Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2008 Jan 22;76(4):1434–1444. doi: 10.1128/IAI.01242-07

Regulatory Roles of CD1d-Restricted NKT Cells in the Induction of Toxic Shock-Like Syndrome in an Animal Model of Fatal Ehrlichiosis▿

H L Stevenson 1, E C Crossley 1, N Thirumalapura 1, D H Walker 1, N Ismail 1,*
PMCID: PMC2292873  PMID: 18212072

Abstract

CD1d-restricted NKT cells are key players in host defense against various microbial infections. Using a murine model of fatal ehrlichiosis, we investigated the role of CD1d-restricted NKT cells in induction of toxic shock-like syndrome caused by gram-negative, lipopolysaccharide-lacking, monocytotropic Ehrlichia. Our previous studies showed that intraperitoneal infection of wild-type (WT) mice with virulent Ehrlichia (Ixodes ovatus Ehrlichia [IOE]) results in CD8+ T-cell-mediated fatal toxic shock-like syndrome marked by apoptosis of CD4+ T cells, a weak CD4+ Th1 response, overproduction of tumor necrosis factor alpha and interleukin-10, and severe liver injury. Although CD1d−/− mice succumbed to high-dose IOE infection similar to WT mice, they did not develop signs of toxic shock, as shown by elevated bacterial burdens, low serum levels of tumor necrosis factor, normal serum levels of liver enzymes, and the presence of few apoptotic hepatic cells. An absence of NKT cells restored the percentages and absolute numbers of CD4+ and CD8+ T cells and CD11b+ cells in the spleen compared to WT mice and was also associated with decreased expression of Fas on splenic CD4+ lymphocytes and granzyme B in hepatic CD8+ lymphocytes. Furthermore, our data show that NKT cells promote apoptosis of macrophages and up-regulation of the costimulatory molecule CD40 on antigen-presenting cells, including dendritic cells, B cells, and macrophages, which may contribute to the induction of pathogenic T-cell responses. In conclusion, our data suggest that NKT cells mediate Ehrlichia-induced T-cell-mediated toxic shock-like syndrome, most likely via cognate and noncognate interactions with antigen-presenting cells.


Patients with severe human monocytotropic ehrlichiosis (HME) may develop sepsis or toxic shock-like syndrome (9), including elevated liver enzyme levels, hepatic injury and inflammation (34), and lymphopenia (33). HME is caused by Ehrlichia chaffeenesis, an obligately intracellular gram-negative bacterium that lacks lipopolysaccharide (LPS) and peptidoglycan (24). The clinical and pathological manifestations of the disease observed after intraperitoneal (i.p.) inoculation of mice with a virulent Ehrlichia species isolated from Ixodes ovatus ticks and referred to as I. ovatus Ehrlichia (IOE) reproduces the manifestations reported for severe and fatal human disease. This animal model of fatal HME has enabled us to further characterize the host immune response. Studies using this model have determined that decreased interleukin-12 (IL-12) production, a weak CD4+ Th1 response, expansion of pathogenic tumor necrosis factor alpha (TNF-α)-producing CD8+ T cells (19), elevated serum TNF-α and IL-10 levels (20, 37), and development of hepatic apoptosis and necrosis are associated with disease progression and development of fatal toxic shock-like syndrome (36). Recently, we determined the roles of CD8+ T cells in the pathogenesis of fatal ehrlichiosis by using two different types of CD8+ T-cell-deficient mice (β2m−/− and TAP−/−). Interestingly, we observed that β2m−/− mice that are deficient in both CD8+ and CD1d-restricted natural killer T (i.e., invariant NKT [iNKT] and variant NKT) cells are more resistant to fatal disease than TAP−/− mice that are deficient only in CD8+ T cells and that 90% of β2m−/− mice survived past day 30 postinfection (18). These observations, as well as the report by Mattner et al. (26) that NKT cells are directly activated by Ehrlichia muris, a species closely related both antigenically and phylogenetically to E. chaffeensis and IOE, persuaded us to examine more closely the role of NKT cells in severe ehrlichiosis.

NKT cells are a unique subset of T lymphocytes that express a semi-invariant T-cell receptor (TCR) and markers of natural killer (NK) cells. These cells have been identified as a novel lymphocyte population that acts in innate immune responses and also influences the acquired immune response (40). Unlike conventional antigen-specific T lymphocytes, NKT cells recognize glycolipids and phospholipids, rather than peptide antigens, presented by the nonclassical major histocompatibility complex (MHC) class I molecule CD1; however, the only CD1 receptor present in mice is CD1d. CD1d-restricted NKT cells comprise two major subsets, iNKT cells, which express exclusively an invariant TCR α chain (Vα14Jα18 in mice) and are activated by α-galactosylceramide, and variant NKT cells, which express more diverse TCRs. CD1d is an MHC class I-like molecule expressed on the surface of many cells, including hepatocytes (41) and professional antigen-presenting cells (APCs), including splenic dendritic cells (DCs), macrophages, and B cells (8). Expression of CD1d in the thymus is essential for positive selection of iNKT cells in the periphery.

NKT cells play a critical role in linking innate immunity and adaptive immunity by influencing the activation and effector functions of several hematopoietic cells, including DCs, macrophages/Kupffer cells, NK cells, and T and B lymphocytes (5). Fujii et al. (11) have shown that activation of iNKT cells by α-galactosylceramide results in up-regulation of CD40, CD80, CD86, and MHC class II on APCs similar to the up-regulation induced by Toll-like receptor ligation. This up-regulation may be important for the host's recognition of pathogens that lack LPS and peptidoglycan, such as ehrlichiae. Previously, we have shown that antigen-specific activation of NKT cells by Alphaproteobacteria lacking LPS, such as E. muris and Sphingomonas capsulata, is CD1d dependent and Toll-like receptor independent (26). This study further demonstrated that glycosylceramides are alternative ligands to LPS for innate recognition of the gram-negative, LPS-negative bacterial cell walls by NKT cells. In addition, activated NKT cells influence the Th1/Th2 phenotype of CD4+ T cells through their early and rapid production of large amounts of Th1 and Th2 cytokines, such as gamma interferon (IFN-γ) and IL-4, respectively. NKT cells also promote the induction of effector CD8+ T cells by enhancing the ability of APCs, mainly DCs, to activate naïve CD8+ T cells (38). Probably even more relevant is the capacity to activate cytotoxic T-lymphocyte (CTL) responses in the absence of CD4+ T-cell help. This phenomenon may be an important mechanism in severe ehrlichiosis, in which a significant decrease in the number of CD4+ Th1 cells has been observed (19).

We hypothesized that NKT cells may mediate tissue damage and toxic shock-like syndrome in the animal model of severe and fatal ehrlichiosis directly or indirectly by activating other cells of the immune system, including pathogenic CD8+ T cells. We investigated our hypothesis by studying lethal ehrlichial infection (i.e., i.p. inoculation of IOE) in CD1d−/− mice and identified a critical requirement for both CD1d expression and NKT cells in immunopathology and toxic shock. Our results indicate that NKT cells play both beneficial and detrimental roles during severe ehrlichial infection. On the one hand, NKT cells are critical in controlling the early bacterial burden and increase the number of costimulatory molecules on APCs. In contrast, they also promote Ehrlichia-mediated toxic shock-like syndrome. Understanding the immunopathology mediating fatal ehrlichiosis is critical for designing effective immune-based therapy not only against ehrlichiosis but also against toxic shock-like syndrome caused by Ehrlichia and other pathogens.

