂ receptors are differentially coupled to Gi/o- and Gs-type G proteins in separate pharmacologically and electrophysiologically defined populations of sensory neurons.

METHODS

Isolation of trigeminal ganglion neurons

129SvEv/C57BL/6 mice (4–6 weeks old) of either sex were used for this study. All procedures were approved by the Animal Ethics Committee of the University of Sydney, Australia. Mice were anaesthetized with halothane (4 %) and decapitated, and the trigeminal ganglia were removed and placed in cold (4 °C) physiological saline containing (mm): NaCl 126; KCl 2.5; CaCl₂ 2.5; MgCl₂ 1.2; NaH₂PO₄ 1.2; NaHCO₃ 24; and glucose 10, gassed with 95 % O₂-5 % CO₂. Using a simplified version of the methods outlined in Eckert et al. (1997), ganglia were cut up with iridectomy scissors and incubated at 32–34 °C for 30 min in physiological saline. The ganglia pieces were then transferred to oxygenated Hepes buffered saline (HBS) containing 20 units ml⁻¹ papain and incubated at 32–34 °C for 15 min. In a few experiments the ganglia were incubated with 3 mg ml⁻¹ collagenase Type IV (Worthington) before incubation with papain. This procedure reduced the amount of trituration needed to release the cells. HBS contained (mm): NaCl 154; KCl 2.5; CaCl₂ 2.5; MgCl₂ 1.5; Hepes 10; glucose 10; pH 7.2 (NaOH), 330 ± 5 mosmol l⁻¹. The papain digestion was terminated with addition of HBS containing 1 mg ml⁻¹ bovine serum albumin (BSA) and 1 mg ml⁻¹ trypsin inhibitor. Minced ganglia were washed free of enzyme and enzyme inhibitors with room temperature HBS. Cells were released by gentle trituration through decreasing bore, silanized Pasteur pipettes with fire-polished tips. The cells were plated onto plastic culture dishes and kept at room temperature in HBS. Cells remained viable for up to 10 h after dissociation and could be cultured overnight.

Pertussis toxin and cholera toxin treatments

Trigeminal ganglion cells were isolated as above. Neurons in HBS were left to attach to plastic culture dishes before changing medium to L15 Lebovitz (Sigma) containing 5 % fetal bovine serum (Gibco) and penicillin-streptomycin (50 u, 5 μg ml⁻¹), and incubated at 25 °C in a humidified incubator. Pertussis toxin (PTX; 100 ng ml⁻¹) or cholera toxin (CTX; 250 ng ml⁻¹) was added to the culture medium prior to overnight incubation.

Electrophysiological recordings

Ionic currents from mouse trigeminal neurons were recorded in the whole-cell configuration of the patch-clamp method (Hamill et al. 1981) at room temperature (22–24 °C). Dishes were continually perfused with HBS. For isolating calcium currents, an extracellular solution was used containing (mm): TEACl 140; CsCl 2.5; CaCl₂ 2.5; Hepes 10; MgCl₂ 1; glucose 10; pH 7.2 (CsOH), 330 ± 5 mosmol l⁻¹. The intracellular solution contained (mm): CsCl 130; Hepes 10; EGTA 10; CaCl₂ 2; MgATP 5; NaGTP 0.2; NaCl 5; pH 7.3 (CsOH), 285 ± 3 mosmol l⁻¹.

Recordings were made using an EPC-9 patch-clamp amplifier and corresponding Pulse software from Heka Electroniks (Lambrecht, Germany) or an Axopatch-1D amplifier (Axon Instruments, Union City, CA) using pCLAMP acquisition software (Axon Instruments). Currents were sampled at 20–50 kHz and recorded on hard disk for later analysis. The recordings were filtered at 2.83 kHz (Heka) or 2 kHz (Axopatch). Patch pipettes were pulled from borosilicate glass (AM Systems, Everett, WA, USA). The pipette input resistance ranged between 0.7 and 1.5 MΩ. The capacitance of individual cells ranged between 4 and 40 pF with a series resistance between 1 and 5 MΩ. A series resistance compensation of at least 80 % was used in all experiments. Capacitance transients were compensated automatically using a built-in procedure of the Heka amplifier or by using the manual compensation on the Axopatch-1D. Leak current was subtracted on line using a P/8 protocol by the Pulse software (Heka Electroniks) unless otherwise noted (see Fig. 1A). The average current settling time (from 12 randomly selected cells) was 0.6 ± 0.05 ms. A liquid junction potential of approximately −8 mV has not been corrected for.

Figure 1. PGE₂ inhibits HVA I_Ca in Type 1 mouse trigeminal neurons.

