Skip to main content
The Journal of Physiology logoLink to The Journal of Physiology
. 2002 May 15;541(Pt 1):273–281. doi: 10.1113/jphysiol.2001.015594

Muscle glycogen content and glucose uptake during exercise in humans: influence of prior exercise and dietary manipulation

Adam Steensberg *,†, Gerrit van Hall *, Charlotte Keller *,†, Takuya Osada *, Peter Schjerling *, Bente Klarlund Pedersen *,†, Bengt Saltin *, Mark A Febbraio *,‡
PMCID: PMC2290308  PMID: 12015435

Abstract

There are many factors that can influence glucose uptake by contracting skeletal muscle during exercise and although one may be intramuscular glycogen content, this relationship is at present not fully elucidated. To test the hypothesis that muscle glycogen concentration influences glucose uptake during exercise, 13 healthy men were studied during two series of experiments. Seven men completed 4 h of two-legged knee extensor exercise 16 h after reducing of muscle glycogen by completing 60 min of single-legged cycling (Series 1). A further six men completed 3 h of two-legged knee extensor exercise on two occasions: one after 60 min of two-legged cycling (16 h prior to the experimental trial) followed by a high carbohydrate diet (HCHO) and the other after the same exercise followed by a low carbohydrate diet (LCHO) (Series 2). Muscle glycogen was decreased by 40 % when comparing the pre-exercised leg (EL) with the control leg (CL) prior to exercise in Series 1. In addition, muscle glycogen was decreased by the same magnitude when comparing LCHO with HCHO in Series 2. In Series 1, glucose uptake was 3-fold higher in the first 60 min of exercise, in the presence of unchanged pre-exercise GLUT4 protein in EL compared with CL, suggesting that the lower glycogen, and not the exercise the day before, might have provided the stimulus for increased glucose uptake. Despite the same magnitude of difference in pre-exercise glycogen concentration when comparing Series 1 with Series 2, neither direct-nor isotopic tracer-determined glucose uptake was higher in LCHO compared with HCHO in Series 2. However, arterial concentrations of insulin and glucose were lower, while free fatty acids and adrenaline were higher in LCHO compared with HCHO. These data suggest that pre-exercise glycogen content may influence glucose uptake during subsequent exercise. However, this is only the case when delivery of substrates and hormones remains constant. When delivery of substrates and hormones is altered, the potential effect of glycogen on glucose uptake is negated.


It is well established that the rate of muscle glycogen utilization during prolonged exercise is influenced, in part, by initial glycogen concentration (Gollnick et al. 1972; Gollnick et al. 1981; Hargreaves et al. 1995, van Hall et al. 1995; Weltan et al. 1998; Blomstrand & Saltin, 1999). This is probably due to the fact that glycogen can bind to glycogen phosphorylase, the enzyme responsible for glycogen breakdown, to increase its activity (Johnson, 1992). It has also been suggested that glucose uptake during exercise is influenced by glycogen content (Richter et al. 2001a), although the effect of pre-exercise glycogen content on glucose uptake is unclear (Gollnick et al. 1981; Hargreaves et al. 1995; Blomstrand & Saltin, 1999, Richter et al. 2001b). The confusion within the literature may be related to the methodology utilized to deplete muscle glycogen prior to exercise. One experimental approach to determine the effect of glycogen content on glucose uptake during contraction is to deplete one leg of glycogen by single-legged exercise prior to performing two-legged exercise. Such an approach resulted in higher glucose uptake in a leg that commenced exercise with lower glycogen content when compared with the contralateral leg, which contained a normal glycogen concentration (Gollnick et al. 1981; Blomstrand & Saltin, 1999). While this experimental approach has the advantage of ensuring that the delivery of hormones and substrates to the contracting muscles is identical, the effect of the prior exercise in one limb may affect glucose transport per se. Indeed, since GLUT4 total protein was not measured in the previous studies that adopted this model (Gollnick et al. 1981; Blomstrand & Saltin, 1999) the authors could not rule out the possibility that the stimulus for the augmented glucose uptake was increased GLUT4 protein and not glycogen content per se.

An alternative experimental approach is to perform two experimental trials following a standardized exercise bout and the ingestion of either a high fat or high carbohydrate diet in the intervening period. While this method has the advantage of normalizing pre-exercise activity levels, it may result in an altered delivery of substrates and/or hormones to the contracting muscles. Such fluctuations may influence glucose uptake independent of glycogen availability. In the study by Hargreaves et al. (1995), while a direct measure of glucose flux across the contracting limb was not made, isotopic tracer-determined glucose uptake was not different during exercise when comparing two trials with differing pre-exercise glycogen content. However, the authors conceded that the maintenance of glucose rate of disappearance (Rd) in the low glycogen trial might have been influenced by the lower plasma glucose and insulin and higher plasma free fatty acids (FFA) during exercise, a situation where glucose uptake would be expected to decrease (Galbo et al. 1979; Hargreaves et al. 1991). In addition, dietary manipulation such as that adopted by Hargreaves et al. (1995) also results in altered adrenaline secretion (Galbo et al. 1979), which has been demonstrated to influence glucose uptake during exercise (Watt et al. 2001).

