Abstract
Porcine reproductive and respiratory syndrome virus (PRRSV) infects mature dendritic cells (mDCs) derived from porcine monocytes and matured with lipopolysaccharide. The infection of mDCs induced apoptosis, reduced the expression of CD80/86 and major histocompatibility complex class II molecules, and increased the expression of interleukin-10, thus suggesting that such mDC modulation results in the impairment of T-cell activation.
Porcine reproductive and respiratory syndrome virus (PRRSV) is an enveloped RNA virus that belongs to the Arteriviridae family (15). PRRSV is responsible for significant economic losses and is the cause of the most important infectious disease affecting swine production worldwide. PRRSV infects pigs of different ages, and cells supporting PRRSV replication are located in different organs and tissues, with alveolar macrophages being the principal cell type that supports replication. Apoptotic cells have been associated with PRRSV infection, and they are distributed in different infected tissues, including lung, testes, and lymph node (21, 22). Protective immunity against PRRSV is not clearly understood. A delay in the appearance of the cellular immune response suggests that PRRSV infection involves a mechanism of immunosuppression or immunomodulation (18). Recently, it was reported that PRRSV infects and interferes with some functions of immature monocyte-derived dendritic cells (DCs) (3, 11, 27), as evidenced by the down-regulation of alpha interferon (IFN-α) mRNA and the up-regulation of IFN-β and tumor necrosis factor alpha (TNF-α) mRNA without changes in the production of interleukin-10 (IL-10), IL-12, and IFN-γ (27). No report exists, however, on the effects of PRRSV on mature DCs (mDCs). In this paper, we report the effects of PRRSV on mature porcine monocyte-derived DCs. Our results show that PRRSV replicated in mDCs, induced apoptosis, down-regulated the expression of CD80/86 costimulatory and major histocompatibility complex class II (MHC-II) molecules, reduced the allogeneic stimulation of T cells, and up-regulated the expression of IL-10 (mRNA and protein).
The PRRSV strain NVSL 97-7895 (GenBank accession no. AY545985) was propagated in MARC-145 cells, and the supernatant was collected, titrated, and stored at −70°C. Porcine alveolar macrophages (PAM) were collected and maintained as described previously (14). The following monoclonal antibodies were used: for MHC-II, MSA3; for CD172a, SWC3 (74-22-15); and for CD14, CAM36A; all were from VMRD (Pullman, WA). Other key reagents included mouse immunoglobulin G (IgG) Fc-human cytotoxic T-lymphocyte-associated antigen 4 fusion protein (501-820; Ancell, Bayport, MN), goat anti-mouse IgG-fluorescein isothiocyanate (IgG-FITC) (Southern Biotech), and recombinant porcine IL-4 (PSC0045) and recombinant porcine granulocyte-macrophage colony-stimulating factor (PSC2015) from Biosource International (Camarillo, CA). Escherichia coli O55:B5 lipopolysaccharide (LPS) and PCR primers and probe were from Sigma (St. Louis, MO). Blood samples were taken from 4- to 8-week-old White/Yorkshire hybrid pigs, and peripheral blood mononuclear cells (PBMCs) were isolated in gradients of Ficoll-Hypaque as previously described (8) and resuspended in complete Dulbecco's modified Eagle's medium (DMEM) containing 10% heat-inactivated fetal bovine serum, 50 mM 2-mercaptoethanol, 100 IU penicillin/ml, and 100 μg streptomycin/ml. PBMCs were placed in 75-cm2 tissue culture flasks, and monocytes were allowed to adhere through overnight incubation at 37°C in 5% CO2. Nonadherent cells were removed by being washed with DMEM, and the adherent cells were cultured in complete DMEM containing 20 ng/ml of each recombinant porcine granulocyte-macrophage colony-stimulating factor and IL-4 at 37°C and 5% CO2 in a humidified incubator. The cultures were incubated for 5 days, and half of the culture medium was changed on days 2 and 5. On day 5, LPS was added (2 μg/ml), and the cells were cultured for two more days. On day 7, nonadherent cells (mDCs) were harvested from the supernatant by being washed twice with DMEM, resuspended in complete DMEM, and infected with PPRSV.