A, HVA I_Ca elicited by stepping the membrane potential from −80 to 0 mV was inhibited by 1 μm PGE₂ in a Type 1 neuron. B, a representative time plot illustrating that inhibition of HVA I_Ca by 1 μm PGE₂ completely reversed upon washout of the drug. C, Type-1 neurons were superfused with various concentrations of PGE₂ for 1 min and then washed until the current returned to pre-drug treatment amplitude. Each point represents the mean and s.e.m. of 6–12 cells.

Peak HVA I_Ca in each cell was determined by stepping the membrane potential from a holding potential of −80 mV to between −60 and +60 mV, for 30 ms, in 10 mV increments. Following this procedure the test current was evoked every 30s and monitored for current stability before drugs were applied. Cells were rejected if the current increased or decreased by more than 2 % in the first 90 s after running the I-V protocol. Cells were exposed to drugs via a series of flow pipes positioned above the cells. The inhibition by drugs was quantified by measuring the current isochronically from the peak of the control current in the presence and absence of the drug.

RNA isolation and reverse transcription-polymerase chain reaction

Total RNA was isolated from whole trigeminal ganglia of mice using the RNeasy kit (Qiagen, Germany). Total RNA was treated with RQ1 RNase-free DNase (Promega, Madison, WI, USA) at 37 °C for 30 min to remove any contaminating genomic DNA. The enzyme was removed by a phenol-chloroform extraction. Optical density readings were performed to estimate the amount of total RNA before it was used in reverse transcription- polymerase chain reaction (RT-PCR).

A total of 1 μg of RNA and 1 μg of oligodT primers (Promega) were incubated at 70 °C for 5 min, and then cooled on ice. The RNA was reverse transcribed at 37 °C in a 15 μl reaction mixture containing (mm): Tris-HCl 50 (pH 8.5); KCl 75; MgCl₂ 3; dithiothreitol 10; and 400 μm each of deoxyadenosinetriphosphate (dATP), deoxythymidinetriphosphate (dTTP), deoxycytidinetriphosphate (dCTP), and deoxyguanosinetriphosphate (dGTP); 20 U of SUPERase•In RNase inhibitor (Ambion Inc., Austin, TX, USA) and 200 U of M-MLV reverse transcriptase (Promega). The RNA from each animal was incubated both with and without M-MLV reverse transcriptase to confirm the absence of contaminating genomic DNA.

PCR was performed in a 20 μl reaction volume containing (mm): Tris-HCl 10 (pH 9); KCl 50; MgCl₂ 1.5; 0.1 % Triton X-100; and 200 μm each of dATP, dTTP, dCTP and dGTP; 500 μm of each primer; 1 U of Taq DNA polymerase (Promega) and 5 μl of the appropriate RT product. Amplifications were performed in a Perkin-Elmer 2400 thermal cycler with an initial denaturation step at 94 °C for 1 min followed by 35 cycles. Each cycle consisted of a denaturation step at 94 °C for 30 s, an annealing step at 55 °C for 30 s, and an elongation step at 72 °C for 30 s. This was followed by a final elongation step at 72 °C for 5 min. The PCR products were separated on a 2 % agarose gel stained with ethidium bromide.

Data analysis

All data are expressed as means ± s.e.m. unless otherwise indicated. Concentration response data were pooled for each group and fitted to the Hill equation using the software package GraphPad Prism v. 3. Where noted, significant differences between means were tested, using Student's paired or unpaired, two tailed t test.

Drugs and chemicals

PGE₂ was from Cayman Chemical Co. (Ann Arbor, MI, USA). ONO-DI-004, ONO-AE1–329, ONO-AE-248 and ONO-AE1–259 were kindly supplied by Ono Pharmaceuticals Co. Ltd (Osaka, Japan). Baclofen was from Research Biochemicals International (Natick, MA, USA). Buffer salts were from BDH Australia or Sigma Australia. Papain and collagenase were from Worthington Biochemical Corp. (Freehold, NJ, USA). BSA and trypsin inhibitor (chicken egg white ovomucoid, Type II-O), pertussis toxin and cholera toxin were from Sigma Australia. Methionine-enkephalin was from Auspep (Melbourne, Australia).

PGE₂ was dissolved in ethanol and stored at −20 °C. More dilute aqueous solutions were made daily and kept on ice; ethanol alone (up to 0.01 %) did not affect I_Ca. Other compounds were dissolved in dimethylsulfoxide (DMSO); DMSO alone (up to 0.01 %) did not affect I_Ca. At higher concentrations (up to 0.1 %) of DMSO, the osmotic effects of the solvent were minimized by diluting the recording buffer before addition of the drugs (ONO-AE-248 and ONO-AE1–259) or the DMSO alone. For these higher concentrations of DMSO, the control was always defined as the current in the appropriate concentration of DMSO.