MATERIALS AND METHODS

Mice.

BALB/c wild-type (WT) or CD1d−/− (C.129S2-Cd1tm1Gru/J; stock number 003814) mice were used for all experiments (Jackson Laboratories, Bar Harbor, ME) except those whose results are shown in Fig. 1, in which we compared the disease characteristics in WT BALB/c mice to those in WT C57BL/6J mice. The mice were gender matched for each experiment and were 6 to 12 weeks old. Mouse handling and experimental procedures were conducted in accordance with the recommendations of the University of Texas Medical Branch Institutional Animal Care and Use Committee.

FIG. 1.

FIG. 1.

Survival, organ bacterial burdens, serum TNF-α and ALT concentrations, and liver lesions were similar in C57BL/6 and BALB/c WT mouse strains. Both WT BALB/c and C57BL/6 mice (nine mice per group) were inoculated with a high dose of IOE (1 × 105 genome copies) and monitored daily for signs of illness. The data represent the results of three independent experiments with three mice per group. (A) Survival rate of both WT C57BL/6 and BALB/c mice. (B) Bacterial burdens in the liver, lung, spleen, and kidney were not significantly (P > 0.05) different for the two mouse strains on day 7 postinfection. The bars indicate the averages and the error bars indicate the standard deviations for triplicate amplifications with three mice per group. (C and D) Serum levels of TNF-α (C) and ALT (D) were not significantly (P > 0.05) different in IOE-infected C57BL/6 and BALB/c WT mice on day 5 postinfection. The bars indicate the means and the error bars indicate the standard deviations for three mice per group. Similar results were obtained in three independent experiments.

Experimental design.

For all experiments a highly virulent Ehrlichia sp. (IOE), originally isolated from I. ovatus ticks in Japan, was used (17, 35). The genome copy numbers of IOE in our inocula were determined as previously reported (37). Mice were inoculated i.p. with a high dose of IOE (∼1 × 105 genome copies), and three mice per group were sacrificed on days 5 and 7 postinfection to determine the bacterial burden and the levels of cytokines and liver enzymes in the serum, as well as organ pathology. Mice were monitored daily for signs of illness, including the presence of distress, loss of appetite, roughened fur, and decreased activity. On days 0, 5, and 7 individually tagged mice were monitored for changes in temperature and weight as previously described (19).

Determination of the ehrlichial load in collected organs by quantitative real-time PCR.

To determine the relative differences in the ehrlichial burden between the different groups of mice, approximately 10 mg each of liver, lung, spleen, and kidney were collected at different time points postinfection and homogenized. DNA was extracted using a DNeasy tissue kit (Qiagen, Valencia, CA) with an elution volume of deionized water of 100 μl, and ehrlichial burdens were determined using an iCycler IQ multicolor real-time detection system (Bio-Rad, Hercules, CA). The following primers (Sigma-Genosys, St. Louis, MO) and probes (Biosearch Technologies, Novato, CA) targeting both the IOE and E. muris dsb (which encodes a thio-disulfide oxidoreductase) and host glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were used: EM/IOE dsb forward primer (5′ CAGGATGGTAAAGTACGTGTGA 3′), EM/IOE dsb reverse primer (5′ TAGCTAAYGCTGCCTGGACA 3′), EM/IOE probe (5′ 6-carboxyfluorescein-AGGGATTTCCCTATACTCGGTGAGGC-BHQ1 3′), GAPDH forward primer (5′ CAACTACATGGTCTACATGTTC 3′), GAPDH reverse primer (5′ CTCGCTCCTGGAAGATG 3′), and GAPDH probe (5′ Cy5-CGGCACAGTCAAGGCCGAGAATGGGAAGC-BHQ2 3′). The comparative cycle threshold method (4) was used to determine the ehrlichial burdens in the harvested organs.

Determination of serum cytokine and ALT concentrations.

At different time points after infection, serum samples were collected from infected mice. IFN-γ, TNF-α, and IL-10 levels were determined by using a Quantikine enzyme-linked immunosorbent assay (R&D Systems, Minneapolis, MN) according to the manufacturer's recommendations. The serum concentrations of the liver enzyme alanine transaminase (ALT) (an enzyme that is released from injured hepatocytes) were determined by the Clinical Chemistry Laboratory, University of Texas Medical Branch.

Histology and ultrastructural analysis.

Formalin-fixed, paraffin-embedded samples from the liver, lung, and spleen were sectioned and stained with hematoxylin and eosin (H&E). Histological sections were evaluated qualitatively, and liver lesions were assessed by using four parameters, hepatocyte damage, frequency of lesions, size of inflammatory lesions, and extent of lobular and perivascular inflammation, as described previously (30).

Isolation of splenic and hepatic mononuclear cells.

Spleens and livers were harvested at different time points postinfection, and mononuclear cells were purified for flow cytometric analysis. Splenocyte single-cell suspensions were prepared in RPMI 1640 medium (500 ml) supplemented with 10% heat-inactivated fetal bovine serum, 1% HEPES buffer, and 1% penicillin G (50,000 U)-streptomycin sulfate (50,000 μg). Hepatic mononuclear cells were isolated using a modified enzymatic dispersal protocol as described previously (28), which allows the maximum yield and viability of hepatic mononuclear cells. Briefly, mouse livers were perfused with cold phosphate-buffered saline through the portal vein, and liver tissues were collected in Hanks' balanced salt solution (HBSS) without Ca2+ and Mg2+ and washed. Each liver was then perfused with warm HBSS (37°C) with Ca2+- and Mg2+-containing collagenase IV (500 mg/liter; 312 U/mg), DNase I (50 mg/liter), fetal calf serum (FCS) (2%), and bovine serum albumin (0.6%). Tissue was teased apart into ∼1- to 3-mm fragments while it was submersed in the warm HBSS and then incubated at 37°C with frequent shaking. After 15 min cold HBSS without Ca2+ and Mg2+ was added to stop the enzymatic digestion. The tissue was then passed through a 30-μm cell strainer to remove any large clumps or undissociated tissue. The filtered suspension was then centrifuged (500 × g) for 10 min at 4°C, and the cell pellet was washed twice in cold HBSS. Hepatocytes were removed by differential centrifugation (36 × g) for 1 min at 4°C, and the final pellet was resuspended in RPMI 1640 medium containing 10% FCS and 1% HEPES. Hepatic mononuclear cells were further purified for intracellular cytokine staining by overlaying cells obtained from each mouse liver carefully onto 5 ml of Lympholyte M (Cedarlane Laboratories, Burlington, NC), followed by centrifugation and collection of the upper two-thirds of the resulting density gradient. Trypan blue dye exclusion was used to determine cell viability.