Clearly, the effect of glycogen content on glucose uptake requires further clarification and we aimed to do so by performing two series of experiments. In Series 1, we had humans perform 4 h of two-legged knee extensor exercise, 16 h after performing one-legged cycling exercise. Along with a measurement of glucose uptake and glycogen content, we also measured GLUT4 gene and protein expression. We hypothesized that glucose uptake would be augmented in the previously exercised leg and that this would be due to a difference in glycogen content per se and not due to any alteration in GLUT4 protein content. In Series 2, we had subjects perform two trials of two-legged exercise for 3 h following a standardized exercise bout performed 16 h prior to the trials and the ingestion of either a high fat or high carbohydrate diet in the intervening period. We attempted to alter pre-exercise glycogen content by a similar magnitude as we altered glycogen content between legs in Series 1. We hypothesized that despite a difference in muscle glycogen, glucose uptake would be similar when comparing trials because of the counter-regulatory effects of altered arterial delivery of substrates and/or hormones.

METHODS

Subjects

Thirteen healthy, physically active, but not specifically trained male subjects were recruited for this study. Seven (mean aged 26 (range 19-33), mean weight 75 kg (range 70-82) and height 1.84 m (range 1.75-1.96)) participated in Series 1, while six (mean aged 26 (range 22-33), mean weight 78 kg (range 70-82) and height 1.87 m (range 1.75-1.93)) participated in Series 2. The study was approved by the Ethical Committee of the Copenhagen and Frederiksberg Communities, Denmark, and performed according to the ‘Declaration of Helsinki’. Subjects were informed about the possible risks and discomfort involved before their written consent was obtained.

Pre-experimental testing

Each subject underwent preliminary exercise tests on the two-legged knee-extensor apparatus (Blomstrand & Saltin, 1999). After they became familiar with the knee extensor exercise model, they underwent a maximal exercise test to determine their individual knee extensor peak power output (Wmax,ke). Thereafter, they performed ≈2 h of two-legged knee extensor exercise at 40 % Wmax,ke (mean workload = 66.7 ± 4 W) in order to become fully accustomed to performing the exercise for prolonged periods.

At 17:00 h the day before the experimental trial in Series 1 and the two experimental trials in Series 2 subjects reported to the laboratory and performed 60 min of either one- (Series 1) or two- (Series 2) legged cycling followed by 60 min of two-arm cranking at a workload that subjects could tolerate for the duration of the exercise period. This protocol was designed to reduce glycogen from the quadriceps of the exercised leg(s) and minimize resynthesis in the leg(s), by allowing endogenous glucose production to be distributed to the muscles of the upper body for the period between the depletion protocol and the experimental trial. Apart from being permitted to drink water ad libitum, the subjects were instructed to abstain from consuming food and drink from 13:00 h on the day of the depletion protocol until the cessation of the experiment. In Series 1, however, each subject was provided with a low carbohydrate diet for the intervening period, which was to be consumed by 07:00 h on the morning of the experimental trial. This diet consisted of three eggs, six slices of bacon and 500 ml of diet cola to consume on the evening before the experimental trial and two eggs to consume at 7:00 h on the morning of the experimental trial. This diet provided ≈3932 kJ (24 % protein, 2 % carbohydrate, 74 % fat). In Series 2, subjects consumed either the diet described above in LCHO or 300 ml of fruit juice, 500 ml of cola, 100 g of raisins, 500 g of pasta (20 % protein, 75 % carbohydrate, 5 % fat) in HCHO. The diets in Series 2 were isocaloric and were consumed by 07:00 h on the morning of the two experimental trials.

Experimental procedures

Series 1

Subjects reported to the laboratory at 07:30 h, voided, changed into appropriate exercise attire and remained supine for the next 1.5 h. After 10 min in supine position, the femoral artery and vein from the right leg and the femoral vein of the left leg were cannulated under local anaesthesia (lidocaine, 20 mg ml−1) as previously described (Andersen & Saltin, 1985). The subjects then exercised for 4 h at the workload used during the familiarization trial. Blood samples were obtained immediately prior to exercise and at 1 h intervals during the exercise. At each sampling time point the femoral arterial blood flow in both legs was measured with ultrasound Doppler, as previously validated (Rådegran, 1997). Muscle biopsies were obtained from the vastus lateralis of both limbs using the percutaneous biopsy technique with suction at rest and immediately following exercise. Muscle samples were analysed for glycogen, lactate, ATP, phosphocreatine (CrP) and creatine (Cr). In addition, the muscle sample at rest was also analysed for GLUT4 gene and protein expression. Blood samples were analysed for insulin, glucose and FFA.

Series 2

Experimental trials were separated by at least 2 weeks. Subjects reported to the laboratory at 07:30 h on both occasions, voided, changed into appropriate exercise attire and remained supine for the next 2-2.5 h. After 10 min in supine position, a catheter was placed in the antecubital vein of one arm and following the collection of a basal blood sample, a primed (1.7 mmol), continuous (0.25 mmol kg−1 min−1) infusion of [6,6-2H2]glucose (Cambridge Isotope Laboratories, Cambridge, MA, USA) was commenced and maintained during 2 h of rest. The femoral artery and vein from one leg were then cannulated. After 2 h of isotopic tracer infusion, the infusion rate was increased 2-fold. Subjects then exercised for 3 h at ≈55 % Wmax,ke (mean workload = 92.5 ± 3.7 W). Blood samples were obtained immediately prior to exercise and at 30, 60, 90, 120 and 180 min during the exercise. At each sampling time point the femoral arterial blood flow in both legs was measured with ultrasound Doppler, as previously validated (Rådegran, 1997). Muscle biopsies were obtained from vastus lateralis using the percutaneous biopsy technique with suction at rest and immediately following exercise. Muscle samples were analysed for glycogen and GLUT4 mRNA. Blood samples were analysed for glucose, [6,6-2H2]glucose, free fatty acids (FFA), adrenaline, noradrenaline, cortisol and insulin.