RESULTS

Acute application of prostaglandin E₂ reversibly inhibited HVA I_Ca in almost all trigeminal neurons. We have previously characterized two populations of trigeminal sensory neurons based on sensitivity to opioid receptor agonists and capsaicin (Type 1 neurons) or the presence of a prominent T-type calcium current and insensitivity to opioid agonists and capsaicin (Type 2 cells, Borgland et al. 2001). In Type 1 neurons PGE₂ inhibited HVA I_Ca in 234 of 262 cells examined, with an EC₅₀ of 41 nm (logEC₅₀ −7.4 ± 0.1) to a maximum of 28 ± 2 % (Fig. 1C). In Type 2 neurons PGE₂ inhibited HVA I_Ca in 203 of 218 cells examined, with an EC₅₀ of 34 nm (logEC₅₀ −7.5 ± 0.1) and inhibited HVA I_Ca to a maximum of 32 ± 1 % (Fig. 2C). In Type 2 neurons that were sensitive to PGE₂, the T-type I_Ca itself was not inhibited (Fig. 2A; n = 10).

Figure 2. Calcium currents in Type 2 trigeminal neurons are inhibited by PGE₂.

A, to elicit the low voltage-activated T-type I_Ca, neurons were stepped from −80 mV to −40 mV. Neurons recovered for 80 ms (approximately 65 ms has been removed for clarity) before stepping the membrane potential to 0 mV to elicit HVA I_Ca. T-type I_Ca was not inhibited by 1 μm PGE₂. This trace was not leak subtracted and zero current is denoted by the dashed line_.B, time course of inhibition of HVA I_Ca by 1 μm PGE₂ in the same cell. C, Type 2 neurons were superfused with various concentrations of PGE₂ for 1 min and then washed until the current returned to pre-drug treatment amplitude. Each point represents the mean and s.e.m. of 6–12 cells.

When current-voltage (I-V) relationships for I_Ca were determined in trigeminal neurons, the peak amplitude I_Ca of cells with (Fig. 3B) or without (Fig. 3A) T-type I_Ca occurred at either 0 or +10 mV (except in 6 cells with T-type I_Ca where the peak was at −40 mV). Inhibition of I_Ca by PGE₂ occurred over a range of potentials in both types of cell. The inhibition of I_Ca was not due indirectly to a PGE₂-induced increase in an outward current, because PGE₂ did not modulate the current evoked in the presence of 30 μm Cd²⁺ when cells were stepped from −80 mV to either 0 mV (Fig. 3C, n = 9; 3D, n = 8) or +60 mV (n = 13, data not shown).

Figure 3. Characteristics of PGE₂ modulation of HVA I_Ca.

A and B, HVA I_Ca was elicited by stepping the membrane potential from −80 mV to potentials between −60 mV and +60 mV in 10 mV increments (Control, black squares). PGE₂ (1 μm; triangles) inhibited I_Ca over a range of membrane potentials. A, a representative example of a current-voltage relationship of a Type 1 cell. B, current-voltage relationship for a Type 2 cell. In Type 1 cells (C) and Type 2 cells (D) 1 μm PGE₂ did not alter Cd²⁺-insensitive current when HVA I_Ca was elicited by stepping the cells from the holding potential to 0 mV.

PGE₂ inhibits I_Ca in two subpopulations of trigeminal sensory neurons by distinct G protein mechanisms

To examine the possible role of G proteins in the PGE₂ inhibition of I_Ca, trigeminal neurons were treated overnight with either pertussis toxin (PTX, 100 ng ml⁻¹), an irreversible inhibitor of Gi/o proteins, or cholera toxin (CTX, 250 ng ml⁻¹), an activator of Gs proteins which uncouples Gs α-subunits from their receptors (Fig. 4). PTX treatment significantly attenuated the inhibition of I_Ca caused by 1 μm PGE₂ in Type 2 cells (Fig. 4A, P < 0.001, n = 8), but not in Type 1 cells (Fig. 4A, n = 9). In contrast, CTX did not affect PGE₂-mediated inhibition of I_Ca in Type 2 cells (n = 10), but it did abolish PGE₂ inhibition of I_Ca in Type 1 cells (Fig. 4A, n = 10). CTX treatment alone did not alter the activation kinetics of the peak I_Ca (0–50 % rise times for I_Ca: Type 1 cells, 1.6 ± 0.2 ms vs. 1.6 ± 0.2 ms after CTX; Type 2 cells, 1.3 ± 0.1 ms vs. 1.3 ± 0.1 ms after CTX). In Type 1 cells, PTX treatment abolished inhibition of I_Ca by methionine-enkephalin (ME) (Fig. 4B, n = 6–8 each, and in Type 2 cells PTX treatment abolished the effects of baclofen (30 μm; Fig. 4C, n = 6–8 each). CTX treatment had no effect on the responses to ME in Type 1 cells or to baclofen in Type 2 cells. (Fig. 4C, n = 6–10 cells for each).