Flow cytometry and intracellular cytokine staining.

Splenocytes and/or hepatic mononuclear cells were harvested, counted, resuspended in fluorescence-activated cell sorter staining buffer (Dulbecco's phosphate-buffered saline without Mg2+ or Ca2+ containing 1% heat-inactivated FCS and 0.09% sodium azide), and filtered (0.2-μm-pore-size membrane), the pH was adjusted to 7.4 to 7.6, and aliquots were placed into a 96-well V-bottom plate (Costar, Corning, NY) at a concentration of 106 cells per well. Fc receptors were blocked with a monoclonal antibody (clone 2.4G2) against mouse CD16 and CD32 cell surface antigens for 15 min. The cells were then washed and pelleted. Optimal concentrations were determined for the following monoclonal antibodies: allophyocyanin-Cy5-conjugated CD3 (clone 145-2C11) and CD11c (clone HL3); fluorescein isothiocyanate-conjugated CD4 (clone GK1.5), B220 (clone RAB-632), and Fas (clone FAS); phycoerythrin-conjugated CD8a (clone 53-6.7), CD40 (clone 3/23), and granzyme B (eBioscience, San Diego, CA) (clone 16G6); and peridin-chlorophyll protein-conjugated CD11b (clone M1/70), CD4 (clone RM4-5), and CD8 (clone 53-6.7). Corresponding isotype controls were used. All antibodies were obtained from BD Pharmingen (San Diego, CA) unless otherwise indicated. For ex vivo intracellular granzyme B detection, splenocytes or hepatic mononuclear cells were incubated at 37°C for 4 h in complete medium supplemented with BD Golgi plug (BD Pharmingen) according to the manufacturer's recommendations. Lymphocyte populations were gated based on forward and side scatter parameters, 20,000 to 50,000 events were collected using a BD FACSCalibur (BD Immunocytometry Systems, San Jose, CA) flow cytometer with CellQuest software (Immunocytometry Systems), and data were analyzed using FlowJo (Tree Star Inc., Ashland, OR) flow cytometric analysis software.

Statistical analysis.

Data were analyzed using SigmaPlot software (SPSS, Chicago, IL), and P values were determined using the Student two-tailed t test. P values less than 0.01 were considered highly significant, and P values less than 0.05 were considered significant. Mouse groups contained three mice unless otherwise indicated, and the standard deviation was determined for each group. The standard error of the mean was used for analysis of combined data from more than one experiment.

RESULTS

Susceptibility, in vivo bacterial burdens, TNF-α production, and pathological changes in the liver of WT BALB/c mice following lethal ehrlichial infection are similar to those of WT C57BL/6 mice.

To determine whether the outcome of ehrlichial infection is influenced by the genetic background of BALB/c mice, we compared the host defenses and immune responses to Ehrlichia of these mice to those of C57BL/6 WT mice. Both groups of WT mice succumbed to i.p. inoculation with a high dose of IOE by day 8 postinfection (Fig. 1A). No significant differences in organ bacterial burdens were observed on day 5 (data not shown) or day 7 postinfection (Fig. 1B). We next examined whether BALB/c mice developed toxic shock-like syndrome following lethal ehrlichial infection like C57BL/6 mice (19). To this end, we characterized some of the main features of Ehrlichia-induced toxic shock, including high serum levels of TNF-α and hepatic injury. Similar to infected C57BL/6 mice, WT BALB/c mice infected i.p. with a high dose (∼1 × 105 genome copies) of IOE had high concentrations of serum TNF-α (Fig. 1C) and serum ALT (Fig. 1D) on day 5 postinfection. Similar to analyses of IOE-infected C57BL/6 mice (19, 20, 36, 37), hepatic histopathology analysis of WT BALB/c mice showed apoptosis of both Kupffer cells and hepatocytes on day 5 postinfection and severe multifocal hepatic necrosis on day 7 postinfection (data not shown). These data suggest that lethal ehrlichial infection causes pathology and fatal disease in both WT strains of mice, indicating that IOE induction of toxic shock-like syndrome occurs independent of the genetic background of the mice.

Resistance to Ehrlichia-induced toxic shock in the absence of CD1d and CD1d-reactive NKT cells.

To identify a role for CD1d-restricted NKT cells in Ehrlichia-induced fatal toxic shock syndrome, we examined the effect of ehrlichial infection on the host defenses and the pathogenesis of ehrlichiosis in WT BALB/c and NKT cell-deficient CD1d−/− mice with a BALB/c background. Because CD1d is required for positive selection of NKT cell precursors in the thymus (in addition to stimulation of variant NKT and iNKT cells in the periphery), CD1d−/− mice lack the CD1d-restricted iNKT cell population (27). Briefly, WT and CD1d−/− mice were infected i.p. with a high dose of IOE (∼1 × 105 genomes copies), their survival was monitored, and the host immune response was evaluated on days 5 and 7 postinfection. BALB/c CD1d−/− mice succumbed to high-dose IOE infection on day 8 postinfection, 1 day after the death of WT BALB/c mice (Fig. 2A). However, unlike WT BALB/c mice, CD1d−/− mice did not develop signs of toxic shock-like syndrome. Compared to WT mice on day 5 postinfection, fatal ehrlichial infection did not result in weight loss or hypothermia (data not shown) in CD1d−/− mice. In addition, the IOE-infected CD1d−/− mice had significantly lower serum concentrations of the liver enzyme ALT on day 5 postinfection (Fig. 2B).

FIG. 2.

FIG. 2.

Survival, serum levels of liver enzyme and cytokines, and organ bacterial burdens in IOE-infected CD1d−/− mice and BALB/c WT controls. (A) Survival rates of BALB/c CD1d+/+ and CD1d−/− mice following i.p. inoculation of a high dose of IOE (1 × 105 genome copies). There was no significant difference in survival between the two groups of mice (nine mice per group). The data represent the results of one of three independent experiments with a total of nine mice per group. (B to E) Serum levels of ALT, TNF-α, IFN-γ, and IL-10 on day 5 following i.p. infection of knockout and WT BALB/c mice with a high dose of IOE. CD1d−/− mice had significantly lower (P < 0.01) serum levels of ALT (B) and TNF-α (C) than infected WT mice. The serum levels of IFN-γ (D) and IL-10 (E) were not significantly different for the two groups. (F and G) Ehrlichial burdens in different organs of CD1d−/− and WT mice on days 5 (F) and 7 (G) postinfection. CD1d−/− mice had significantly (P < 0.01) greater bacterial burdens in all analyzed organs on day 5 postinfection and in only the liver on day 7 postinfection. The bars indicate the means and the error bars indicate the standard deviations for three mice per group. Similar results were obtained in three independent experiments. P values less than 0.01 were considered highly significant (filled diamond), and P values less than 0.05 were considered significant (asterisk). KO, knockout.