Blood analysis

Plasma glucose and FFA were determined using an automatic analyser (Cobas Fara, Roche, France), plasma insulin (Insulin RIA 100, Amersham, Pharmacia, Biotech, Uppsala, Sweden) and cortisol (Diagnostic Products Corporation, Los Angeles, USA) by radioimmunoassay and plasma adrenaline and noradrenaline by high performance liquid chromatography. These analyses are described in more detail elsewhere (Blomstrand & Saltin, 1999; Starkie et al. 2000; Steensberg et al. 2001). An aliquot of blood was mixed in a tube containing lithium heparin and spun in a centrifuge. The resultant plasma was stored for measurement of [6,6-2H2]glucose enrichment. Briefly, 250 μl of water and 3 ml chloroform-methanol (2.3:1 v/v) was added to 150 μl plasma, mixed and centrifuged at 4 °C for 15 min. The supernatant was decanted and washed once by adding 1 ml of water (pH 2 with hydrochloric acid) and 2 ml of chloroform before being spun as described above. The upper layer was dehydrated and derivatized with the addition of butylboronic acid and pyridine (100 mg:10 ml w/v) and incubated at 95 °C for 30 min. Thereafter, 250 μl of acetic anhydride was added and incubated at room temperature for 90 min. The solution was dehydrated and re-dissolved in 100 μl of ethyl acetate. The deuterium enrichment of glucose was determined by split injection (ratio 1:30) of 1 μl samples using a gas chromatograph mass spectrometer (GC column, CP-SIL 8CB, Chromopack, the Netherlands). Glucose Ra (rate of glucose appearance) and glucose Rd (rate of glucose disappearance) were determined from changes in the percentage enrichment in the plasma of [6,6-2H2]glucose, calculated using the one-pool non steady-state model (Steele et al. 1956), assuming a pool fraction of 0.65 and estimating the apparent glucose space as 25 % of body weight. The metabolic clearance rate (MCR) of glucose, which represents the amount of plasma required to clear a set amount of glucose, was calculated by dividing glucose Rd by the plasma glucose concentration.

Muscle analysis

Upon sampling, muscle samples were rapidly frozen in liquid nitrogen and stored at −80 °C until analysis. The muscle biopsies were first analysed for total water content by weighing the samples before and after freeze-drying. They were subsequently extracted and analysed for glycogen, lactate, Cr, CrP and ATP using enzymatic analysis with fluorometric detection, as previously described (Febbraio et al. 1994). The concentrations of all metabolites except for glycogen and lactate (due to the extracellular presence of glucose and lactate) were adjusted to the peak total creatine (Cr + CrP) for each subject.

GLUT4 mRNA and protein

Northern analysis

Total RNA from Series 1 and Series 2 was extracted from the muscle biopsies, as described by Chomczynski & Sacchi (1987). The Pfu polymerase (Stratagene, La Jolla, USA) was used to amplify PCR products from human muscle cDNA in Series 1 using the following primers for GLUT4 (GenBank NM-001042; CTGTGCCATCCTGATGACTG; and GGG TTT CAC CTCCTGCTCTA) and GAPDH (GenBank NM-002046; GAACATCATCCCTGCCTCTACT; and GTCTACATG GCA ACT GTGAGGA). The PCR products were cloned into the Sma I site of pBlueScript II SK(+) (Alting-Mees & Short, 1989), resulting in the plasmids pCM160 (GLUT4, orientation opposite lacZ) and pCM5 (GAPDH, orientation as lacZ). Radioactive single-stranded probes were made from these plasmids, as previously described (Jonsdottir et al. 2000). In Series 1, GLUT4 mRNA levels were determined by Northern blotting, as described by Ingelbrecht et al. (1998), and normalized to GAPDH.

In Series 2, GLUT4 mRNA was measured by real time PCR, as previously described (Starkie et al. 2000), using the forward primer 5′-CCTGCCAGAAAGAGTCTGAAGC-3′, reverse primer 5′-ATCCTTCAGCTCAGCCAGCA-3′ and TaqMan fluorescent probe 5′-FAM (6-carboxyfluorescein)-CAGAAACAT CGGCCC AGCCTGTCA-3′TAMRA. In Series 2, GLUT4 mRNA was normalized to 18S.

Since differences were observed in GLUT4 mRNA when comparing EL with CL in Series 1, we determined GLUT4 protein in these muscle samples using Western blot analyses as previously described (Campbell & Febbraio, 2001).

Statistical analysis

A two-way (treatment × time) repeated measures analysis of variance (ANOVA) was performed on the data from Series 1 and Series 2 respectively. Following a significant F test, pair-wise differences were identified using Newman-Keuls post hoc procedure. Student's t tests were also performed on the change in glycogen content (post-exercise-pre-exercise) for both Series 1 and Series 2. The significance level was set at P < 0.05. Data are presented as means ± s.e.m. unless otherwise stated.