The mDCs were infected at a multiplicity of infection of 0.1 for 1 h. To eliminate unabsorbed virus, cells were washed three times by centrifugation at 200 × g at 4°C, resuspended in fresh medium, and cultured for 72 h. Samples of PRRSV-infected mDCs were taken every 24 h and were stored at −70°C until the infectivity assay was performed. The expression of CD14, CD172a, MHC-II, CD80/86, and PRRSV N protein (determined by intracellular staining) was evaluated 24 h postinfection (hpi) by flow cytometry as previously described (8). At 24 hpi, RNA was extracted from infected and noninfected mDCs using TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Reverse transcription was done using Superscript II reverse transcriptase (Invitrogen) in a total volume of 20 μl. Real-time PCR was performed with a Brilliant quantitative PCR core reagent kit (Stratagene, La Jolla, CA) and a SmartCycler system (Cepheid, Sunnyvale, CA). The amplification conditions were as follows: 50°C for 2 min and 95°C for 10 min, and then 40 cycles of 95°C for 15 s and 60°C for 1 min. Primers and probes are listed in Table 1. For the quantification of mRNA, differences in threshold cycle (CT) values between infected and noninfected DCs were evaluated with the 2−ΔΔCT formula. The CTs from infected and noninfected cells were normalized against an endogenous control (peptidylprolyl isomerase A).
TABLE 1.
Gene | Primer sequence (5′→3′)
|
Probe sequenceb (5′→3′) | |
---|---|---|---|
Forward | Reverse | ||
IFN-α | TCAGCTGCAATGCCATCTG | AGGGAGAGATTCTCCTCATTTGTG | TET-TGACCTGCCTCAGACCCACAGCC-BHQ1 |
IL-10 | TGAGAACAGCTGCATCCACTTC | TCTGGTCCTTCGTTTGAAAGAAA | TET-CAACCAGCCTGCCCCACATGC-BHQ1 |
PPIAc | GCCATGGAGCGCTTTGG | TTATTAGATTTGTCCACAGTCAGCAAT | TET-TGATCTTCTTGCTGGTCTTGCCATTCCT-BHQ1 |
ORF5-outer | CCTGAGACCATGAGGTGGG | GCGGTCACTACTATATACGG | |
ORF5-nest | ATGTTGGGGAAATGCTTGACCGC | CTGCAGCTAAGGACGACCCCATTGTTCCG |
Sequences for cytokines and peptidylprolyl isomerase A are from the Porcine Immunology and Nutrition database (http://www.ars.usda.gov/Services/docs.htm?docid=6065).
TET, 6-carboxy-2′4,7,7′-tetrachlorofluorescein; BHQ1, black hole quencher.
PPIA, peptidylprolyl isomerase A.
To detect PRRSV RNA, ORF5 gene-specific nested reverse transcription-PCR was used as previously described (12). Apoptosis was analyzed by annexin V-FITC and propidium iodide (PI) staining and by flow cytometry following the manufacturer's instructions (Zymed Laboratories, San Francisco, CA). IL-10 was quantified using an enzyme-linked immunosorbent assay kit (Biosource, Camarillo, CA), and an allogeneic assay was performed as previously described (7). Data were analyzed as follows. A Mann-Whitney U test was used to assess differences between infected and noninfected DCs, the allogeneic proliferative response and IL-10 production in the culture supernatant were analyzed by a paired t test, and cytokine mRNA expression was analyzed using one-way analysis of variance followed by Tukey's multiple-comparison test. All of the statistical analyses were carried out using the NCCS 2001 package.
Flow cytometric analysis revealed that, after 5 days of culture, the predominant cell phenotype was CD14low, MHC-II+, CD80/86+, and CD172a+ (n = 4) (Fig. 1). LPS stimulation increased the expression of MHC-II and CD80/86 molecules but did not affect the expression of CD14 or CD172a (Fig. 1). The exposure of mDCs to PRRSV consistently induced the same phenotypic changes throughout four independent experiments. A reduction in the expression of CD80/86 costimulatory molecules and MHC-II molecules was observed with a phenotype similar to that of immature DCs, although no significant changes in CD14 or CD172a antigens were noticed (Fig. 1). An allogeneic assay was conducted to quantify the effects of the PRRSV-induced down-regulation of costimulatory and MHC-II molecules. The results showed that PRRSV-infected mDCs induced a 4.5-fold lower level of proliferation than mock-treated mDCs (Fig. 2).
At 24 hpi, GP5 glycoprotein RNA was expressed in infected mDCs (n = 3) (Fig. 3A). N protein expression occurred in about 30% (range, 20 to 59%; n = 3) of mDCs (Fig. 3B and C), and offspring virus could be detected in the supernatant of the infected cells after 24, 48, and 72 hpi (Fig. 3D). Importantly, no differences were observed between the levels of PRRSV replication in PAM and mDCs at 48 and 72 h, but significant differences were observed at 24 h (Fig. 3D). These results suggest that mDCs are fully permissive to PRRSV replication, leading to the release of infectious viral progeny. Annexin V-FITC and PI staining of PRRSV-infected mDCs showed that the number of early apoptotic cells increased by 44% at 24 hpi (range, 36 to 51%; n = 3; P < 0.05) (Fig. 4). No significant changes were observed in the frequency of late apoptotic or necrotic cells between infected and noninfected mock-treated mDCs.