We next examined the effects of the CD1d molecule and NKT cells on the systemic levels of cytokines known to be associated with Ehrlichia-induced toxic shock. Similar to the results of our previous studies (37) using WT C57BL/6 mice, fatal disease in IOE-infected BALB/c mice was associated with significant high serum levels of TNF-α, IFN-γ, and IL-10 (Fig. 2 C to E). In contrast, CD1d−/− mice had lower concentrations of TNF-α (Fig. 2C) but not of IFN-γ (Fig. 2D) or IL-10 (Fig. 2E) on day 5 postinfection.

Our previous studies demonstrated that IOE-induced tissue damage and toxic shock occur in WT C57BL/6 mice in the absence of overwhelming infection. Therefore, we first compared the differences in bacterial burden between the WT BALB/c and knockout mice using real-time PCR. The CD1d−/− mice had significantly higher ehrlichial burdens in the liver, lung, spleen, and kidney on day 5 postinfection and in the liver on day 7 postinfection (Fig. 2F and 2G). The difference in bacterial burden was most striking in the liver on day 5 postinfection, in which the CD1d−/− mice had a fourfold-greater ehrlichial burden than the WT mice. Examination of liver histopathology in infected CD1d−/− mice on day 5 postinfection revealed less inflammation and very few apoptotic cells (Fig. 3A and 3C) compared to WT BALB/c mice, in which acute inflammation and a significantly higher number of apoptotic liver cells, including both hepatocytes and cells lining the sinusoidal spaces and vascular lumens (i.e., Kupffer cells, monocytes, and/or endothelial cells) (Fig. 3B and 3C), were observed. No evidence of necrosis was detected in BALB/c WT or CD1d−/− mice on day 5 postinfection. Electron microscopic analysis of livers from infected WT and CD1d−/− mice further confirmed the difference in apoptosis between the two groups and also demonstrated that most apoptotic cells were indeed Kupffer cells/macrophages (data not shown). Interestingly, on day 7 postinfection, WT and CD1d−/− mice both developed multifocal hepatocellular necrosis similar to that previously reported for WT C57BL/6 mice (37). Thus, although the absence of CD1d and iNKT cells did not prevent Ehrlichia-induced mortality, the CD1d molecule and/or CD1d-restricted NKT cells mediated the early systemic overproduction of proinflammatory TNF-α, apoptotic death of host cells, liver injury, and hypothermia that collectively comprise the major manifestations of Ehrlichia-induced toxic shock syndrome.

FIG. 3.

FIG. 3.

Differences in hepatic histopathology between WT BALB/c and CD1d−/− mice. CD1d−/− mice (A) had fewer apoptotic cells (arrows) in the liver than CD1d+/+ WT BALB/c mice (B) on day 5 postinfection. H&E-stained liver sections showed similar results for three mice per group. (C) Numbers of apoptotic cells or nuclei and apoptotic bodies present in H&E-stained liver sections from each mouse in 10 medium-power fields (magnification, ×200). The bars indicate the means and the error bars indicate the standard deviations for three mice per group. Similar results were obtained in two independent experiments. P values less than 0.01 were considered highly significant (filled diamond). The cells undergoing apoptosis were similar to those reported previously (36) and included sinusoidal lining cells, as well as hepatocytes. KO, knockout.

Absence of CD1d and CD1d-reactive NKT cells restores the populations of splenic CD4+ and CD8+ T cells.

We demonstrated previously (18, 19, 37) that fatal Ehrlichia-induced toxic shock-like syndrome is associated with significant apoptosis of splenic CD4+ T cells and decreases in the percentages and absolute numbers of CD4+ and CD8+ T cells in the spleen. Substantial lymphopenia has also been reported in patients with severe disease. To determine the role of CD1d and CD1d-restricted NKT cells in T-cell apoptosis, we examined the differences in the percentages of CD4+ and CD8+ lymphocytes in the WT and CD1d−/− mice by flow cytometry. The IOE-infected CD1d−/− mice had higher percentages (Fig. 4A) and absolute numbers of splenic CD4+ and CD8+ T cells than the WT mice on day 7 postinfection (the splenocyte mononuclear cell yields determined by trypan blue exclusion were similar in the two groups of mice [data not shown]). These data suggest that CD1d-restricted NKT cells mediate the significant reduction in the total number of CD4+ and CD8+ T cells.

FIG. 4.

FIG. 4.

Absence of NKT cells in IOE-infected CD1d−/− mice restored the percentages of both CD4+ and CD8+ T cells in the spleen and decreased Fas expression on CD4+ T cells and granzyme B expression in CD8+ T cells. BALB/c WT and CD1d−/− mice were inoculated with a high dose of IOE. The percentages and absolute numbers of CD4+ and CD8+ T cells, as well as the expression of Fas and granzyme on splenic CD4+ and hepatic CD8+ T cells, were determined by flow cytometry on day 7 postinfection. Lymphocytes were gated based on size and granularity, and 50,000 events were studied. (A) CD1d−/− mice had significantly higher percentages and absolute numbers of CD4+ and CD8+ T cells (splenocyte yields were not significantly different as determined by trypan blue exclusion) than CD1d+/+ BALB/c mice on day 7 postinfection. The bars indicate the means and the error bars indicate the standard deviations for three mice per group. Similar results were obtained in two independent experiments. (B and C) CD1d−/− mice had lower expression of Fas on splenic CD3+ CD4+ T cells and of granzyme B in hepatic CD3+ CD8+ T cells on day 7 postinfection. The dot plots shown are similar to those obtained for all three mice per group, and the data are representative of two independent experiments. The percentages below the plots are the percentages of Fas+ CD4+ T cells (upper values) and granzyme-positive CD8+ T cells (lower values) shown in the right upper quadrants of each dot plot. (D and E) Percentages of splenic CD3+ CD4+ T cells and hepatic CD3+ CD8+ T cells expressing Fas and granzyme B, respectively, shown graphically for statistical comparison. The bars indicate the means and the error bars indicate the standard deviations for three mice per group. P values less than 0.01 were considered highly significant (filled diamond), and P values less than 0.05 were considered significant (asterisk). KO, knockout.

Fas/FasL interaction plays a role in CD1-restricted-NKT-mediated apoptosis of CD4+ T cells.

In several infectious and noninfectious disease models, it has been demonstrated that the induction of apoptosis in CD4+ T cells, as well as cytotoxic functions acquired by NKT cells, involves the Fas/FasL pathway (2, 39). We hypothesized that NKT cells mediate apoptosis of Ehrlichia-specific CD4+ effector cells via this mechanism. Consistent with this hypothesis, we observed that lethal ehrlichial infection resulted in up-regulation of Fas expression on splenic CD4+ T cells from WT and CD1d−/− mice (Fig. 4B and 4D) on day 7 postinfection. However, the absence of CD1d-restricted NKT cells in infected CD1d−/− mice significantly down-regulated the expression of Fas on splenic CD4+ T cells compared to the cells of infected WT mice (Fig. 4B and 4D).

CD1d-restricted NKT cell-mediated activation of cytotoxic CD8+ T cells involves granzyme B.