RESULTS

Leg blood flow measures

Leg blood flow during exercise did not differ when comparing trials in Series 1, averaging 2.27 ± 0.20 and 2.18 ± 0.14 l min−1 for the pre-exercise leg (EL) and the control leg (CL) respectively. Likewise, leg blood flow during exercise did not differ when comparing trials in Series 2, averaging 2.29 ± 0.14 and 2.18 ± 0.09 l min−1 for LCHO and HCHO respectively.

Muscle glycogen in Series 1 and 2

Muscle glycogen was ≈40 % lower in EL compared with CL prior to exercise in Series 1 (204 ± 25 vs. 353 ± 23 mmol (kg dry wt)−1 for EL and CL respectively; P < 0.05). Likewise, muscle glycogen was ≈40 % lower in LCHO compared with HCHO prior to exercise in Series 2 (241 ± 25 vs. 398 ± 55 mmol (kg dry wt)−1 for LCHO and HCHO respectively; P < 0.05). No differences in muscle glycogen were observed when comparing treatments following exercise in either Series 1 or Series 2. Muscle glycogen was lower (P < 0.05) post- compared with pre-exercise in all conditions. The change in glycogen was greater (P < 0.05) in CL compared with EL in Series 1 and HCHO compared with LCHO in Series 2 (Table 1).

Table 1.

Muscle glycogen concentrations from Series 1 and Series 2

Pre–Ex End–Ex Δ(End-Pre)
Series 1
  EL 204 ± 25 118 ± 16* 86 ± 29
  CL 353 ± 23† 163 ± 23* 190 ± 25†
Series 2
  LCHO 241 ± 35 134 ± 40* 107 ± 29
  HCHO 398 ± 55† 153 ± 50* 245 ± 62†

Muscle glycogen concentration before (Pre–Ex) and immediately following (End-Ex) 4 h of knee-extensor exercise and glycogenolysis (Δ(End–Pre)) in a leg exercised 16 h before experimentation (EL) and a control leg (CL) in Series 1 and before (Pre-Ex) and immediately following (End–Ex) 3 h of knee-extensor exercise after a low (LCHO) and high (HCHO) carbohydrate diet in Series 2.

†

P < 0.05 when comparing EL with CL in Series 1 and LCHO with HCHO in Series 2.

*

P < 0.05 compared with Pre-Ex. Values expressed as mmol (kg dry wt) −1; data expressed as means ± s.e.m. (n = 7, Series 1; n = 6, Series 2).

Muscle metabolites and GLUT4 in Series 1 and 2

ATP was not affected by either treatment or exercise during Series 1. CrP was reduced (P < 0.05) and Cr increased (P < 0.05) after exercise, but there were no differences in these metabolites when comparing EL with CL. There was a significant treatment effect (P < 0.05) for muscle lactate with values being higher in CL compared with EL (Table 2). Pre-exercise GLUT4 mRNA was higher (P < 0.05) in EL compared with CL, but no differences were observed in GLUT4 protein at this time when comparing treatments (Fig. 1). There were no differences in pre-exercise GLUT4 mRNA when comparing LCHO with HCHO in Series 2 (1.0 ± 0.0 vs. 0.9 ± 0.2 arbitrary units for LCHO and HCHO respectively).

Table 2.

Muscle metabolites from Series 1

Metabolite EL Pre–Ex CL Pre–Ex EL End–Ex CL End–Ex
ATP 21.2 ± 1.1 20.7 ± 0.9 20.7 ± 1.5 21.6 ± 0.8
CrP* 84.5 ± 2.0 90.4 ± 2.5 73.0 ± 2.6 72.6 ± 2.2
Cr* 45.6 ± 1.7 39.7 ± 1.5 57.1 ± 1.7 57.4 ± 2.7
La−† 5.6 ± 1.0 6.8 ± 1.2 5.7 ± 0.6 7.9 ± 0.5

Muscle metabolite concentration before (Pre–Ex) and immediately following exercise (End–Ex) in a leg exercised 16 h before experimentation (EL) and a control leg (CL) in Series 1.

†

Main treatment effect (P < 0.05)

*

Main time effect (I < 0.05). ATP, adenosine 5'-triphosphate; CrP, phosphocreatine; Cr, creatine; La−, lactate. Values expressed as mmol (kg dry wt)−1; data expressed as means ± s.e.m. (n = 7).

Figure 1.

Figure 1

Skeletal muscle GLUT4 mRNA (A) and protein (B) in a leg exercised 16 h before experimentation (EL) and a control leg (CL) in Series 1. # denotes difference (P < 0.05) from CL. Data expressed as means ± s.e.m. (n = 7).

Arterial plasma metabolites and net leg glucose balance in Series 1 and 2

Arterial plasma FFA was higher (P < 0.05) and glucose lower (P < 0.05) at all time points during exercise compared with rest in Series 1 (Fig. 2). Likewise, net leg glucose uptake was higher (P < 0.05) in both EL and CL at all times during exercise compared with pre-exercise values. In addition, net leg glucose uptake was ≈3-fold higher in EL compared with CL after 60 min in Series 1 (1.65 ± 0.41 vs. 0.42 ± 0.36 mmol min−1 for EL and CL respectively; P < 0.05), but no differences were observed when comparing legs at any other measurement point (Fig. 2).

Figure 2.