Figure 4. Inhibition of HVA I_Ca by PGE₂ is mediated via multiple G proteins.

Neurons were treated overnight with either 100 ng ml⁻¹ PTX or 250 ng ml⁻¹ CTX. Aa, CTX selectively abolished PGE₂-mediated inhibition of HVA I_Ca in Type 1 neurons, while PTX treatment selectively reduced effects of PGE₂ in Type 2 neurons. Type 2 neurons pre-treated with PTX had significantly less inhibition of HVA I_Ca than controls (P < 0.001). Ab, a representative trace of a CTX treated Type 1 neuron in the presence and absence of 1 μm PGE₂. Ac, a representative trace of a PTX treated Type 2 neuron in the presence and absence of 1 μm PGE₂. B, in Type 1 neurons, inhibition of I_Ca caused by 1 μm ME was abolished by PTX but not CTX. Representative traces of a CTX treated neuron (Bb) and a PTX treated neuron (Bc) in the presence and absence of 1 μm ME. C, I_Ca inhibition caused by 30 μm baclofen was abolished by PTX, but not CTX in Type 2 cells. Representative traces of a CTX treated Type 2 neuron (Cb) and a PTX treated Type 2 neuron (Cc) in the presence and absence of 30 μm baclofen. Records illustrated are superimposed currents recorded before, during and after drug application.

The inhibition of I_Ca by PGE₂ was associated with a significant slowing of the rise time of the evoked current, consistent with direct inhibition of I_Ca by G protein βγ subunits (see Table 1). To address the involvement of G protein βγ in the PGE₂-mediated inhibition of I_Ca, a depolarizing conditioning step designed to reduce affinity of G protein βγ subunits for the calcium channel was used to test the voltage dependence of inhibition. In these experiments we required different voltage protocols for Type 1 and Type 2 cells to achieve relief of PGE₂-mediated I_Ca inhibition. For both cell types I_Ca was evoked by two test steps to 0 mV, separated by a conditioning step applied 100 ms after the first test step (S1). A conditioning step to +100 mV for 50 ms was applied to Type 2 neurons and a step to +130 mV for 70 ms was applied to Type 1 neurons (Fig. 5). In Type 2 cells, PGE₂ (1 μm) inhibition of I_Ca after the conditioning step was reduced by 50 ± 4 % compared to S1 (P < 0.01). After the conditioning step, the slowing of the 0–50 % rise time of I_Ca (S2) in the presence of PGE₂ was significantly less than the slowing of the 0–50 % rise time of S1 (P < 0.01, Table 1). When Type 1 cells were subjected to the same conditioning step as Type 2 cells, the PGE₂ (1 μm) inhibition of I_Ca elicited by the second test step (S2) was only reduced by 7 ± 3 % compared to S1, and there was no change in the rise time of S2 when compared with S1 (0–50 % rise time: S1, 1.04 ± 0.06 ms in control vs. 1.17 ± 0.07 ms in PGE₂; S2, 1.05 ± 0.07 ms in control vs. 1.15 ± 0.07 ms in PGE₂; n = 6). However, when the depolarizing conditioning step applied to Type 1 cells was increased to +130 mV and lengthened to 70 ms, PGE₂ inhibition of I_Ca elicited by S2 was reduced by 39 ± 6 % compared to S1 (Table 1). The slowing of the 0–50 % rise time of I_Ca by PGE₂, apparent in S1, was no longer apparent following the conditioning step (Table 1). Facilitation of S2 by the depolarizing conditioning step was also observed with baclofen, an agonist that activates Gi/o-coupled GABA_B receptors (Table 1). Baclofen (30 μm) significantly decreased the ratio of S1:S2 (reduced inhibition in the second test pulse) and significantly slowed 0–50 % rise times of S1 in Type 1 cells (Table 1).

Table 1.

Effects of a depolarizing conditioning step on PGE₂ modulation of HVA/_Ca in mouse trigeminal neurons

	n	Control	1 μm PGE2	n	Control	30 μm Baclofen
Type 1
Ratio S2:S1 peak amplitude	7	1.01 ± 0.07	1.19 ±0.09*	9	1.00 ± 0.05	1.18 ± 0.07***
0–50% rise time of S1 (ms)	7	0.95 ± 0.07	1.11 ± 0.05*	9	1.18 ±0.07	1.29 ± 0.10*
0–50% rise time of S2 (ms)	7	1.02 ± 0.08	1.05 ±0.08	9	1.11 ±0.05	1.14 ± 0.06
Type 2
Ratio S2:S1 peak amplitude	8	1.07 ± 0.07	1.36 ± 0.09***
0–50% rise time of S1 (ms)	8	1.69 ±0.08	2.35 ±0.17*
0–50% rise time of S2 (ms)	8	1.60 ±0.15	1.86 ± 0.18†

Values are means and s.e.m. The S1:S2 ratio and 0–50% rise times were significantly greater than controls on indicated values (Student's paired, two tailed t test)

^*P < 0.05

^***P < 0.001.