As mentioned above, our previous studies demonstrated that there is a strong correlation between fatal disease and the expansion of TNF-α-producing CD8+ T cells. In addition, we recently reported that β2m−/− mice that lack both CD8+ T cells and CD1d-restricted NKT cells are more resistant to lethal ehrlichial infection than WT mice (18). To determine the contribution of CD1d-restricted NKT cells to the induction of pathogenic cytotoxic CD8+ T cells, we examined differences in intracellular expression of granzyme B (an important molecule involved in cytotoxic effector functions of CD8+ T cells) (32) in hepatic CD8+ T cells from CD1d−/− and WT IOE-inoculated mice. We chose the liver since it is the predominant organ that has marked ehrlichial tropism as well as extensive Ehrlichia-induced pathology. Ehrlichial infection of the CD1d−/− mice resulted in expression of intracellular granzyme B in CD3+/CD8+ T cells that was significantly lower than that observed in the WT mice (Fig. 4C and 4E). Taken together, our data suggest that CD1d-restricted NKT cells could potentially mediate apoptosis of CD4+ T cells via the Fas/FasL pathway and induction of cytotoxic CD8+ T cells in Ehrlichia-induced toxic shock.

IOE infection suppresses the expression of the costimulatory molecule CD40 on DCs, while NKT cells up-regulate CD40 expression on APCs.

Based on the data described above, we hypothesized that NKT cells mediate induction of pathogenic CD8+ T cells and play a direct role in tissue injury and apoptosis of host cells during Ehrlichia-induced toxic shock via cognate interactions with APCs, including macrophages, DCs, and B cells. To test this hypothesis, we first quantified differences in CD11b+ cell frequency in harvested splenocytes by flow cytometry. Our data showed that CD1d−/− mice had significantly higher percentages and absolute numbers of CD11b+ cells in the spleen on day 5 postinfection (Fig. 5A). These observations correlate with the decreased number of apoptotic hepatic phagocytic cells and hepatocytes in the IOE-infected CD1d−/− mice compared to WT mice (Fig. 3A and B).

FIG. 5.

FIG. 5.

Absence of NKT cells resulted in significantly greater numbers of splenic CD11b+ cells but significantly decreased the expression of the costimulatory molecule CD40 on splenic CD11b+, CD11c+, and B220+ cells on day 5 postinfection. BALB/c mice were inoculated with IOE (1 × 105 IOE genome copies) and were sacrificed on day 5 postinfection. Splenocytes were isolated and stained with fluorescently labeled murine monoclonal antibodies, which was followed by flow cytometric analysis, and 20,000 events were collected. (A) CD1d−/− mice had significantly higher percentages of CD11b+ cells than WT mice. (B) CD11b+, CD11c+, and B220+ populations of cells were gated within their representative dot plots, and the mean fluorescence intensity of CD40 expression was determined using FlowJo. The results show that there was significant suppression of CD40 expression on CD11c+ cells in WT mice during IOE infection compared to uninfected WT mice. In addition, decreased expression of CD40 on CD11c+, CD11b+, and B220+ cells was detected in infected CD1d−/− mice compared to infected WT mice on day 5 after IOE infection. The data are representative data for two independent experiments. P values less that 0.01 were considered highly significant (filled diamond). KO, knockout.

We next determined the effect of IOE-activated NKT cells on the activation and/or maturation of APCs by measuring differences in the up-regulation of the costimulatory molecule CD40. CD40 was chosen since it is the main costimulatory molecule that provides strong DC maturation signals through binding of CD40L on the surface of activated conventional T cells or NKT cells (11). In addition, increasing CD40 expression on APCs is a mechanism by which a robust CTL response can be initiated in the absence of CD4 help (10), which is important during severe ehrlichiosis, in which a significant decrease in the number of CD4+ Th1 cells has been observed (19). Compared to uninfected controls, IOE infection of WT BALB/c mice resulted in down-regulation of CD40 expression on CD11c+ DCs but not on CD11b+ CD11c− macrophages or B220+ cells (Fig. 5B). Further down-regulation of CD40 expression on CD11c+ DCs was observed in the absence of CD1d-restricted NKT cells in infected CD1d−/− mice. Similarly, CD40 expression was significantly lower on CD11b+ CD11c− macrophages and B220+ cells in the CD1d−/− mice than in the WT mice. The difference was most significant (P < 0.001) for B220+ cells (Fig. 5B). These data suggest that unlike the maturation of other APCs, DC maturation is suppressed directly by IOE and that CD1d-restricted NKT cells promote up-regulation of costimulatory molecules during ehrlichial infection.

DISCUSSION

Previous studies in our laboratory have shown that mice lacking functional CD8+ T and NKT cells (β2m−/−) are more resistant to Ehrlichia-induced toxic shock than mice deficient in only CD8+ T cells (TAP−/−), suggesting not only that pathogenic CD8+ T cells mediate Ehrlichia-induced toxic shock-like syndrome but also that NKT cells are involved in ehrlichial pathogenesis (18). Using a mildly virulent E. muris strain, we have also shown that NKT cells are directly activated by E. muris in a CD1d-dependent manner and that NKT cells play a critical role in protection against in vivo infection by E. muris (26). Because of these observations and the fact that NKT cells are abundant in the liver, the main organ with marked ehrlichial tropism, we examined the role of CD1d and CD1d-restricted NKT cells in fatal ehrlichial infection caused by the highly virulent organism IOE. In this study, we showed that CD1d-restricted NKT cells mediate toxic shock-like syndrome. Similar to IOE-infected C57BL/6 mice, WT BALB/c mice infected with a high dose of IOE develop toxic shock-like syndrome that closely mimics severe HME in immunocompetent patients and is characterized by lymphopenia, hepatic apoptosis, lymphohistiocytic infiltrates in the liver, and elevation of the levels of hepatic enzymes (34, 36). These observations were similar to those previously reported by Bitsaktsis et al., who compared IOE infection of WT BALB/c mice and IOE infection of C57BL/6 mice (7). These data allowed us to further examine the role of NKT cells using CD1d−/− mice with the BALB/c background.

Although both the WT and knockout mice succumbed to disease and all mice became terminally ill by days 7 and 8 postinfection (Fig. 2A), respectively, the pathogenesis of fatal disease in NKT cell-competent mice and the pathogenesis in NKT cell-deficient mice appear to be mediated by different mechanisms. Increases in the levels of the serum cytokines TNF-α, IL-10, and IFN-γ have been observed during Ehrlichia-induced toxic shock (37). Significantly lower levels of serum TNF-α (Fig. 2B) were observed in the knockout mice than in the WT mice, indicating that NKT cells are directly or indirectly responsible for the production of this proinflammatory cytokine during Ehrlichia-induced toxic shock-like syndrome. The observation that abrogation of systemic TNF-α production does not protect IOE-infected CD1d−/− mice from lethal disease is consistent with our previous data showing that TNF neutralization fails to protect IOE-infected WT mice from lethal infection and results in less apoptosis in the liver. On the other hand, TNF receptor-deficient mice are partially protected (20), suggesting that TNF is not solely responsible for Ehrlichia-induced fatal disease and that other mechanisms mediate this fatal disease. An interesting finding is that despite the normal levels of serum TNF-α, the absence of NKT cells did not influence the high serum levels of IFN-γ or IL-10 (Fig. 2C and 2D), which were also observed in infected WT mice. The presence of high levels of IL-10 in CD1d−/− mice is also consistent with our previous data suggesting that IL-10 is linked to fatal disease. However, the source of IL-10 appears to be independent of NKT cell activation.