Figure 2

Arterial plasma free fatty acid (FFA; A), insulin (B), glucose (C) and net glucose uptake (D) in a leg exercised 16 h before experimentation (EL) and a control leg (CL) in Series 1. # denotes difference (P < 0.05) when comparing EL with CL. Data expressed as means ± s.e.m. (n = 7).

Arterial plasma FFA were higher (P < 0.05) at all time points during exercise in both HCHO and LCHO compared with rest. In addition, arterial plasma FFA was higher (P < 0.05) at all time points during exercise in LCHO compared with HCHO (Fig. 3). In contrast, arterial plasma glucose was lower (P < 0.05) throughout exercise in LCHO compared with HCHO (Fig. 3). Net leg glucose uptake was increased (P < 0.05) when comparing rest with exercise. No differences were observed in net leg glucose uptake when comparing LCHO with HCHO at rest or in the first 90 min of exercise. It was, in fact, lower in LCHO compared with HCHO in the latter 90 min of exercise (0.52 ± 0.09 vs. 0.99 ± 0.24 mmol min−1 for LCHO and HCHO respectively; P < 0.05; Fig. 3).

Figure 3.

Figure 3

Arterial plasma free fatty acid (FFA; A), glucose (B) and net glucose uptake (C) during exercise after a low carbohydrate (LCHO) and high carbohydrate (HCHO) diet in Series 2. # denotes difference (P < 0.05) when comparing LCHO with HCHO. Data expressed as means ± s.e.m. (n = 6).

Plasma glucose kinetics in Series 2

Glucose Ra was higher (P < 0.05) at all time points during exercise compared with rest. Although glucose Ra was similar when comparing trials at rest, it was lower (P < 0.05) in LCHO compared with HCHO at all time points during exercise (Fig. 4). Glucose Rd was higher (P < 0.05) at all time points during exercise compared with rest. Although glucose Rd was not different when comparing LCHO with HCHO in the initial 90 min of exercise it was, in fact, lower (P < 0.05) in LCHO compared with HCHO in the latter 90 min of exercise (10.54 ± 0.95 vs. 14.28 ± 0.92 μmol kg−1 min−1 for LCHO and HCHO respectively; P < 0.05; Fig. 4). MCR was higher (P < 0.05) at all time points during exercise compared with rest. No differences were, however, observed when comparing LCHO with HCHO at any time (Fig. 4).

Figure 4.

Figure 4

Rate of [6,6-2H]glucose appearance (Ra; A), disappearance (Rd; B) and metabolic clearance rate (MCR; C) during exercise after a low carbohydrate (LCHO) and high carbohydrate (HCHO) diet in Series 2. # denotes difference (P < 0.05) when comparing LCHO with HCHO. Data expressed as means ± s.e.m. (n = 6).

Plasma hormones in Series 1 and 2

Plasma insulin was lower (P < 0.05) at all time points during exercise compared with rest in Series 1 (Fig. 2). A main treatment effect was observed for plasma insulin, with values being lower (P < 0.05) in LCHO compared with HCHO in Series 2 (Fig. 5). Plasma adrenaline and noradrenaline were increased (P < 0.05) at all time points during exercise compared with rest in Series 2. In addition, concentrations of these catecholamines were higher (P < 0.05) after 90 min and subsequently in LCHO compared with HCHO (Fig. 5). Plasma cortisol was higher (P > 0.05) after 90 min in LCHO and after 180 min in HCHO compared with rest. In addition, the concentration of this hormone was higher (P < 0.05) at 90 and 120 min in LCHO compared with HCHO (Fig. 5).

Figure 5.

Figure 5

Arterial plasma adrenaline (A), noradrenaline (B), insulin (C) and cortisol (D) during exercise after a low carbohydrate (LCHO) and high carbohydrate (HCHO) diet in Series 2. # denotes difference (P < 0.05) when comparing LCHO with LCHO, § denotes main treatment effect (P < 0.05). Data expressed as means ± s.e.m. (n = 6).

DISCUSSION

The results from this study demonstrate that, despite a similar magnitude of difference in pre-exercise glycogen content when comparing Series 1 with Series 2, initial glucose uptake was only different when comparing conditions in Series 1. Therefore, our data suggest that glucose uptake is affected by pre-exercise glycogen content, but altering the delivery of substrates and/or hormones can override the effect of glycogen in the control of glucose uptake by contracting skeletal muscle.

In Series 1, pre-exercise glycogen content was reduced by approximately 40 % in one leg by prior exercise, the day before the experimental trial. As a result, glucose uptake was increased approximately 3-fold in the first 60 min of exercise when comparing the glycogen depleted with the control leg. It was not surprising that the augmented increase in glucose uptake was not observed late in exercise because neither glycogen (Table 1) nor the measurement of other intramuscular metabolites (Table 2) were different when comparing the depleted with the control leg at the end of exercise. It is of note that the difference in glucose uptake was not apparent after 120 min of exercise in Series 1. Since muscle samples were not obtained throughout exercise in Series 1, we are uncertain whether glycogen concentration was different when comparing EL with CL at this time. However, since glycogen binds to glycogen phosphorylase to increase its activity (Johnson, 1992), it is possible that the difference in glycogen between EL and CL was abolished by this time.

It could be argued that because the difference in glucose uptake was transient (Fig. 2), this was mediated not by the difference in pre-exercise glycogen content per se, but by the residual effects of prior exercise in the depleted leg. Indeed, previous studies in both rats (Kou et al. 1999) and humans (Greiwe et al. 2000) have demonstrated that acute exercise increases GLUT4 protein expression in skeletal muscle. The data from the present study contrast these previous studies. Despite a small increase in GLUT4 mRNA as a result of exercise the previous day, the GLUT4 protein was remarkably similar (Fig. 1). The reason for the discrepancy between our results and those of Greiwe et al. (2000) is not readily apparent. In the previous study subjects performed 60 min of two-legged cycling, whereas in the current study subjects performed one-legged exercise of a similar duration and intensity. Although further research is required to clarify this anomaly, we are confident that in our study the prior exercise had no influence on GLUT4 protein expression and that the augmented glucose uptake in the depleted leg cannot be attributed to an increase in crude membrane transporter protein expression. Despite the fact that crude membrane GLUT4 protein expression was not increased as a result of prior exercise, it is possible that GLUT4 translocation from the intracellular compartment to the plasma membrane and/or the intracellular signalling cascade responsible for trafficking GLUT4 was influenced by the prior exercise. In the current study we were unable to make such measurements, but based on previous results this seems unlikely. It has been previously demonstrated that acute exercise increases GLUT4 translocation from the intracellular pool to the plasma membrane in human skeletal muscle (Kristiansen et al. 1996), but the time course for transport from the plasma membrane back to the intracellular stores in recovery from acute exercise has not been measured in human skeletal muscle. Nonetheless, Goodyear et al. (1991) have made such measurements in rodent skeletal muscle and have demonstrated that the translocation of GLUT4 to the plasma membrane as a result of acute exercise is transient, with GLUT4 protein content in the plasma membrane returning to basal levels within 3 h. It is also possible that the activity of intracellular signalling molecules associated with the trafficking of GLUT4 to the plasma membrane could be up-regulated such that, at the onset of subsequent exercise, GLUT4 translocation is increased. While the precise signalling pathway for contraction-mediated glucose uptake has not been fully elucidated, it has been suggested that 5′-AMP-activated protein kinase (AMPK) may have a regulatory role in contraction-mediated glucose uptake (Hayashi et al. 1998). In this regard, Wojtaszewski et al. (2000) have recently demonstrated that the exercise-induced activation of the specific isoform α2-AMPK in human skeletal muscle is transient with levels returning to baseline within 3 h of the cessation of exercise. Taken together, our GLUT4 data and those of Goodyear et al. (1991) and Wojtaszewski et al. (2000) argue against the prior exercise being the regulator of the augmented glucose uptake observed during exercise in the depleted leg in Series 1. Rather, we propose that the lower glycogen per se in the depleted leg gave rise to the activation of intracellular processes ultimately resulting in an increase in GLUT4 protein in the plasma membrane and an increase in glucose uptake. Indeed, while the effect of glycogen content on GLUT4 translocation has not been measured in human muscle, Derave et al. (1999) have demonstrated, in rodent skeletal muscle, that both contraction-stimulated glucose uptake and cell surface GLUT4 protein expression are dependent upon glycogen content.

It is also possible that the difference in glucose uptake when comparing EL with CL in Series 1 was due to the effect of prior exercise in EL on insulin sensitivity. It has been well demonstrated that prior exercise can enhance insulin sensitivity (for review see Richter et al. 2001a), an effect that may persist for up to 48 h (Mikines et al. 1988). In addition, it must be noted that subjects consumed a low carbohydrate diet in the intervening period between the prior exercise and the experiment. Since diet can influence glucose disposal (Richter et al. 2001a), it is possible that glucose uptake was reduced somewhat in both EL and CL due to the low carbohydrate intake. Hence, while our data suggest that pre-exercise muscle glycogen influences glucose uptake during exercise, we cannot categorically rule out the effect of prior exercise on our measures.

Even though glycogen content may have affected glucose uptake during exercise in Series 1, neither direct (Fig. 3) nor tracer-determined (Fig. 4) glucose disposal was higher when comparing LCHO with HCHO in Series 2. In fact, glucose Rd was lower in LCHO compared with CHO late in exercise (Fig. 4). It is important to note that the magnitudes of difference in glycogen content when comparing Series 1 with Series 2 were remarkably similar (Table 1). Since both plasma glucose and glucose Ra was lower throughout exercise in LCHO it is possible that the lower delivery of glucose led to a lower glucose disposal. However, if glucose delivery were the sole reason for abolishing differences in glucose disposal when comparing LCHO with HCHO, then the MCR would have been higher in LCHO, because MCR measures the amount of plasma that is cleared for a given amount of glucose. Rather, MCR was very similar when comparing these two trials, indicating that other factors might have contributed to the regulation of glucose disposal in Series 2. Indeed, arterial FFA and adrenaline were higher, and insulin lower in LCHO compared with HCHO throughout exercise (Fig. 5). Circumstances of altered insulin (Lavoie et al. 1997) and FFA (Hargreaves et al. 1991) concentration can markedly affect glucose uptake during exercise. In addition, an increase in adrenaline concentration has recently been demonstrated to decrease glucose uptake during exercise (Watt et al. 2001). Hence, it appears from our data that changes in circulating hormones and substrates have the capacity to override any possible effect of glycogen content on glucose uptake during exercise. It must be noted, however, that the present data contrast those of a recent study. Richter et al. (2001b) demonstrated that leg glucose uptake was twice as high during bicycling when subjects performed exercise the preceding day followed by a low carbohydrate diet compared with a high carbohydrate diet. It must be noted, however, that in this recent study (Richter et al. 2001b) subjects performed bicycle exercise at 70 % maximal oxygen consumption for a much shorter duration (1 h), while the magnitude of difference in pre-exercise glycogen content (185 vs. 800 mmol (kg dry wt)−1 was much higher than in the present study. These methodological differences are likely to account for the different results when comparing the data of Richter et al. (2001b) with the current data.