The expression of cytokine mRNA was quantified by real-time PCR, and the results are expressed as relative increments of IL-10 and IFN-α in infected versus noninfected mDCs (Fig. 5A). Our results showed that the infection of mDCs by PRRSV increases the expression of IL-10 mRNA by 6.20-fold (P < 0.05), but only a 1.04-fold increase in IFN-α mRNA was seen (P > 0.05). These data also suggest that a significant increase in IL-10 release takes place compared to the release of IFN-α (P < 0.05). The increase in IL-10 mRNA expression was in accordance with the production of IL-10 in the culture of infected mDCs. Consistent increases in IL-10 production were observed in PRRSV-infected DCs compared to the production level in mock-treated DCs (P < 0.02) (Fig. 5B).
The mDCs generated in this study showed a morphology and phenotype consistent with that of previous reports (2, 19). We induced the maturation process by stimulating immature DCs with LPS, and we observed increments in the percentage and mean fluorescence intensity of CD80/86 and MHC-II (Fig. 2), which demonstrate the mature status of the cells. No changes were observed in CD172a+ and CD14low expression. At 24 hpi, the PRRSV GP5 and N proteins were expressed, and PRRSV could be detected in infected mDCs, suggesting that mDCs are permissive to infection and that such permissiveness is similar in mDCs and in PAM. This outcome confirms and extends previous reports that PRRSV can productively infect immature DCs (3, 11, 27) but, apparently, not lung DCs (11). The differences in the lineage of the cells could explain such discrepancies (11), but further experiments are needed to test these differences.
By evaluating changes in PRRSV-infected mDCs, we found that PRRSV down-regulates the cell surface expression of MHC-II and CD80/D86, as has been reported for other viruses, such as varicella-zoster virus (17). Similar observations have been reported for PRRSV infection of immature DCs (27). A logical consequence of this down-regulation would be the reduced allogeneic proliferation that we observed upon the infection of mDCs with PRRSV. However, the infection of porcine lung DCs with PRRSV induces a down-regulation of MHC-II, but not CD80/86, expression or the ability to stimulate allogeneic T-cell proliferation. The addition of IFN-α reverses the MHC-II down-regulation without affecting T-cell proliferation (11).
Upon the infection of mDCs by PRRSV, we observed low levels of IFN-α mRNA expression but high levels of IL-10 mRNA expression and production in the cell supernatant. Based on these results, we can assume that the reduced proliferation of T cells incubated with the infected DCs is caused by the low level of expression of the CD80/86 and MHC-II molecules and by the production of antiinflammatory IL-10. These results are in agreement with those of Loving et al. (11), who detected no production of IFN-α, but differ from those of Wang et al. (27), who described unaltered IL-10 production after the infection of immature DCs. One possibility for this discrepancy resides in the state of differentiation of the DCs. Immature DCs have a minimal ability to produce IL-10, but after stimulation with bacteria, soluble CD40 ligand, or LPS, mDCs produce high levels of IL-10 (5). IL-10 production down-regulates the production of inflammatory cytokines, and the neutralization of IL-10 increases the production of IL-12 and TNF-α (5). Interestingly, Wang et al. (27) found a significant increase in the levels of TNF-α but no changes in IL-10 secretion. Therefore, it is possible that the differential IL-10 production is a property of some DC subsets, as described for human epidermal Langerhans cells and mouse spleen DCs, which do not express IL-10 mRNA (9, 25). Another possibility is that PRRSV up-regulates IL-10 production by mDC but not by immature DCs by a yet-to-be-defined mechanism.
IL-10 levels are enhanced in pigs infected with PRRSV (23, 24), and the production in PBMC from vaccinated pigs is dependent on the virus strain involved (6). IL-10 plays a role in immune suppression and can be inhibitory in a variety of ways. The secretion of IL-10 down-regulates MHC expression, as do costimulatory and other surface molecules that induce depressed antigen presentation and a suppressed immune response. IL-10 also has down-regulatory properties for a number of proinflammatory cytokines, including IL-12. IL-10 is essential in limiting the immune response to numerous pathogens and subsequent immune pathologies (16).
Previous studies demonstrated that PRRSV encodes two separate immune evasion strategies, specifically by (i) down-regulating the inflammatory cytokine response and inducing the up-regulation of IL-10 expression during PRRSV infection (4, 18, 24, 26) or vaccination against PRRSV (20), and (ii) delaying the appearance of the protective humoral response and the initial clonal amplification of PRRSV-specific T lymphocytes while transiently enhancing the ability of PRRSV to replicate in lung, lymphoid, and reproductive tract sites (1, 10, 13, 17). According to our present results and those of others (3, 11, 27), a third possible immune evasion mechanism for PRRSV is productive DC infection and the modulation of cytokine production. Such an outcome could impair the ability of DCs to function properly.
Acknowledgments
We thank Waithaka Mwangi for helpful comments, suggestions, and the critical reading of the manuscript. We also thank Mónica Brito for technical assistance and the Laboratorio Ramos and M. C. Alfonso Ramos for support with the use of flow cytometry.
This work was supported by SEP-CONACYT (proyecto no. 43602) and by USDANRICGP (grant no. 005-01810). Lilian Flores-Mendoza and Erika Silva-Campa received scholarships from CONACYT.
Footnotes
Published ahead of print on 13 February 2008.
REFERENCES
- 1.Batista, L., C. Pijoan, S. Dee, M. Olin, T. Molitor, H. S. Joo, Z. Xiao, and M. Murtaugh. 2004. Virological and immunological responses to porcine reproductive and respiratory syndrome virus in a large population of gilts. Can. J. Vet. Res. 68:267-273. [PMC free article] [PubMed] [Google Scholar]
- 2.Carrasco, C. P., R. C. Rigden, R. Schaffner, H. Gerber, V. Neuhaus, S. Inumaru, H. Takamatsu, G. Bertoni, K. C. McCullough, and A. Summerfield. 2001. Porcine dendritic cells generated in vitro: morphological, phenotypic and functional properties. Immunology 104:175-184. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Charerntantanakul, W., R. Platt, and J. A. Roth. 2006. Effects of porcine reproductive and respiratory syndrome virus-infected antigen-presenting cells on T cell activation and antiviral cytokine production. Viral Immunol. 19:646-661. [DOI] [PubMed] [Google Scholar]
- 4.Chung, H. K., and C. Chae. 2003. Expression of interleukin-10 and interleukin-12 in piglets experimentally infected with porcine reproductive and respiratory syndrome virus (PRRSV). J. Comp. Pathol. 129:205-212. [DOI] [PubMed] [Google Scholar]
- 5.Corinti, S., C. Albanesi, A. la Sala, S. Pastore, and G. Girolomoni. 2001. Regulatory activity of autocrine IL-10 on dendritic cell functions. J. Immunol. 166:4312-4318. [DOI] [PubMed] [Google Scholar]
- 6.Díaz, I., L. Darwich, G. Pappaterra, J. Pujols, and E. Mateu. 2006. Different European-type vaccines against porcine reproductive and respiratory syndrome virus have different immunological properties and confer different protection to pigs. Virology 351:249-259. [DOI] [PubMed] [Google Scholar]
- 7.Garfias, Y., B. Ortiz, J. Hernandez, D. Magana, M. Becerril-Angeles, E. Zenteno, and R. Lascurain. 2006. CD4+ CD30+ T cells perpetuate IL-5 production in Dermatophagoides pteronyssinus allergic patients. Allergy 61:27-34. [DOI] [PubMed] [Google Scholar]
- 8.Hernández, J., Y. Garfias, A. Nieto, C. Mercado, L. F. Montano, and E. Zenteno. 2001. Comparative evaluation of the CD4+CD8+ and CD4+CD8− lymphocytes in the immune response to porcine rubulavirus. Vet. Immunol. Immunopathol. 79:249-259. [DOI] [PubMed] [Google Scholar]
- 9.Iwasaki, A., and B. L. Kelsall. 1999. Freshly isolated Peyer's patch, but not spleen, dendritic cells produce interleukin 10 and induce the differentiation of T helper type 2 cells. J. Exp. Med. 190:229-239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Lopez, O. J., and F. A. Osorio. 2004. Role of neutralizing antibodies in PRRSV protective immunity. Vet. Immunol. Immunopathol. 102:155-163. [DOI] [PubMed] [Google Scholar]
- 11.Loving, C. L., S. L. Brockmeier, and R. E. Sacco. 2007. Differential type I interferon activation and susceptibility of dendritic cell populations to porcine arterivirus. Immunology 120:217-229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Macías, M. J., G. Yépiz-Plascencia, F. Osorio, A. Pinelli-Saavedra, J. Reyes-Leyva, and J. Hernández. 2006. Isolation and characterization of the gene ORF5 of porcine reproductive and respiratory syndrome. Vet. Méx. 37:2. [Google Scholar]
- 13.Meier, W. A., J. Galeota, F. A. Osorio, R. J. Husmann, W. M. Schnitzlein, and F. A. Zuckermann. 2003. Gradual development of the interferon-gamma response of swine to porcine reproductive and respiratory syndrome virus infection or vaccination. Virology 309:18-31. [DOI] [PubMed] [Google Scholar]
- 14.Mengeling, W. L., K. M. Lager, and A. C. Vorwald. 1996. Alveolar macrophages as a diagnostic sample for detecting natural infection of pigs with porcine reproductive and respiratory syndrome virus. J. Vet. Diagn. Investig. 8:238-240. [DOI] [PubMed] [Google Scholar]
- 15.Meulenberg, J. J., M. M. Hulst, E. J. de Meijer, P. L. Moonen, A. den Besten, E. P. de Kluyver, G. Wensvoort, and R. J. Moormann. 1993. Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV. Virology 192:62-72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Moore, K. W., R. de Waal Malefyt, R. L. Coffman, and A. O'Garra. 2001. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 19:683-765. [DOI] [PubMed] [Google Scholar]
- 17.Morrow, G., B. Slobedman, A. L. Cunningham, and A. Abendroth. 2003. Varicella-zoster virus productively infects mature dendritic cells and alters their immune function. J. Virol. 77:4950-4959. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Murtaugh, M. P., Z. Xiao, and F. Zuckermann. 2002. Immunological responses of swine to porcine reproductive and respiratory syndrome virus infection. Viral Immunol. 15:533-547. [DOI] [PubMed] [Google Scholar]
- 19.Paillot, R., F. Laval, J. C. Audonnet, C. Andreoni, and V. Juillard. 2001. Functional and phenotypic characterization of distinct porcine dendritic cells derived from peripheral blood monocytes. Immunology 102:396-404. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Royaee, A. R., R. J. Husmann, H. D. Dawson, G. Calzada-Nova, W. M. Schnitzlein, F. A. Zuckermann, and J. K. Lunney. 2004. Deciphering the involvement of innate immune factors in the development of the host response to PRRSV vaccination. Vet. Immunol. Immunopathol. 102:199-216. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Sirinarumitr, T., Y. Zhang, J. P. Kluge, P. G. Halbur, and P. S. Paul. 1998. A pneumo-virulent United States isolate of porcine reproductive and respiratory syndrome virus induces apoptosis in bystander cells both in vitro and in vivo. J. Gen. Virol. 79:2989-2995. [DOI] [PubMed] [Google Scholar]
- 22.Sur, J. H., A. R. Doster, and F. A. Osorio. 1998. Apoptosis induced in vivo during acute infection by porcine reproductive and respiratory syndrome virus. Vet. Pathol. 35:506-514. [DOI] [PubMed] [Google Scholar]
- 23.Suradhat, S., and R. Thanawongnuwech. 2003. Upregulation of interleukin-10 gene expression in the leukocytes of pigs infected with porcine reproductive and respiratory syndrome virus. J. Gen. Virol. 84:2755-2760. [DOI] [PubMed] [Google Scholar]
- 24.Suradhat, S., R. Thanawongnuwech, and Y. Poovorawan. 2003. Upregulation of IL-10 gene expression in porcine peripheral blood mononuclear cells by porcine reproductive and respiratory syndrome virus. J. Gen. Virol. 84:453-459. [DOI] [PubMed] [Google Scholar]
- 25.Teunissen, M. B., C. W. Koomen, J. Jansen, R. de Waal Malefyt, E. Schmitt, R. M. Van den Wijngaard, P. K. Das, and J. D. Bos. 1997. In contrast to their murine counterparts, normal human keratinocytes and human epidermoid cell lines A431 and HaCaT fail to express IL-10 mRNA and protein. Clin. Exp. Immunol. 107:213-223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Thacker, E. L. 2001. Immunology of the porcine respiratory disease complex. Vet. Clin. N. Am. Food Anim. Pract. 17:551-565. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Wang, X., M. Eaton, M. Mayer, H. Li, D. He, E. Nelson, and J. Christopher-Hennings. 2007. Porcine reproductive and respiratory syndrome virus productively infects monocyte-derived dendritic cells and compromises their antigen-presenting ability. Arch. Virol. 152:289-303. [DOI] [PubMed] [Google Scholar]