As mentioned above, the liver is one of the main sites of pathology during severe ehrlichiosis, and relatively high concentrations of NKT cells are found in this organ. We focused our investigations on several different characteristics of liver involvement, including the serum levels of ALT, the hepatic bacterial burdens, and liver histopathology. The differences in these parameters between the WT and CD1d−/− mice showed that CD1d-restricted NKT cells mediate early liver damage following lethal ehrlichial infection. The infected CD1d−/− mice had significantly lower levels of serum ALT (Fig. 2B), higher bacterial burdens in the liver on days 5 and 7 postinfection (Fig. 2F and 2G), much less apoptosis of both hepatocytes and Kupffer cells, and less inflammation in the liver on day 5 postinfection (Fig. 3). The bacterial burdens in the lung, spleen, and kidney were also significantly greater in the absence of NKT cells on day 5 postinfection but not on day 7 postinfection, suggesting that NKT cells assist in controlling the bacterial burden in these organs only at early stages of ehrlichial infection (Fig. 2F). One possible explanation accounting for the differential effects of NKT cells on the bacterial burdens in different organs could be the abundance of NKT cells in the liver and the ability of these cells to eliminate infected target cells via engagement of death receptors. In support of this conclusion, we also observed that mice lacking NKT cells had significantly higher percentages (Fig. 4A) and absolute numbers (data not shown) of CD11b+ phagocytic cells than the WT controls. Numerous hepatocytes were apoptotic in the WT mice, and as previously reported by Sotomayor et al. (36), most of these dead hepatocytes did not contain ehrlichial antigen as determined by immunohistochemical staining. Several studies have suggested that apoptosis leads to secondary necrosis and activation of CD8+ T cells via cross-priming pathways (31). Thus, cross-presentation of apoptotic cells that contain ehrlichial antigens by DCs may assist in the activation of pathogenic cytotoxic CD8+ T cells.

Next, we examined the role of CD1d-restricted NKT cells and CD1d molecules in impeding induction of the specific acquired immune response against Ehrlichia for two reasons. First, lymphopenia occurs during severe HME (15, 33) and in animal models of fatal ehrlichiosis (7). Second, recently, CD4+ T-cell apoptosis was reported to occur during severe ehrlichiosis (18) and occurs in other septic conditions secondary to activation-induced cell death, which has also been linked with IL-10-mediated up-regulation of Fas (1). The absence of NKT cells resulted in significantly decreased expression of Fas death receptors on splenic CD3+ CD4+ T cells (Fig. 4B and 4D). In addition, the absence of NKT cells resulted in decreased activation of cytotoxic CD8+ T cells, as shown by decreased intracellular granzyme B expression in hepatic CD3+ CD8+ T cells (Fig. 4C and 4E) from IOE-infected CD1d−/− mice compared to IOE-infected WT controls on day 7 postinfection. These observations correlated with the observed differences in the percentages and absolute numbers of CD4+ and CD8+ T cells in the spleen (Fig. 4A). We hypothesize that splenic CD4+ T cells die prematurely during ehrlichial infection due to Fas-mediated activation-induced cell death and that NKT cells mediate the induction of pathogenic cytotoxic CD8+ T cells, followed by their migration to the main sites of infection, such as the liver. A recent study in our laboratory supported this concept as only splenic CD4+ T cells, and not splenic CD8+ T cells, concurrently express the early apoptotic marker annexin V (18). IL-10 may also be involved in the early induction of apoptosis of CD4+ T cells, as this is a known mechanism by which immune homeostasis is reestablished postinfection (3) and systemically IL-10 is present at high concentrations late during severe ehrlichiosis. In addition, IFN-γ has been shown to promote FasL- and perforin-mediated hepatocellular destruction by CTLs (32). Although our previous study showed that mice lacking perforin did not survive ehrlichial infection, granzyme B may still be important in IOE-induced toxic shock-like syndrome for at least two reasons. First, severe ehrlichiosis, like other septic conditions, appears to be a multifactorial process in which elimination of one factor or cell type is not sufficient to protect mice from fatal disease. Second, recent reports have identified a perforin-independent pathway for target cell killing by granzyme B (1, 13).

NKT cells can bias the immune response toward a Th1 or Th2 phenotype by producing high concentrations of particular cytokines early during the immune response; additionally, they also express CD40L on the cell surface, which has been reported to increase the expression of the costimulatory molecule, CD40, on APCs. Up-regulation of CD40 has been described as “empowering” APCs to be more efficient in presenting antigen and in producing cytokines and thus be more robust activators of the adaptive immune response, including CTLs (10, 25). Therefore, we examined whether NKT cells mediate toxic shock and liver injury via their cognate interaction with APCs. CD1d−/− mice that lack iNKT cells had significantly lower expression of CD40 on APCs, including DCs, phagocytic cells, and B cells, suggesting that NKT cells up-regulated CD40 expression on these cells. Interestingly, IOE infection decreased CD40 expression on CD11c+ cells, as indicated by the reduction in the level of this costimulatory molecule in both WT and CD1d−/− Ehrlichia-infected mice compared to uninfected control mice. Increasing the level of CD40 on APCs can mediate either protective or pathogenic immune responses depending on the cytokine environment and type of APCs. For example, an increased level of CD40 results in increased production of reactive oxygen species and TNF-α by macrophages (16, 22), and CD40-CD154 (CD40L) ligation is required for IL-12 production and induction of Th1 immunity by CD8α+ DCs in vivo (43). Alternatively, agonists of either CD40 on DCs (14) or CD40L on CD8+ T cells (10) can initiate a CTL response independent of CD4+ T-cell help. This situation is particularly important during severe ehrlichiosis, in which a decrease in the number of protective IFN-γ-producing CD4+ T cells and an increase in the number of pathogenic TNF-α-producing CD8+ T cells have been observed (19). The observed differences in the expression of CD40 on APCs may have resulted in differences in CD4+ and/or CD8+ T-cell activation between the WT and CD1d−/− mice. Additionally, CD40-CD154 ligation also contributes to lethality in cecal ligation- and puncture-induced sepsis (12).

In a recent review Tupin et al. (42) thoroughly analyzed the different roles of invariant NKT cells in response to a variety of infectious agents, including bacteria, viruses, and parasites. These authors reported the roles of Vα14 iNKT cells in bacterial infections, and in many infections, such as infections with Streptococcus pneumoniae (21), Pseudomonas aeruginosa (29), and Borrelia burgdorferi (23), these cells played protective roles by prolonging survival or decreasing the bacterial burden. In contrast, in infections with other disease-causing bacteria, such as Chlamydia trachomatis, NKT cells induced a pathogenic response (6). To our knowledge, fatal ehrlichiosis is the first bacterium-mediated disease for which both beneficial and detrimental roles have been observed for NKT cells. These cells are protective because they help control the initial bacterial burden; however, they also play a role in inducing toxic shock-like syndrome by playing a role in increasing the serum TNF-α concentrations and liver injury, promoting Fas-induced apoptosis of protective CD4+ T cells, and inducing pathogenic granzyme B-producing CD8+ T cells. The dual roles played by NKT cells during fatal ehrlichiosis need to be considered when vaccines or other immunotherapeutics targeting these and other cells capable of affecting multiple downstream events are designed.