In summary, our results suggest that pre-exercise glycogen content may affect glucose uptake during subsequent exercise. However, this is only the case when delivery of substrates and hormones remains constant. When delivery of substrates and hormones is altered, the possible effect of glycogen on glucose uptake is negated.

Acknowledgments

The authors wish to thank the subjects who participated in this study for their extraordinary effort. In addition, the technical assistance of Ruth Rousing, Carsten Nielsen, Brigitte Jessen, Hanne Willumsen, Dr Shannon Campbell and Vigdis Christie is greatly acknowledged. This study was supported by the Danish National Research Foundation (504-14).

REFERENCES

  1. Alting-Mees MA, Short JM. pBluescript II: gene mapping vectors. Nucleic Acids Research. 1989;17:9494–9494. doi: 10.1093/nar/17.22.9494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Andersen P, Saltin B. Maximal perfusion of skeletal muscle in man. Journal of Physiology. 1985;366:233–249. doi: 10.1113/jphysiol.1985.sp015794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Blomstrand E, Saltin B. Effect of muscle glycogen on glucose, lactate and amino acid metabolism during exercise and recovery in human subjects. Journal of Physiology. 1999;514:293–302. doi: 10.1111/j.1469-7793.1999.293af.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Campbell SE, Febbraio MA. Effect of ovarian hormones on GLUT4 expression and contraction-stimulated glucose uptake. American Journal of Physiology - Endocrinology and Metabolism. 2001;282:E1139–1146. doi: 10.1152/ajpendo.00184.2001. [DOI] [PubMed] [Google Scholar]
  5. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Analytical Biochemistry. 1987;162:156–159. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
  6. Derave W, Lund S, Holman GD, Wojtaszewski J, Pedersen O, Richter EA. Contraction-stimulated muscle glucose transport and GLUT-4 surface content are dependent on glycogen content. American Journal of Physiology. 1999;277:E1103–1110. doi: 10.1152/ajpendo.1999.277.6.E1103. [DOI] [PubMed] [Google Scholar]
  7. Febbraio MA, Snow RJ, Stathis CG, Hargreaves M, Carey MF. Effect of heat stress on muscle energy metabolism during exercise. Journal of Applied Physiology. 1994;77:2827–2831. doi: 10.1152/jappl.1994.77.6.2827. [DOI] [PubMed] [Google Scholar]
  8. Galbo H, Holst JJ, Christensen NJ. The effect of different diets and of insulin on the hormonal response to prolonged exercise. Acta Physiologica Scandinavica. 1979;107:19–32. doi: 10.1111/j.1748-1716.1979.tb06438.x. [DOI] [PubMed] [Google Scholar]
  9. Gollnick PD, Pernow B, Essén B, Jansson E, Saltin B. Availability of glycogen and plasma FFA for substrate utilization in leg muscle of man during exercise. Clinical Physiology. 1981;1:27–42. [Google Scholar]
  10. Gollnick PD, Piehl K, Saubert CW, Armstrong RB, Saltin B. Diet, exercise, and muscle glycogen. Journal of Applied Physiology. 1972;33:421–425. doi: 10.1152/jappl.1972.33.4.421. [DOI] [PubMed] [Google Scholar]
  11. Goodyear LJ, Hirshman MF, Horton ES. Exercise-induced translocation of skeletal muscle glucose transporters. American Journal of Physiology. 1991;261:E795–799. doi: 10.1152/ajpendo.1991.261.6.E795. [DOI] [PubMed] [Google Scholar]
  12. Greiwe JS, Holloszy JO, Semenkovich CF. Exercise induces lipoprotein lipase and GLUT-4 protein in muscle independent of adrenergic receptor signalling. Journal of Applied Physiology. 2000;89:176–181. doi: 10.1152/jappl.2000.89.1.176. [DOI] [PubMed] [Google Scholar]
  13. Hargreaves M, Kiens B, Richter EA. Effect of increased plasma free fatty acids concentrations on muscle metabolism in exercising men. Journal of Applied Physiology. 1991;70:194–201. doi: 10.1152/jappl.1991.70.1.194. [DOI] [PubMed] [Google Scholar]
  14. Hargreaves M, McConell G, Proietto J. Influence of muscle glycogen on glycogenolysis and glucose uptake during exercise in humans. Journal of Applied Physiology. 1995;78:288–292. doi: 10.1152/jappl.1995.78.1.288. [DOI] [PubMed] [Google Scholar]
  15. Hayashi T, Hirshman MF, Kurth EJ, Winder WW, Goodyear LJ. Evidence for 5′AMP-activated protein kinase mediation of the effect of muscle contraction on glucose transport. Diabetes. 1998;47:1369–1373. doi: 10.2337/diab.47.8.1369. [DOI] [PubMed] [Google Scholar]
  16. Ingelbrecht IL, Mandelbaum CI, Mirkov TE. Highly sensitive northern hybridization using a rapid protocol for downward alkaline blotting of RNA. Biotechniques. 1998;25:420–426. doi: 10.2144/98253st03. [DOI] [PubMed] [Google Scholar]
  17. Johnson LN. Glycogen phosphorylase: control by phosphorylation and allosteric effectors. FASEB Journal. 1992;6:2274–2282. doi: 10.1096/fasebj.6.6.1544539. [DOI] [PubMed] [Google Scholar]
  18. Jonsdottir IH, Schjerling P, Ostrowski K, Asp S, Richter EA, Pedersen BK. Muscle contractions induce interleukin-6 mRNA production in rat skeletal muscles. Journal of Physiology. 2000;528:157–163. doi: 10.1111/j.1469-7793.2000.00157.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kristiansen S, Hargreaves M, Richter EA. Exercise-induced increase in glucose transport, GLUT-4, and VAMP-2 in plasma membrane from human muscle. American Journal of Physiology. 1996;270:E197–201. doi: 10.1152/ajpendo.1996.270.1.E197. [DOI] [PubMed] [Google Scholar]
  20. Kuo C-H, Browning KS, Ivy JL. Regulation of GLUT4 protein expression and glycogen storage after prolonged exercise. Acta Physiologica Scandinavica. 1999;165:193–201. doi: 10.1046/j.1365-201x.1999.00489.x. [DOI] [PubMed] [Google Scholar]
  21. Lavoie C, Ducros F, Bourque J, Langelier H, Chiasson JL. Glucose metabolism during exercise in man: the role of insulin in the regulation of glucose utilization. Canadian Journal of Physiology and Pharmacology. 1997;75:36–43. [PubMed] [Google Scholar]
  22. Mikines K, Sonne B, Farrell P, Tronier B, Galbo H. Effect of physical exercise on sensitivity and responsiveness to insulin in humans. American Journal of Physiology. 1988;254:E248–259. doi: 10.1152/ajpendo.1988.254.3.E248. [DOI] [PubMed] [Google Scholar]
  23. Rådegran J. Ultrasound Doppler estimates of femoral artery blood flow during dynamic knee extensor exercise in humans. Journal of Applied Physiology. 1997;83:1383–1388. doi: 10.1152/jappl.1997.83.4.1383. [DOI] [PubMed] [Google Scholar]
  24. Richter EA, Derave W, Wojtaszewski JFP. Glucose, exercise and insulin: emerging concepts. Journal of Physiology. 2001a;535:313–322. doi: 10.1111/j.1469-7793.2001.t01-2-00313.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Richter EA, McDonald C, Kiens B, Hardie DG, Wojtaszewski JFP. Dissociation of 5′AMP-activated protein kinase activity and glucose uptake in human skeletal muscle during exercise. Diabetes. 2001b;50(suppl. 2):A62. abstract. [Google Scholar]
  26. Starkie RL, Angus DJ, Rolland J, Hargreaves M, Febbraio MA. Effect of prolonged, submaximal exercise and carbohydrate ingestion on monocyte intracellular cytokine production in humans. Journal of Physiology. 2000;528:647–655. doi: 10.1111/j.1469-7793.2000.t01-1-00647.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Steele R, Wall JS, Debodo RC, Altszuler N. Measurement of size and turnover rate of body glucose pool by the isotopic dilution method. American Journal of Physiology. 1956;187:15–24. doi: 10.1152/ajplegacy.1956.187.1.15. [DOI] [PubMed] [Google Scholar]
  28. Steensberg A, Toft AD, Schjerling P, Halkjær-kristensen J, Pedersen BK. Plasma interleukin-6 during strenuous exercise: role of epinephrine. American Journal of Physiology. 2001;281:C1001–1004. doi: 10.1152/ajpcell.2001.281.3.C1001. [DOI] [PubMed] [Google Scholar]
  29. Van Hall G, Saltin B, Van Der Vusser GJS, Söderlund K, Wagenmakers AJM. Deamination of amino acids as a source of ammonia production during prolonged exercise. Journal of Physiology. 1995;489:251–261. doi: 10.1113/jphysiol.1995.sp021047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Watt M, Howlet TK, Febbraio M, Spriet LL, Hargreaves M. Adrenaline increases skeletal muscle glycogenolysis, pyruvate dehydrogenase activation and carbohydrate oxidation during moderate exercise in humans. Journal of Physiology. 2001;534:269–278. doi: 10.1111/j.1469-7793.2001.t01-1-00269.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Weltan SM, Bosch AN, Dennis SC, Noakes TD. Influence of muscle glycogen content on metabolic regulation. American Journal of Physiology. 1998;274:E72–82. doi: 10.1152/ajpendo.1998.274.1.E72. [DOI] [PubMed] [Google Scholar]
  32. Wojtaszewski JFP, Nielsen P, Hansen BF, Richter EA, Kiens B. Isoform-specific and exercise intensity-dependent activation of 5′-AMP-activated protein kinase in human skeletal muscle. Journal of Physiology. 2000;528:221–226. doi: 10.1111/j.1469-7793.2000.t01-1-00221.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Physiology are provided here courtesy of The Physiological Society

RESOURCES