^†Significantly different from S1 in PGE₂, Student's unpaired t test,P <0.02.

Figure 5. PGE₂ inhibition of HVA I_Ca in sensory neurons is relieved by a positive prepulse.

Different prepulse protocols were used for Type 1 and Type 2 neurons to achieve relief of I_Ca inhibition. Trigeminal neurons were voltage clamped at −80 mV and were stepped initially (S1) to a test potential of 0 mV. In Type 1 neurons, a 70 ms step to +130 mV was applied. Cells recovered for 20 ms before a second test pulse (S2) was applied. In Type 2 neurons, a 50 ms step to +100 ms was applied. Cells recovered for 15 ms before the second test pulse. A section of approximately 80 ms in the current trace has been omitted for clarity. Inhibition of HVA I_Ca by 1 μm PGE₂ was relieved after a large positive prepulse in both Type 1 and Type 2 cells, but a greater depolarizing pulse was required to achieve relief in Type 1 neurons.

The effects of prostaglandin are mediated by EP₃ receptors

PGE₂ acts predominantly on prostanoid receptors of the EP type. The expression of the four cloned prostaglandin EP receptors in the mouse trigeminal ganglion was examined using RT-PCR. Messenger RNA was isolated from the trigeminal ganglion of eight male and five female animals, and PCR was performed using the primers described in Table 2. The primers selectively amplified mRNA fragments of the expected size (Fig. 6, Table 2), and the mRNA for all four prostaglandin EP receptors was found in all animals tested (Fig. 6).

Table 2.

Primer sequences used to amplify mRNA fragments from prostanoid EP receptors EP_1–4 and the housekeeping enzyme hypoxanthine phosphoribosyl-transferase (HPRT)

Receptor			Size (bp)
EP1	F	GCTTAACCTGAGCCTAGCGGA	294
	R	CGCAGTATACAGGCGAAGCAC
EP2	F	CTCAACTACGGGGAGTACGTCC	277
	R	AGGAGAATGAGGTGGTCCGTC
EP3	F	CATGATGGTCACTGGCTTCGT	238
	R	ACACTGTCATGGTTAGCCGCA
EP4	F	CGTAGTATTGTGCAAGTCGCG	215
	R	CAGATGATGCTGAGACCCGAC
HPRT	F	GCTACTGTAATGATCAGTCAACGGG	394
	R	CAACATCAACAGGACTCCTCGTA

F, the forward primer; R, the reverse; Size (bp), the length of the expected PCR product.

Figure 6. Trigeminal ganglion cells express 4 EP prostanoid receptor subtypes.

Total trigeminal ganglion mRNA was extracted and subjected to RT PCR utilizing the primers outlined in Table 1. The resulting PCR products were separated on a 2 % agarose gel stained with ethidium bromide, as illustrated. Lane A is a nucleotide size ladder in 100 bp increments, lanes B, C, D and E contain the amplified DNA fragments corresponding to EP₁, EP₂, EP₃ and EP₄ receptors respectively, lane F is the amplified DNA fragment corresponding to hypoxanthine phosphoribosyltransferase, a housekeeping enzyme, lane G contains all the PCR reaction components without added reverse transcription product. This is representative gel from the ganglia of 1 of 13 mice (8 male, 5 female).

To determine which EP receptor PGE₂ was acting at to inhibit I_Ca, we examined the effects of selective EP receptor agonists on I_Ca in Type 1 and Type 2 cells. The effects of PGE₂ were mimicked by the selective EP₃ receptor agonist ONO-AE-248 (Fig. 7), but not by selective agonists for EP₁ receptors (ONO-DI-004, 100 nm-3 μm), EP₂ receptors (ONO-AE1–259, 300 nm-10 μm) or EP₄ receptors (ONO-AE1–329, 100 nm-3 μm). At the highest concentrations tested the EP₁, EP₂ and EP₄ receptor agonists did not affect I_Ca in any cell (n = 7–9 for each of Type 1 and Type 2 cells, data not shown).

Figure 7. The EP₃ agonist ONO-AE-248 inhibits I_Ca in Type 1 and Type 2 trigeminal neurons.

Representative time plots of ONO-AE-248 inhibition of peak I_Ca in a Type 1 (Aa) and Type 2 (Ba) neuron. I_Ca was elicited by stepping the membrane potential from −80 to 0 mV. Example traces from the Type 1 neuron (Ab) and Type 2 (Bb) neurons are shown in Aa and Ba. C, the inhibition of I_Ca by ONO-AE-248 in Type 1 (triangles) and Type 2 (squares) neurons was concentration dependent, with an EC₅₀ of 580 nm and 1.4 μm, respectively. Each point represents the mean and s.e.m. of 6–10 cells. D, overnight treatment with PTX (100 ng ml⁻¹) strongly reduced the ONO-AE-248 (10 μm) inhibition of I_Ca in Type 2 but not Type 1 cells, whereas treatment with CTX (250 ng ml⁻¹) overnight blocked the ONO-AE-248 inhibition of I_Ca in Type 1 but not Type 2 cells (n = 6–15 for each).

In Type 1 neurons ONO-AE-248 inhibited I_Ca in 25 of 36 cells, with an EC₅₀ of 1.4 μm (logEC₅₀ −5.9 ± 0.1) to a maximum of 28 ± 2 % (Fig. 7C). In Type 2 cells ONO-AE-248 inhibited I_Ca in all 40 cells tested, with an EC₅₀ of 580 nm (logEC₅₀ −6.2 ± 0.1) to a maximum of 30 ± 2 % (Fig. 7C). The inhibition of I_Ca by ONO-AE-248 was also associated with significant slowing of the activation kinetics of I_Ca in both Type 1 and Type 2 cells. In Type 1 cells, 30 μm ONO-AE-248 resulted in a slowing of the 0–50 % rise time of I_Ca from 1.21 ± 0.15 ms to 1.38 ± 0.18 ms (n = 10, P < 0.02 paired t test). In Type 2 cells 30 μm ONO-248 slowed the 0–50 % rise time from 1.2 ± 0.1 ms to 1.55 ± 0.15 ms (n = 9, P < 0.02, paired t test). The inhibition of I_Ca by ONO-AE-248 was blocked by overnight CTX treatment in Type 1 but not Type 2 cells, whereas PTX pre-treatment blocked the effects of ONO-AE-248 in Type 2 cells but not in Type 1 cells (Fig. 7D). These data indicate that ONO-AE-248 inhibits I_Ca in a manner similar to that of PGE₂.

PGE₂ inhibits predominantly N- and P/Q-type I_Ca

Type 1 and Type 2 trigeminal sensory neurons both express predominantly N- and P/Q-type HVA I_Ca, with a lesser amount of R-type current, while Type 1 cells also have some L-type I_Ca (Borgland et al. 2001). We examined the inhibition of the different types of I_Ca in Type 1 and Type 2 sensory neurons by applying PGE₂ in the presence of combinations of calcium channel antagonists. A predominantly N-type I_Ca was isolated by using a combination of the P/Q-type I_Ca antagonist ω-agatoxin IVA (500 nm) and the L-type I_Ca antagonist nimodipine (3 μm). When applied in the presence of these antagonists, PGE₂ (1 μm) inhibited N-type I_Ca by 21 ± 3 % (n = 5) in Type 1 neurons and 30 ± 4 % (n = 9) in Type 2 neurons. A predominantly P/Q-type I_Ca was isolated using the N-type I_Ca antagonist ω-conotoxin GVIA (1 μm) and nimodipine (3 μm). In the presence of these antagonists PGE₂ (1 μm), inhibited P/Q-type I_Ca by 19 ± 3 % (n = 6) in Type 1 cells and 15 ± 1 % (n = 6) in Type 2 neurons. The residual L-type and R-type I_Ca recorded in the presence of ω-agatoxin IVA (500 nm) and ω-conotoxin GVIA (1 μm) were not inhibited by PGE₂ (1 μm) in either Type 1 or Type 2 neurons (n = 9).

DISCUSSION

In adult mouse trigeminal sensory neurons, PGE₂ inhibited HVA I_Ca in almost all of the cells tested, but did so via two different G protein coupling mechanisms in electrophysiologically and pharmacologically distinct subpopulations of cells. Prostaglandins have been shown to inhibit I_Ca in rat sympathetic neurons (Ikeda, 1992; Ito et al. 2000), melanotrophs (Tanaka et al. 1998) and bovine adrenal chromaffin cells (Currie & Fox, 2000), but the only previous study to examine the actions of PGE₂ on I_Ca in sensory neurons found that PGE₂ increased the calcium current amplitude (Nicol et al. 1992). The reason(s) for the very different findings of this study and those of Nicol and colleagues (1992) are not known, but the earlier study was performed in very different cells — embryonic chicken sensory neurons.

PGE₂ inhibited I_Ca via two different signal transduction pathways in different trigeminal neuron populations. In Type 1 trigeminal neurons PGE₂-mediated inhibition of I_Ca was abolished by CTX pre-treatment and unaffected by PTX. In contrast, in Type 2 neurons inhibition of I_Ca was blocked by PTX treatment and unaffected by CTX treatment. These results imply that in Type 2 cells the PGE₂ receptors are coupled predominantly through Gi/o proteins, whereas in Type 1 cells PGE₂ receptors couple to calcium channels exclusively through Gs. Rapid, voltage-dependent inhibition of I_Ca via native PTX-insensitive G proteins has been observed in several cell types with agonists such as vasoactive intestinal polypeptide (VIP) (Zhu & Ikeda, 1994; Ehrlich & Elmslie, 1995), histamine and PGE₂ (Currie & Fox, 2000). VIP inhibition of I_Ca in sympathetic neurons occurs via a CTX-sensitive, PKA-independent pathway with kinetic characteristics identical to PTX-sensitive pathways in the same cell (Zhu & Ikeda, 1994; Ehrlich & Elmslie, 1995). Similar results were obtained in this study, where the CTX-sensitive PGE₂ inhibition of I_Ca appeared to be mediated via G protein βγ subunits, which also mediated the PTX-sensitive inhibition of I_Ca by baclofen (see below). In bovine adrenal chromaffin cells, both histamine and PGE₂ inhibit I_Ca via a voltage-dependent, PTX-insensitive pathway, but the involvement of Gs, or other types of G protein, has not been addressed.

In both types of cells the inhibition of I_Ca appeared to be consistent with βγ-subunits of the G protein heterotrimers interacting with calcium channels. The rise time of I_Ca in the presence of PGE₂ was slowed in both types of cell, and the magnitude of the PGE₂-induced inhibition of I_Ca could be strongly reduced by a positive conditioning step; both these features are characteristic of the G protein βγ subunit-mediated pathway of calcium channel inhibition (Herlitze et al. 1996; Ikeda 1996; Zamponi & Snutch, 1998). Similarly, in sympathetic neurons and melanotrophs PGE₂ couples to inhibition of I_Ca predominantly via a PTX-sensitive βγ subunit-mediated pathway (Ikeda 1992; Tanaka et al. 1998; Ito et al. 2000). The present results do not preclude the possibility that PGE₂ modulates HVA I_Ca via other second messenger systems as well.

Different conditioning pulse protocols were required to relieve I_Ca inhibition by PGE₂ in Type 1 versus Type 2 cells. In Type 1 cells a step to +130 mV was required to observe significant relief of PGE₂-induced inhibition, while a step to +100 mV was sufficient in Type 2 cells. There are several possible explanations for this. Different G protein βγ subtypes that have a stronger affinity for calcium channels may be coupled to different G proteins in Type 1 versus Type 2 cells. Differential voltage-dependent effects on I_Ca of different G protein βγ subunits have been observed in rat superior cervical ganglion neurons, where G protein βγ subunits derived from Goa or Gi heterotrimers were not equally effective in promoting voltage-dependent inhibition of I_Ca (Delmas et al. 1999). Recombinant N-type and P/Q-type calcium channels are differentially modulated by different types of G protein β subtypes (Arnot et al. 2000), and so association of different βγ subunits with Gsα versus PTX-sensitive G proteins in sensory neurons may explain our observations. However, the identity of the calcium channels and their accessory subunits in Type 1 or Type 2 cells may also be responsible for the need for more robust depolarizations in Type 1 cells to obtain relief from PGE₂ inhibition. Different splice variants of N-type or P/Q-type calcium channels have been identified and may be differentially affected by G protein βγ subunits (Lin et al. 1997; Bourinet et al. 1999; Delmas et al. 2000), leading to variable neurotransmitter modulation of otherwise similar channels in native neurons. An example of such variability which may be a result of alternative splicing of the α1B subunit is found in superior cervical ganglion neurons. In these cells, dendrites uniquely expressed an N-type calcium channel which had enhanced interactions with G protein βγ subunits (Delmas et al. 2000), which resulted in the dendrites of these neurons being ‘hypersensitive’ to neurotransmitter-mediated regulation of I_Ca when compared with the cell body. The dendritic N-type channel also showed reduced relief from G protein βγ inhibition for a given depolarizing step. Similar differences in G protein βγ subunit-mediated regulation of I_Ca can also occur when different calcium channel β-subunits associate with a given pore forming subunit (Canti et al. 2000; Feng et al. 2001). Although mouse trigeminal neurons appear to have similar amounts of N-type and P/Q-type calcium channels in Type 1 and Type 2 cells (Borgland et al. 2001), our studies cannot detect different splice variants of the α subunit of the channels, or the identity of the calcium channel β subunits they are associated with.

Although we found mRNA for all four types of EP prostanoid receptor in whole trigeminal ganglion, EP₃ receptors appeared to mediate the effects of PGE₂ in both types of trigeminal neuron. Of the selective EP receptor agonists tested, only the EP₃ agonist ONO-AE-248 mimicked the PGE₂ inhibition of I_Ca. Agonists selective for EP1 (ONO-DI-004), EP2 (ONO-AE1–259) or EP4 receptors (ONO-AE1–329) did not modulate I_Ca in any neurons examined. These agents have been reported to be potent and very selective agonists at native and recombinant mouse EP receptors (Zacherowski et al. 1999; Suzawa et al. 2000). The inhibition of I_Ca by ONO-AE-248 had similar operational characteristics to that caused by PGE₂ in that it was associated with a significant slowing of the activation of I_Ca and was largely abolished by CTX treatment in Type 1 cells and PTX treatment in Type 2 cells. ONO-AE-248 was considerably less potent than PGE₂ in inhibiting I_Ca. This is consistent with previous findings demonstrating that ONO-AE-248 inhibited forskolin-stimulated adenylyl cyclase activity in cells expressing recombinant murine EP₃ receptors at least 10-fold less potently than PGE₂ (Zacharowski et al. 1999). Mouse EP₃ receptor mRNA can undergo multiple alternative splicing events to produce proteins which can couple to either only Gi/Go (EP_3α and EP_3β, Sugimoto et al. 1993) or to both Gi/Go and Gs (EP_3γ, Irie et al. 1993). The relative expression of these isoforms in mouse sensory neurons has not been established, but the results of the present study are consistent with the expression of at least the EP_3γ isoform in trigeminal neurons.

The presence of multiple EP receptors in mouse trigeminal ganglion is generally consistent with other reports (Oida et al. 1995; Narumiya et al. 1999), although the presence of EP₂ receptor mRNA has not to our knowledge been reported in mouse. All four EP receptor types are found in rat dorsal root ganglion neurons although one study found only one of the rat EP₃ splice variants (Southall & Vasko, 2001), while another found all three (Donaldson et al. 2001). In cultured rat dorsal root ganglion neurons, the Gs-coupled EP_3c receptor subtype (together with EP4 receptors), was found to be necessary for full expression of some of the biochemical correlates of PGE₂-mediated sensitization, namely elevation of cAMP and enhanced release of substance P and calcitonin gene-related peptide (Southall & Vasko, 2001).

The present study identified inhibition of HVA I_Ca as a novel mechanism by which PGE₂ can modify the activity of virtually all sensory neurons. In many sensory neurons PGE₂ directly enhances excitability (Ingram & Williams, 1996; Gold et al. 1996; Evans et al. 1999) and sensitizes the cells to a variety of stimuli (Pitchford & Levine, 1991; Cui & Nicol, 1995; Lopshire & Nicol, 1998). These effects occur predominantly via processes that involve activation of adenylyl cyclase via Gs (Ingram & Williams, 1996; England et al. 1996; Evans et al. 1999). The adenylyl cyclase-dependent sensitization by PGE₂ is likely to occur in the Type 1 trigeminal sensory neurons, which are opioid and capsaicin sensitive, and in which PGE₂ inhibits I_Ca via Gs. Although often considered simply an inhibitory effect, the reduction of calcium entry via HVA I_Ca may also enhance sensory neuronal excitability by indirectly inhibiting calcium-dependent after-hyperpolarizations, which can allow neurons to attain higher frequencies of action potentials.

We have also identified a significant population of trigeminal sensory neurons in which PGE₂ is unlikely to act as a sensitizing agent, at least when acting through EP₃ receptors. In these Type 2 neurons PGE₂ appears to couple predominantly through inhibitory G proteins. Although we have not established whether other EP receptor subtypes act on other channels to modulate the activity of Type 2 neurons, these neurons also lack one of the major substrates for PGE₂-mediated sensitization, VR1 receptors (Lopshire & Nicol, 1998; Borgland et al. 2001). We speculate that the rapid elevations of PGE₂ in the spinal cord that can follow a peripheral noxious stimulus (Yang et al. 1996) may act to dampen sensory input from this population of neurons by inhibiting I_Ca in the spinal terminals of these cells. In a preliminary study in the substantia gelatinosa of the spinal trigeminal nucleus of the rat, we have reported that PGE₂ inhibited spontaneous miniature glutamatergic synaptic currents (Jennings et al. 2000). In contrast, and consistent with the excitatory effects of PGE₂ on sensory neurons, another study found a PGE₂-induced enhancement of glutamatergic synaptic currents in mouse lumbar dorsal horn neurons (Minami et al. 1999). These two studies, together with the data reported here, indicate that PGE₂ can act in ways other than simply as a sensitizing agent for sensory neurons, and appears to differentially modulate the sensory information coming from distinct populations of sensory neurons.