Acknowledgments

We thank Sherrill Hebert and Doris Baker for their excellent secretarial assistance, Colette Keng and Jennifer Buezo for their technical assistance, and Linda Muehlberger for expert histological preparations.

This work was funded by grant AI31431 to D.H.W. and Emerging and Tropical Infectious Diseases training grant T32 AI7526 to H.L.S. from the National Institute of Allergy and Infectious Diseases.

Editor: R. P. Morrison

Footnotes

▿

Published ahead of print on 22 January 2008.

REFERENCES

  • 1.Ayala, A., C. S. Chung, G. Y. Song, and I. H. Chaudry. 2001. IL-10 mediation of activation-induced TH1 cell apoptosis and lymphoid dysfunction in polymicrobial sepsis. Cytokine 1437-48. [DOI] [PubMed] [Google Scholar]
  • 2.Ayala, A., C. S. Chung, Y. X. Xu, T. A. Evans, K. M. Redmond, and I. H. Chaudry. 1999. Increased inducible apoptosis in CD4+ T lymphocytes during polymicrobial sepsis is mediated by Fas ligand and not endotoxin. Immunology 9745-55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Barreiro, R., G. Luker, J. Herndon, and T. A. Ferguson. 2004. Termination of antigen-specific immunity by CD95 ligand (Fas ligand) and IL-10. J. Immunol. 1731519-1525. [DOI] [PubMed] [Google Scholar]
  • 4.Belperio, J. A., M. P. Keane, M. D. Burdick, J. P. Lynch III, Y. Y. Xue, K. Li, D. J. Ross, and R. M. Strieter. 2002. Critical role for CXCR3 chemokine biology in the pathogenesis of bronchiolitis obliterans syndrome. J. Immunol. 1691037-1049. [DOI] [PubMed] [Google Scholar]
  • 5.Bendelac, A., P. B. Savage, and L. Teyton. 2007. The biology of NKT cells. Annu. Rev. Immunol. 25297-336. [DOI] [PubMed] [Google Scholar]
  • 6.Bilenki, L., S. Wang, J. Yang, Y. Fan, A. G. Joyee, and X. Yang. 2005. NK T cell activation promotes Chlamydia trachomatis infection in vivo. J. Immunol. 1753197-3206. [DOI] [PubMed] [Google Scholar]
  • 7.Bitsaktsis, C., J. Huntington, and G. M. Winslow. 2004. Production of IFN-γ by CD4 T cells is essential for resolving ehrlichia infection. J. Immunol. 1726894-6901. [DOI] [PubMed] [Google Scholar]
  • 8.Brigl, M., and M. B. Brenner. 2004. CD1: antigen presentation and T cell function. Annu. Rev. Immunol. 22817-890. [DOI] [PubMed] [Google Scholar]
  • 9.Dumler, J. S. 2005. Anaplasma and Ehrlichia infection. Ann. N. Y. Acad. Sci. 1063361-373. [DOI] [PubMed] [Google Scholar]
  • 10.French, R. R., H. T. Chan, A. L. Tutt, and M. J. Glennie. 1999. CD40 antibody evokes a cytotoxic T-cell response that eradicates lymphoma and bypasses T-cell help. Nat. Med. 5548-553. [DOI] [PubMed] [Google Scholar]
  • 11.Fujii, S., K. Liu, C. Smith, A. J. Bonito, and R. M. Steinman. 2004. The linkage of innate to adaptive immunity via maturing dendritic cells in vivo requires CD40 ligation in addition to antigen presentation and CD80/86 costimulation. J. Exp. Med. 1991607-1618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gold, J. A., M. Parsey, Y. Hoshino, S. Hoshino, A. Nolan, H. Yee, D. B. Tse, and M. D. Weiden. 2003. CD40 contributes to lethality in acute sepsis: in vivo role for CD40 in innate immunity. Infect. Immun. 713521-3528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gondek, D. C., L. F. Lu, S. A. Quezada, S. Sakaguchi, and R. J. Noelle. 2005. Cutting edge: contact-mediated suppression by CD4+ CD25+ regulatory cells involves a granzyme B-dependent, perforin-independent mechanism. J. Immunol. 1741783-1786. [DOI] [PubMed] [Google Scholar]
  • 14.Grohmann, U., F. Fallarino, S. Silla, R. Bianchi, M. L. Belladonna, C. Vacca, A. Micheletti, M. C. Fioretti, and P. Puccetti. 2001. CD40 ligation ablates the tolerogenic potential of lymphoid dendritic cells. J. Immunol. 166277-283. [DOI] [PubMed] [Google Scholar]
  • 15.Harkess, J. R., S. A. Ewing, T. Brumit, and C. R. Mettry. 1991. Ehrlichiosis in children. Pediatrics 87199-203. [PubMed] [Google Scholar]
  • 16.Howard, L. M., and S. D. Miller. 2004. Immunotherapy targeting the CD40/CD154 costimulatory pathway for treatment of autoimmune disease. Autoimmunity 37411-418. [DOI] [PubMed] [Google Scholar]
  • 17.Inayoshi, M., H. Naitou, F. Kawamori, T. Masuzawa, and N. Ohashi. 2004. Characterization of Ehrlichia species from Ixodes ovatus ticks at the foot of Mt. Fuji, Japan. Microbiol. Immunol. 48737-745. [DOI] [PubMed] [Google Scholar]
  • 18.Ismail, N., E. C. Crossley, H. L. Stevenson, and D. H. Walker. 2007. The relative importance of T cell subsets in monocytotropic ehrlichiosis: a novel effector mechanism involved in Ehrlichia-induced immunopathology in murine ehrlichiosis. Infect. Immun. 754608-4620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ismail, N., L. Soong, J. W. McBride, G. Valbuena, J. P. Olano, H.-M. Feng, and D. H. Walker. 2004. Overproduction of TNF-α by CD8+ type 1 cells and down-regulation of IFN-γ production by CD4+ Th1 cells contribute to toxic shock-like syndrome in an animal model of fatal monocytotropic ehrlichiosis. J. Immunol. 1721786-1800. [DOI] [PubMed] [Google Scholar]
  • 20.Ismail, N., H. L. Stevenson, and D. H. Walker. 2006. Role of tumor necrosis factor alpha (TNF-α) and interleukin-10 in the pathogenesis of severe murine monocytotropic ehrlichiosis: increased resistance of TNF receptor p55- and p75-deficient mice to fatal ehrlichial infection. Infect. Immun. 741846-1856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kawakami, K., N. Yamamoto, Y. Kinjo, K. Miyagi, C. Nakasone, K. Uezu, T. Kinjo, T. Nakayama, M. Taniguchi, and A. Saito. 2003. Critical role of Valpha14+ natural killer T cells in the innate phase of host protection against Streptococcus pneumoniae infection. Eur. J. Immunol. 333322-3330. [DOI] [PubMed] [Google Scholar]
  • 22.Kiener, P. A., P. Moran-Davis, B. M. Rankin, A. F. Wahl, A. Aruffo, and D. Hollenbaugh. 1995. Stimulation of CD40 with purified soluble gp39 induces proinflammatory responses in human monocytes. J. Immunol. 1554917-4925. [PubMed] [Google Scholar]
  • 23.Kumar, H., A. Belperron, S. W. Barthold, and L. K. Bockenstedt. 2000. Cutting edge: CD1d deficiency impairs murine host defense against the spirochete, Borrelia burgdorferi. J. Immunol. 1654797-4801. [DOI] [PubMed] [Google Scholar]
  • 24.Lin, M., and Y. Rikihisa. 2003. Ehrlichia chaffeensis and Anaplasma phagocytophilum lack genes for lipid A biosynthesis and incorporate cholesterol for their survival. Infect. Immun. 715324-5331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lunsford, K. E., M. A. Koester, A. M. Eiring, P. H. Horne, D. Gao, and G. L. Bumgardner. 2005. Targeting LFA-1 and CD154 suppresses the in vivo activation and development of cytolytic (CD4-independent) CD8+ T cells. J. Immunol. 1757855-7866. [DOI] [PubMed] [Google Scholar]
  • 26.Mattner, J., K. L. Debord, N. Ismail, R. D. Goff, C. Cantu III, D. Zhou, P. Saint-Mezard, V. Wang, Y. Gao, N. Yin, K. Hoebe, O. Schneewind, D. Walker, B. Beutler, L. Teyton, P. B. Savage, and A. Bendelac. 2005. Exogenous and endogenous glycolipid antigens activate NKT cells during microbial infections. Nature 434525-529. [DOI] [PubMed] [Google Scholar]
  • 27.Mendiratta, S. K., W. D. Martin, S. Hong, A. Boesteanu, S. Joyce, and K. L. Van. 1997. CD1d1 mutant mice are deficient in natural T cells that promptly produce IL-4. Immunity 6469-477. [DOI] [PubMed] [Google Scholar]
  • 28.Morsy, M. A., P. J. Norman, R. Mitry, M. Rela, N. D. Heaton, and R. W. Vaughan. 2005. Isolation, purification and flow cytometric analysis of human intrahepatic lymphocytes using an improved technique. Lab. Investig. 85285-296. [DOI] [PubMed] [Google Scholar]
  • 29.Nieuwenhuis, E. E., T. Matsumoto, M. Exley, R. A. Schleipman, J. Glickman, D. T. Bailey, N. Corazza, S. P. Colgan, A. B. Onderdonk, and R. S. Blumberg. 2002. CD1d-dependent macrophage-mediated clearance of Pseudomonas aeruginosa from lung. Nat. Med. 8588-593. [DOI] [PubMed] [Google Scholar]
  • 30.Olano, J. P., G. Wen, H.-M. Feng, J. W. McBride, and D. H. Walker. 2004. Histologic, serologic, and molecular analysis of persistent ehrlichiosis in a murine model. Am. J. Pathol. 165997-1006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Rock, K. L., and L. Shen. 2005. Cross-presentation: underlying mechanisms and role in immune surveillance. Immunol. Rev. 207166-183. [DOI] [PubMed] [Google Scholar]
  • 32.Roth, E., and H. Pircher. 2004. IFN-gamma promotes Fas ligand- and perforin-mediated liver cell destruction by cytotoxic CD8 T cells. J. Immunol. 1721588-1594. [DOI] [PubMed] [Google Scholar]
  • 33.Schutze, G. E., S. C. Buckingham, G. S. Marshall, C. R. Woods, M. A. Jackson, L. E. Patterson, and R. F. Jacobs. 2007. Human monocytic ehrlichiosis in children. Pediatr. Infect. Dis. J. 26475-479. [DOI] [PubMed] [Google Scholar]
  • 34.Sehdev, A. E., and J. S. Dumler. 2003. Hepatic pathology in human monocytic ehrlichiosis. Ehrlichia chaffeensis infection. Am. J. Clin. Pathol. 119859-865. [DOI] [PubMed] [Google Scholar]
  • 35.Shibata, S., M. Kawahara, Y. Rikihisa, H. Fujita, Y. Watanabe, C. Suto, and T. Ito. 2000. New Ehrlichia species closely related to Ehrlichia chaffeensis isolated from Ixodes ovatus ticks in Japan. J. Clin. Microbiol. 381331-1338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Sotomayor, E., V. Popov, H.-M. Feng, D. H. Walker, and J. P. Olano. 2001. Animal model of fatal human monocytotropic ehrlichiosis. Am. J. Pathol. 158757-769. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Stevenson, H. L., J. M. Jordan, Z. Peerwani, H. Q. Wang, D. H. Walker, and N. Ismail. 2006. An intradermal environment promotes a protective type-1 response against lethal systemic monocytotropic ehrlichial infection. Infect. Immun. 744856-4864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Stober, D., I. Jomantaite, R. Schirmbeck, and J. Reimann. 2003. NKT cells provide help for dendritic cell-dependent priming of MHC class I-restricted CD8+ T cells in vivo. J. Immunol. 1702540-2548. [DOI] [PubMed] [Google Scholar]
  • 39.Takeda, K., Y. Hayakawa, K. L. Van, H. Matsuda, H. Yagita, and K. Okumura. 2000. Critical contribution of liver natural killer T cells to a murine model of hepatitis. Proc. Natl. Acad. Sci. USA 975498-5503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Taniguchi, M., K. Seino, and T. Nakayama. 2003. The NKT cell system: bridging innate and acquired immunity. Nat. Immunol. 41164-1165. [DOI] [PubMed] [Google Scholar]
  • 41.Trobonjaca, Z., F. Leithauser, P. Moller, R. Schirmbeck, and J. Reimann. 2001. Activating immunity in the liver. I. Liver dendritic cells (but not hepatocytes) are potent activators of IFN-gamma release by liver NKT cells. J. Immunol. 1671413-1422. [DOI] [PubMed] [Google Scholar]
  • 42.Tupin, E., Y. Kinjo, and M. Kronenberg. 2007. The unique role of natural killer T cells in the response to microorganisms. Nat. Rev. Microbiol. 5405-417. [DOI] [PubMed] [Google Scholar]
  • 43.Yasumi, T., K. Katamura, T. Yoshioka, T. A. Meguro, R. Nishikomori, T. Heike, M. Inobe, S. Kon, T. Uede, and T. Nakahata. 2004. Differential requirement for the CD40-CD154 costimulatory pathway during Th cell priming by CD8 alpha+ and CD8 alpha-murine dendritic cell subsets. J. Immunol. 1724826-4833. [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES