Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2008 Feb 27;82(9):4275–4283. doi: 10.1128/JVI.02249-07

IFP35 Is Involved in the Antiviral Function of Interferon by Association with the Viral Tas Transactivator of Bovine Foamy Virus▿

Juan Tan 1,†, Wentao Qiao 1,†, Jian Wang 1, Fengwen Xu 1, Yue Li 1, Jun Zhou 1, Qimin Chen 1, Yunqi Geng 1,*
PMCID: PMC2293045  PMID: 18305040

Abstract

Interferon-induced proteins (IFPs) exert multiple functions corresponding to diverse interferon signals. However, the intracellular functions of many IFPs are not fully characterized. Here, we report that IFP35, a member of the IFP family with a molecular mass of 35 kDa, can interact with the bovine Tas (BTas) regulatory protein of bovine foamy virus (BFV). The interaction involves NID2 (IFP35/Nmi homology domain) of IFP35 and the central domain of BTas. The overexpression of IFP35 disturbs the ability of BTas to activate viral-gene transcription and inhibits viral replication. The depletion of endogenous IFP35 by interfering RNA can promote the activation of BFV, suggesting an inhibitory function of IFP35 in viral-gene expression. In addition, IFP35 can interact with the homologous regulatory protein of prototype FV and arrest viral replication and repress viral transcription. Our study suggests that IFP35 may represent a novel pathway of interferon-mediated antiviral activity in host organisms that plays a role in the maintenance of FV latency.


Interferons provide an important defense against viral infection as part of the innate immune systems of vertebrates. They provide antiviral functions by stimulating susceptible cells to express interferon-regulated genes, subsets of which show antiviral activities. Three interferon-regulated antiviral pathways have been described previously, including the double-stranded-RNA-dependent protein kinase R (14, 27, 28), the 2′,5′-oligoadenylate synthetase/RNase L system (41), and the Mx protein (2, 18, 30) pathways. Other proteins with potential antiviral activities are ISG20 (11, 12), ISG15 (22, 29), promyelocytic leukemia protein (PML) (31), guanylate binding protein 1 (GBP-1) (1), P56 (17, 20), and RNA-specific adenosine deaminase 1 (ADAR1) (35, 38).

The gene that encodes IFP35 (interferon-induced 35-kDa protein), an interferon-induced protein, was first isolated through differential screening of a cDNA library from HeLa cells that were treated with gamma interferon (3). IFP35 can be induced by alpha/beta-interferon in various cells, including fibroblasts, monocytes/macrophages, and epithelial cells. It can translocate from the cytoplasm to the nucleus upon interferon stimulation (3). IFP35 contains a unique N-terminal leucine zipper motif, but it lacks the basic domain that is crucial for DNA binding. Its C terminus has two tandem Nmi/IFP35 homology domains (NIDs). IFP35 can homodimerize in vitro and can be stabilized by Nmi (N-Myc-interacting protein) through heterodimerization. It can also interact with CKIP-1 (casein kinase 2-interacting protein-1) (40) and B-ATF (basic leucine zipper transcription factor, ATF-like) (37). These protein-protein interactions suggest a potential role for IFP35 in apoptosis and other cytokine-signaling pathways.

Foamy viruses (FVs), also known as spumaretroviruses, are complex retroviruses which compose the only genus in the Spumaretrovirinae subfamily of the Retroviridae. These viruses can infect humans and monkeys as well as many other mammals (such as cattle, cats, and horses). Infection leads to lifelong latency in almost all organs, without detectable viral replication. FVs are unique among the retroviruses in certain aspects, such as their forming a separate pol mRNA, having an infectious DNA genome, and encoding two functional promoters, the long terminal repeat (LTR) and the internal promoter. The transactivator protein (Tas) of FV acts as the key regulator of viral replication and gene expression. Tas is a DNA binding protein that can transactivate both the LTR and the internal promoter by specifically binding to transactivation-responsive elements (19, 21).

Interferons are believed to play a protective role against the lytic replication of prototype FV (PFV) by inhibiting the synthesis of viral proteins and RNAs (33). Gamma interferon plays an important role in controlling FV replication to nonpathogenic levels in vitro (13). Regad et al. reported that PML could inhibit the replication of PFV by interfering with Tas (31). However, a later study by Meiering and Linial found that the endogenous PML did not play an important role in PFV latency in vitro (25). The replication of PFV was found to occur in the presence of substantial PML, either in fully permissive cells or during the reactivation of latent PFV. Therefore, there must be some other unknown factors that play more-important roles in inhibiting PFV.

In this study, we provide evidence that IFP35 plays a key role in the interferon-mediated anti-FV response. IFP35 was identified as a novel bovine Tas (BTas)-interacting protein via yeast two-hybrid screening. Overexpression of IFP35 not only can down-regulate the transactivation ability of BTas and Tas but also can efficiently inhibit the replication of bovine FV (BFV) and PFV. These results indicate that IFP35 may represent a novel pathway in the antiviral action of interferon.

MATERIALS AND METHODS

Plasmids.

pDCR-IFP35 was a gift from Elizabeth J. Taparowsky and was subcloned into the pcDNA3.1 (+) (Invitrogen), pCMV-Tag3B (Stratagene), or pCMV-Tag2B (Stratagene) vector. Truncated IFP35 mutants were created by PCR and cloned into pcDNA3.1 (+). PFV pCMV-Tas and pLTR-luc were kindly provided by Maxine L. Linial. BFV pCMV-BTas and pLTR-luc were constructed as described previously (24). The pCMV-BTas (1-133aa), pCMV-BTas (1-183aa), pCMV-BTas (1-217aa), pCMV-BTas (Δ133-183aa), pCMV-BTas (Δ167-183aa), pEGFP-BTas (90-183aa), pEGFP-BTas (1-167aa), and pEGFP-BTas (167-249aa) vectors were constructed by inserting an individual PCR fragment into a pcDNA3.1 (+) or pEGFP-N1 vector. pCMV-AD-BTas (1-133aa) and pCMV-AD-IFP35 were subcloned into a pCMV-AD (Stratagene) vector. The sequences of all of the new constructs were confirmed by sequencing.

Cells, reagent, and viruses.

293T, HeLa, fetal bovine lung (FBL), CV-1, and BFV indicator cell line (BICL) cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 50 IU/ml penicillin, and 50 μg/ml streptomycin at 37°C in humidified air with 5% CO2. Anti-Flag M2 monoclonal antibody (MAb), antitubulin MAb, and anti-Myc rabbit antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The antibodies to BTas and IFP35 were produced by the immunization of mice and purified according to a standard protocol. Protein A beads and anti-β-actin MAb were purchased from Sigma-Aldrich. BFV3026 was isolated from peripheral lymphoid cells by us in 1993.

Yeast two-hybrid screening.

A fragment of BTas containing residues 1 to 183 was cloned into pGBKT7 (Clontech) and used as the bait. The screening was performed by using the human B-cell cDNA library (a gift from Charles Wood). Clontech's Matchmaker GAL4 two-hybrid system 3 (PT3247-1) was used according to the manufacturer's instructions. Among 1 × 107 cDNA clones screened, 50 clones were identified as partners that interact with BTas containing amino acids (aa) 1 to 183 [BTas (1-183aa)]. One of the candidates encodes the N-terminally truncated IFP35 in which aa 1 to 91 are deleted [IFP35 (92-288aa)].

Immunoprecipitation.

Cultures of 293T cells in 100-mm-diameter dishes were transfected with various combinations of plasmids using the polyethyleneimine reagent (9). Forty-eight hours following transfection, cells were harvested and washed twice with phosphate-buffered saline (PBS). The cells were lysed in 1 ml lysis buffer (50 mM Tris-HCl, 150 mM NaCl, pH 8.0, 1% NP-40, 0.2% sodium dodecyl sulfate [SDS], and 1 mM phenylmethylsulfonyl fluoride), sonicated, and centrifuged at 4°C (10,000 × g, 15 min). The supernatant (500 μl) was incubated with the antibody indicated in Fig. 1 at 4°C for 2 h. The protein A-Sepharose (50%, 25 μl) equilibrated in lysis buffer was then added, and the mixture was incubated for an additional 2 h. Immunocomplexes were washed five times with the lysis buffer, boiled in 35 μl of 2× Laemmli buffer, electrophoresed on 12% SDS-polyacrylamide gels, and then subjected to Western blotting.

FIG. 1.

FIG. 1.

Identification of the BTas domain responsible for binding to IFP35. (A) Schematic representation of BTas and deletion mutants. (B, C, and D) Myc-IFP35 was transiently transfected into 293T cells together with the indicated BTas wild type or truncation mutants. BTas proteins were immunoprecipitated (IP) (anti-BTas) and immunoblotted with the antibodies indicated on the left side of each blot. α, anti. (E) HeLa cells were transfected with Myc-BTas. Forty-eight hours later, the cell lysates were incubated with control mouse immunoglobulin G (IgG) or mouse anti-IFP35 antibody. The immunoprecipitated proteins were immunoblotted with the indicated antibodies.

Luciferase assays.

The transfection of 293T and HeLa cells was carried out using polyethyleneimine (Sigma) (9) and the following DNA constructs: BFV pLTR-luc, pCMV-IFP35, pCMV-BTas, or pcDNA3.1 (+), with pCMV β-gal as the control for transfection efficiency. Cells were harvested 48 h after transfection, and then luciferase assays (Promega) were performed. The transfection efficiency was assessed by determining the β-galactosidase activity, which was used to normalize the luciferase activities. Total amounts of DNA were equalized by adding the vector DNA.

Subcellular localization.

HeLa and 293T cells were grown on coverslips and cotransfected 24 h later with 0.2 μg of pcDNA3.1 (+) or pCMV-BTas and 0.5 μg of pMyc-IFP35. Forty-eight hours later, cells were fixed in 4% paraformaldehyde and permeabilized with 0.2% Triton X-100. Indirect immunofluorescence was carried out by using the anti-BTas and anti-Myc antibodies and the Texas Red-conjugated goat anti-rabbit (Molecular Probes) and fluorescein isothiocyanate (FITC)-conjugated rabbit anti-mouse (Dako) secondary antibodies. Cellular nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI). Fluorescence microscopy was carried out by using an Olympus fluorescence microscope.

FV-activated GFP assay.

BHK21 cells were transfected with the green fluorescent protein (GFP) gene that was driven by the BFV LTR for establishing an indicator cell line named BICL. BICL cells were plated in six-well plates at a density of 2 × 105 cells per well. After 24 h, the BICL cells were incubated with 1/20 of the infected HeLa or 293T cells (1 × 104), which were infected by means of the coculture method. Cellular fluorescence was observed after 48 h, and the GFP-positive cells were counted. After we monitored the level of fluorescence, the BICL cells were trypsinized and counted with a hemocytometer. Total cells were counted under an inverted light microscope and the GFP-positive cells under an inverted fluorescence microscope. The percentage of GFP-positive cells was calculated based on these numbers.

IFP35 siRNA.

Three small interfering RNA (siRNA) oligonucleotides derived from the human IFP35 RNA sequence were designed to contain a sense strand of 21 nucleotides of the IFP35 gene. The three sequences were cloned into the pBS/U6 vector (a gift from Yang Shi) by following the manufacturer's instructions and confirmed by sequencing. One sequence from the three sequences was selected for stable transfection (oligonucleotide 1, GGAGATCCAGAAGGCTGAGAAAGCTTTCTCAGCCTTCTGGATCTCCCTTTTTG, and oligonucleotide 2, AATTCAAAAAGGGAGATCCAGAAGGCTGAGAAAGCTTTCTCAGCCTTCTGGATCTCC). pBS/U6-siCRLF3 was a gift from Li Liu and used as a negative control (39). The pBS/U6-siIFP35 plasmids were transfected into 293T or HeLa cells, and IFP35 expression was assayed by immunoblotting or fluorescence microscopy. Twenty-four hours after the siRNA transfection, BFV3026 was added to infect the cells, and FV replication was assessed 96 h later by enhanced-GFP (EGFP) expression through coculture with BICL cells.

EMSA.

293T cells were transfected with the empty vector, BTas alone, IFP35 alone, or BTas and IFP35. Two days later, the cells were lysed in 0.3 M NaCl for 30 min at 4°C, sonicated, and harvested by centrifugation at 14,000 × g. The supernatants were then aliquoted and kept at −70°C. The BFV LTR was synthesized with the oligonucleotide BFV LTR (795 to 816) sense (5′-ATAGCTATTTTAGTAAGTTAGC-3′). Position 1 is defined in this paper as the first nucleotide of the BFV proviral genome (GenBank accession no. AY 134750). Probes were purified, digitonin labeled, and used in electrophoretic mobility shift assays (EMSA) with a DIG gel shift kit (Roche).

RESULTS

Identification of IFP35 as a BTas-interacting protein.

BTas is composed of a DNA binding domain and the C-terminal transactivation domain (aa 184 to 249). To identify the potential proteins that interact with BTas, a yeast two-hybrid screening was performed with a human B-cell cDNA library and BTas (1-183aa) as the bait. Fifty positive clones were obtained from nutritional and colorimetric selections. Most of them were false positives, but one clone contained an in-frame 764-bp partial cDNA (GenBank accession no. NM 005533) which encodes amino acids 92 to 288 of the human IFP35 protein. IFP35 is an interferon-induced protein and may affect the function of BTas, so we chose IFP35 for further study.

To identify the specific binding region of BTas for IFP35, a series of Flag-BTas deletion mutants (Fig. 1A) were constructed and cotransfected with Myc-tagged IFP35. As shown in Fig. 1B, all of the C-terminally truncated mutants, including BTas (1-183aa) and BTas (1-217aa), retained the same ability to bind IFP35 as that of the wild-type protein. These results suggested that the IFP35 binding domain was not located in the activation domain (AD) (aa 184 to 249). The binding region was defined as BTas (133-183aa), since BTas (1-167aa) and BTas (Δ133-183aa) could not bind to IFP35 and BTas (Δ167-183aa) bound weakly, while BTas (167-249aa) and BTas (90-183aa) remained full binding ability (Fig. 1C and D). We also found that endogenous IFP35 coimmunoprecipitated with Myc-BTas in HeLa cells (Fig. 1E). To map the BTas binding domain in IFP35, a series of Flag-IFP35 deletion mutants (Fig. 2A) were constructed and cotransfected with Myc-BTas. We found that IFP35 without its N-terminal leucine zipper domain retained the ability to bind to BTas, while IFP35 without NID2 did not (Fig. 2B). Therefore, BTas-IFP35 complex formation is specific and depends on the presence of NID2.

FIG. 2.

FIG. 2.

Identification of the IFP35 domain responsible for binding to BTas. (A) Schematic representations of IFP35 and deletion mutants. WT, wild type; L-zip, leucine zipper. (B) Myc-BTas was transiently transfected into 293T cells together with the indicated IFP35 wild type or truncation mutants. IFP35 proteins were immunoprecipitated (IP) (anti-IFP35) and immunoblotted with the antibodies indicated on the left side of each blot. α, anti.

The overexpression of IFP35 confers resistance to BFV infection in some cell types.

BTas is an early regulatory protein and is required for the replication of BFV. It acts as a switch for BFV from latent to lytic replication (26). Because IFP35 is an interferon-induced protein and can interact with BTas, we hypothesized that IFP35 might play a role in the replication of BFV. To test the possible antiviral effect of IFP35 against BFV infection, 293T cells were transfected with the empty vector or with IFP35 and then infected with BFV. Three days postinfection, viral antigen expression was monitored by immunofluorescence using an anti-Gag antibody. We found that the transfection of 293T cells with Myc-IP35 greatly decreased the level of Gag expression relative to that of control cells (Fig. 3A). Similar results were obtained with BICL cells (data not shown).

FIG. 3.

FIG. 3.

Overexpression of IFP35 confers resistance to BFV infection. (A) 293T cells were transfected with the empty vector or IFP35 and then infected with BFV. After 96 h of indirect immunofluorescence, microscopy was performed using rabbit anti-Myc antibody (α-Myc) visualized with Texas Red and the mouse anti-Gag antibody followed by FITC labeling. (B) 293T cells were transfected with 0.5 μg pcDNA3.1 (+) (gray bars) or 0.5 μg pCMV-BTas (black bars). After the transfection (24 h later), cells were infected by BFV3026. After 96 h, 1/20 of the cells were cocultured with BICL (BFV indicator cell line) and observed after 48, 72, and 96 h. EGFP-positive cells were observed with an Olympus fluorescence microscope and counted. (C) HeLa cells were transfected with 0.5 μg pcDNA3.1 (+) (gray bars) or 0.5 μg pCMV-BTas (black bars). After the transfection (24 h later), cells were infected by BFV3026. After 96 h, 1/20 of the cells were cocultured with BICL and observed after 48, 72, and 96 h and EGFP-positive cells were observed and counted. (D) Total RNAs of 293T and HeLa cells were extracted, and an equal amount of RNA was amplified by reverse transcription-PCR (RT-PCR) by using primers specific for IFP35 and for GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as an internal control, respectively. (E) Equal numbers of 293T and HeLa cells were lysed and immunoblotted with anti-IFP35 antibody. The same blots were reprobed with anti-actin antibody. WB, Western blotting. (F) Equal numbers of 293T and HeLa cells were infected with BFV (the same titer). After 96 h, the cell lysates were immunoblotted with anti-Gag antibody. The same blots were reprobed with anti-actin antibody.

To study the effects of IP35 overexpression on viral replication, 293T and HeLa cells were transfected with IFP35 or the empty vector and then infected with BFV. After 96 h, 1/20 of the cells were cocultured with BICL cells, which were then observed after 48, 72, and 96 h. As shown in Fig. 3B, overexpression of IFP35 in 293T cells was found to be associated with lower EGFP expression in BICL indicator cells. In contrast, overexpression of IFP35 did not inhibit the replication of BFV in HeLa cells (Fig. 3C). Western blotting showed equal levels of IFP35 in the transfected cells (data not shown). In order to understand this discrepancy, we first tested the expression level of endogenous IFP35 in the two cell lines. Reverse transcription-PCR and Western blot assays showed that HeLa cells expressed a higher level of endogenous IFP35 than did 293T cells (Fig. 3D and E). Thus, it is possible that the level of endogenous IFP35 affects the replication of BFV. To test this, equal numbers of 293T and HeLa cells were infected with BFV, and total protein extracts 3 days after infection were analyzed by Western blotting using anti-Gag antibody. BFV infection did not induce syncytia in either HeLa or 293T cells. However, the viral titer in HeLa cells was significantly lower than that in 293T cells (Fig. 3F). These results suggest that endogenous IFP35 could play an important role in inhibiting the replication of BFV in HeLa cells.

Intracellular localization of BFV BTas and IFP35.

We next investigated the molecular mechanism involved in IFP35's inhibition of BFV replication. Using indirect immunofluorescence, BTas was found to accumulate predominantly in the nucleus, while IFP35 displayed a clear cytoplasmic distribution in HeLa cells (Fig. 4A) and 293T cells (Fig. 4C) cells when each was expressed alone. We next examined the localization of the two proteins when they were coexpressed. Interestingly, different results were seen for the two cell lines. In HeLa cells, there appeared to be high expression of BTas and IFP35 in both the nucleus and the cytoplasm (Fig. 4B). In contrast, IFP35 relocalizes to the nucleus along with BTas in 293T cells (Fig. 4D). These results suggest that the expression of BTas could induce a redistribution of IFP35 from the cytoplasm to the nucleus in 293T cells through a direct protein-protein interaction. This result may explain the discrepancy in results obtained with HeLa and 293T cells (Fig. 3B and C).

FIG. 4.

FIG. 4.

Intracellular localization of BFV BTas and IFP35. Indirect immunofluorescence was used to localize BTas (with mouse anti-BTas antibody and FITC-conjugated rabbit anti-mouse secondary antibody) and IFP35 (with rabbit anti-Myc antibody and Texas Red-conjugated goat anti-rabbit secondary antibody). Nuclei were visualized with DAPI stain. (A) Individual expression of BTas or Myc-IFP35 in HeLa cells. (B) Coexpression of BTas and Myc-IFP35 in HeLa cells. The merged images show the colocalization of BTas and IFP35 (yellow). (C) Individual expression of BTas or Myc-IFP35 in 293T cells. (D) Coexpression of BTas and Myc-IFP35 in 293T cells. The merged images show the colocalization of BTas and IFP35 (yellow). In about 80% of cells, coexpression of both proteins resulted in a distinct redistribution of IFP35 to the nucleus, with only weak expression of IFP35 in the cytoplasm.

IFP35 inhibits BTas-mediated BFV LTR transcriptional activation.

BTas is a transactivator that functions in the nucleus. In 293T cells expressing BTas and IFP35, some IFP35 translocated from the cytoplasm to the nucleus, suggesting that the interaction between IFP35 and BTas may affect the function of BTas as the transactivator. In order to assess the role of IFP35 in the BTas-mediated transactivation of the BFV LTR, a luciferase reporter gene under the transcriptional control of the BFV LTR (LTR-luc) was used in transactivation experiments. 293T cells were transfected with both the BFV LTR-luc gene and the BTas gene in the presence or absence of IFP35. Luciferase levels were measured 48 h later (Fig. 5A). Compared with control cells, IFP35 reduced the level of BTas-induced LTR transactivation and did so in a dose-dependent manner. With 500 ng of the IFP35 plasmid, the transactivation was inhibited by 64%. In control transfections without BTas, IFP35 had no effect on the very low level of basal promoter activity of LTR-luc. Western blotting showed equal levels of BTas in the transfected cells. Interestingly, the LTR transactivation in HeLa cells by BTas was not affected by IFP35, even with 500 ng of IFP35-expressing plasmid DNA (Fig. 5B), consistent with the data in Fig. 3B. These results could be explained by the difference in relocalization of IFP35 in the presence of BTas in the two cell lines (Fig. 4).

FIG. 5.

FIG. 5.

IFP35 inhibits BTas-mediated BFV LTR transcriptional activation. (A) 293T cells were transfected with 0.1 μg of the reporter plasmid pLTR-luc and 0.01 μg of pCMV β-gal, with or without 0.2 μg of pCMV-BTas and 0, 0.1, 0.2, 0.3, 0.4, or 0.5 μg of pCMV-IFP35. Luciferase activities were measured as described in Materials and Methods. The bottom rows of panels A and B show a Western blot from aliquots of the cells indicating the level of BTas expression. α, anti. (B) HeLa cells were transfected with 0.1 μg of the reporter plasmid pLTR-luc and 0.05 μg of pCMV β-gal, combined with 0.2 μg of pCMV-BTas and 0, 0.1, 0.2, or 0.5 μg of pCMV-IFP35. Luciferase activities were measured. (C) 293T cells were transfected with 0.1 μg of the reporter plasmid pLTR-luc and 0.01 μg of pCMV β-gal in combination with 0.2 μg of pCMV-BTas and 0.5 μg of pCMV-IFP35, pCMV-IFP35 (92-288aa), or pCMV-IFP35 (1-170aa). The expression of IFP35 in the transfected cells was monitored by Western blotting (at the bottom). All transfections were performed in triplicate.

To identify the IFP35 domain(s) inhibiting BTas-driven transcription in 293T cells, similar experiments were performed with two IFP35 mutants, IFP35 (92-288aa) and IFP35 (1-170aa). Neither mutant was able to inhibit LTR transactivation (Fig. 5C) suggesting that BTas is not inhibited by interacting with a simple domain of IFP35.

Knockdown of endogenous IFP35 by siRNA promotes BTas-induced BFV LTR activation.

We have shown above that the overexpression of IFP35 has no inhibitory effect on the BTas-induced BFV LTR activation or replication of BFV in HeLa cells, which contain more endogenous IFP35 than do 293T cells. Thus, endogenous IFP35 may play an important role in the replication of FV. To examine this more closely, RNA interference analysis with IFP35-specific oligonucleotides was performed. First, pBS/U6-siIFP35 (encoding IFP35 siRNA), pBS/U6-siCRLF3 (encoding a control siRNA), and pBS/U6 (the empty vector) were each cotransfected with EGFP-IFP35 into 293T cells. Both fluorescence microscopy (Fig. 6A) and Western blotting (Fig. 6B) showed that the expression of IFP35 was significantly reduced with pBS/U6-siIFP35 compared to that with the two controls. These results suggested that pBS/U6-siIFP35 could effectively inhibit the overexpressed IFP35. The efficiency of pBS/U6-siIFP35 in depleting endogenous IFP35 was also examined in HeLa cells. The expression of IFP35 was significantly knocked down in the siIFP35-transfected HeLa cells, while transfection with either pBS/U6 or pBS/U6-siCRLF3 had no effect (Fig. 6C). HeLa cells were transfected with BFV LTR-luc or a luc plasmid containing three copies of NF-κB binding site [pNF-κB (3×)-luc] and BTas in the presence or absence of pBS/U6-siIFP35 plasmids to determine whether BFV LTR or NF-κB activation would be enhanced by depleting endogenous IFP35. NF-κB was examined because the BFV LTR contains an NF-κB binding site and BTas can stimulate the NF-κB pathway in HeLa cells. Luciferase assays showed that the induction of the BFV LTR promoter in the siIFP35-transfected cells increased but that BTas-induced NF-κB activation was not affected (Fig. 6D). These results suggest that the inhibition of IFP35 is specific to the BFV LTR and independent of the NF-κB signal pathway. We next transfected HeLa cells with the pBS/U6-siIFP35, pBS/U6-siCRLF3, or pBS/U6 plasmid and then infected the cells with BFV. After 96 h, the transfected cells were cocultured with BICL indicator cells. The siIFP35-transfected cells showed about a twofold increase in viral titer (Fig. 6E), supporting the idea that endogenous IFP35 inhibits BFV replication in HeLa cells.

FIG. 6.

FIG. 6.

Knockdown of endogenous IFP35 by siRNA-promoted, BTas-induced BFV LTR activation. (A and B) 293T cells were cotransfected with pEGFP-IFP35 and pBS/U6, pBS/U6-siIFP35, or pBS/U6-siCRLF3. After 48 h, fluorescence microscopy was performed (A), and equal numbers of cell lysates were immunoblotted with the indicated antibodies (B). (C) HeLa cells were transfected with pBS/U6, pBS/U6-siIFP35, or pBS/U6-siCRLF3. After 48 h, equal numbers of cell lysates were immunoblotted with the indicated antibodies. (D) HeLa cells were transfected with pBS/U6, pBS/U6-siIFP35, or pBS/U6-siCRLF3. After 24 h, pLTR-luc or pNF-κB (3×)-luc and pCMV β-gal, along with pCMV-BTas or pcDNA3.1 (+), were introduced. Luciferase activities were measured after 96 h. (E) HeLa cells were transfected with pBS/U6, pBS/U6-siIFP35, or pBS/U6-siCRLF3 and then infected by BFV3026 (24 h later). After 96 h, 1/20 of the cells were cocultured with BICL cells, and EGFP-positive cells were observed and counted after 48 h. All experiments were performed in triplicate. α, anti.

IFP35 does not inhibit the binding of BTas to the BFV LTR.

Our EMSA results showed that BTas can directly bind to the BFV LTR. Protein-protein interactions can result in the inhibition of the activity of either partner by preventing nuclear localization, DNA binding, or both. In order to determine whether IFP35 could affect the binding of BTas to BFV LTR, DNA binding studies were carried out with BTas binding sequences using extracts from cells expressing either the empty vector, BTas alone, IFP35 alone, or BTas and IFP35. We found that that a complex was formed in the extracts from cells transfected with BTas (Fig. 7A, lane 2) but not with the empty vector (Fig. 7A, lane 1) or with IFP35 alone (Fig. 7A, lane 3). Coexpression of IFP35 and BTas did not alter the complex (Fig. 7A, lane 4), and the complex could be removed by competition with an excess of unlabeled LTR DNA (Fig. 7A, lane 5). As a positive control, we used purified BTas protein binding to the LTR (Fig. 7A, lane 6). This complex formation was found to be competed out with unlabeled LTR DNA (Fig. 7A, lane 7). Western blots using equal amounts of cell extract showed that all the cells expressed similar quantities of BTas and IFP35 (Fig. 7B).

FIG. 7.

FIG. 7.

IFP35 does not inhibit the binding of BTas to the BFV LTR. (A) EMSA were performed with extracts from 293T cells that had been transfected with either the empty vector, BTas, IFP35, or BTas and IFP35. Digitonin-labeled sequences derived from the BFV LTR were used as the probe. (B) Equivalent aliquots from EMSA samples were analyzed by Western blotting and visualized using anti-BTas and anti-IFP35 antibodies. (C) 293T cells were transfected with BTas (1-133aa), IFP35, the GAL4-binding domain controlled by the immediate early promoter of cytomegalovirus (CMV-BD), CMV-BD-BTas (1-133aa) or CMV-AD-IFP35, and pLTR-luc and pCMV β-gal. After 48 h of transfection, luciferase activities were measured. α, anti.

Although IFP35 did not inhibit the binding of BTas to the BFV LTR using the specific binding domain-containing oligonucleotide (aa 795 to 816), IFP35 could bind to another site on the full-length BFV LTR to interfere with BTas-induced transcription. To test this possibility, the GAL4 AD was fused to BTas (1-133aa) (the DNA binding domain of BTas) and to IFP35. GAL4 AD-IFP35 should be able to activate the transcription of the BFV LTR if IFP35 can bind directly to the BFV LTR. However, we found that neither the GAL4 AD (Fig. 7C, lane 1), BTas (1-133aa) (Fig. 7C, lane 2), IFP35 (Fig. 7C, lane 3), nor GAL4 AD-IFP35 (Fig. 7C, lane 5) could activate the transcription of the BFV LTR in transfected 293T cells. In contrast, GAL4 AD-BTas (1-133aa) could strongly activate the transcription of the BFV LTR (Fig. 7C, lane 4), because it binds to the BFV LTR. These results suggest that IFP35 cannot directly bind to the BFV LTR.

IFP35 inhibits Tas-induced PFV LTR activation.

To determine whether our findings on the inhibition of Tas activity by IFP35 could be extended to other FVs, we examined whether Tas from PFV can interact with IFP35. At 48 h after cotransfection of 293T cells with Myc-tagged IFP35 and PFV Flag-tagged Tas, cell extracts were immunoprecipitated using anti-Flag antibody. Precipitated proteins were resolved by SDS-polyacrylamide gel electrophoresis and analyzed by Western blotting using the anti-Myc and anti-Flag antibodies. Myc-IFP35 was observed to bind to Flag-Tas (Fig. 8A). Similar data were obtained when the samples were immunoprecipitated with the anti-IFP35 antibody and analyzed by the anti-Flag antibody (Fig. 8A). 293T cells were transfected with a luciferase reporter plasmid under the control of the PFV LTR and increasing amounts of IFP35, with or without Tas. Similarly to the results with BFV, IFP35 showed no effect on the basal promoter activity of LTR-luc, but it reduced PFV LTR transactivation by Tas in a dose-dependent manner (Fig. 8B), with a decrease of 84% using 500 ng of IFP35-encoding plasmid.

FIG. 8.

FIG. 8.

IFP35 inhibits Tas-induced PFV LTR activation. (A) Myc-IFP35 was transfected into 293T cells together with Flag-Tas or the empty vector. Proteins were immunoprecipitated and immunoblotted with the antibodies indicated above the blots and immunoblotted with the antibodies indicated on the left side of each blot. α, anti. (B) 293T cells were transfected with 0.1 μg reporter PFV pLTR-luc and 0.01 μg pCMV β-gal, with 0.2 μg pCMV-Tas and 0, 0.1, 0.2, or 0.5 μg pCMV-IFP35 as indicated. Luciferase activities were measured. All transfections were performed in triplicate.

DISCUSSION

In this paper, we have identified a physical interaction between the major BFV transactivator protein BTas and the cellular protein IFP35 by yeast two-hybrid screening. Coimmunoprecipitation experiments confirmed that an IFP35-BTas complex was formed in cells and that this interaction depends on the NID2 domain of IFP35 and the central domain of BTas. Prior to the current work, the only reported interferon-mediated FV inhibitor was PML (31). However, the study by Meiering et al. (25) showed that endogenous PML does not limit the replication of PFV, suggesting that there might be other factors important for the interferon-mediated inhibition of FV replication. Our results suggest that IFP35 exerts an antiviral function by interfering with the transcription of viral genes via interaction with viral regulatory proteins. This may represent a novel antiviral pathway in the interferon action.

Some proteins that dimerize via their leucine zipper motif but lack a basic region for binding DNA have been found to be negative regulators of transcription (4). It was suggested that IFP35 might be a negative transcriptional regulator, since it contains this kind of unique N-terminal leucine zipper motif (3). However, there is no experimental evidence that IFP35 perturbs gene transcription, even though IFP35 has been found to interact with two leucine zipper proteins, CKIP-1 and B-ATF (37, 40). In this report, we show using transactivation assays with 293T cells that IFP35 can reduce BTas-dependent activation of the BFV LTR in a dose-dependent manner. This inhibition requires both NID2, which is necessary for the formation of an IFP35-BTas complex, and the N-terminal leucine zipper motif. This result provides evidence for the idea that the N-terminal leucine zipper motif of IFP35 is a negative regulator of transcription. In addition, our EMSA results show that IFP35 neither directly binds to the BFV LTR nor inhibits the binding of BTas to the BFV LTR. Because the interaction domain in BTas that binds to IFP35 is near the activation domain of BTas, IFP35 may inhibit BTas-induced transactivation by interfering with the interaction of a cellular transcriptional activation factor(s) and BTas.

As an early response to viral infections, cells produce a spectrum of early inflammatory proteins that can activate cytolytic functions of T cells or directly inhibit viral replication. Latent transcription factors in the cytoplasm of these cells respond to external signals and subsequently transmit them to the nucleus. For example, steroid receptors (8) and caspase-activated DNase (10) can receive an activating signal in the cytoplasm and rapidly shuttle into the nucleus. Other diverse transcription factor families, including the interferon regulatory factor (IRF) (32), the signal transducer and activator of transcription (STAT) (7), the NF-κB (15, 16), and the nuclear factor of activated T cells (NFAT) (6) families, can also respond to the external signals in the same way. The functional diversity of such transcription factors depends upon modifications (such as phosphorylation) and/or interactions with other transcription factors that are coexpressed and/or activated in the infected cells (34, 36). In this study, we observed a cytoplasm-to-nucleus translocation of IFP35 when it was coexpressed with BTas. A similar cytoplasm-to-nucleus translocation of IFP35 was reported when IFP35 was induced by the interferon treatment (3). We believe that this redistribution is necessary for the biological function of IFP35. Our results suggest that BTas could act as a chaperone for the nuclear entry of IFP35 by direct interaction.

The different inhibitory effects of IFP35 on BFV in HeLa and 293T cells may be caused by the level of endogenous IFP35, which is at a higher level in HeLa cells than in 293T cells (3, 5). We believe that endogenous IFP35 plays a more important role in inhibiting BFV in HeLa cells than in 293T cells. This idea is supported by the increase in BFV LTR-driven activation after the repression of endogenous IFP35 by RNAi. Thus, endogenous IFP35 might account for the low activation of BFV in HeLa cells. In addition, very little IFP35 entered the nucleus when BTas and IFP35 were cotransfected into HeLa cells, which is different from the results with 293T cells. Coupled with the high level of endogenous IFP35, this may explain why overexpressed IFP35 did not inhibit BFV replication in HeLa cells.

Most retroviruses cause disease after infecting natural or accidental hosts. The genomic organization of FVs shows striking similarity to those of other retroviruses, especially human T-cell leukemia virus type I and human immunodeficiency virus type 1. In addition, FVs share many characteristics with the human pathogen hepatitis B virus, such as reverse transcription late in infection, leading to a DNA genome (23). However, no specific disease related to FVs has been reported (23). Understanding the mechanisms responsible for latent infection induced by FV may yield insight into pathogenesis by other retroviruses. It may also aid in the development of FVs as vectors for gene therapy. In this study, although most the experiments were done in a heterologous system (bovine FV Tas and human IFP35), the Tas-mediated transactivation of either BFV or PFV could be significantly reduced when enough IFP35 was present. Our data suggest that IFP35 could be a general mechanism for inhibiting FV replication.

Acknowledgments

We thank Elizabeth J. Taparowsky (Purdue University) for providing the pDCR-IFP35 plasmid, Charles Wood (University of Nebraska-Lincoln) for the human B-cell cDNA library, Yang Shi (Harvard Medical School) for the pBS/U6 plasmid, and Maxine L. Linial (Fred Hutchinson Cancer Research Center and University of Washington) for the HFV pCMV-Tas and pLTR-luc plasmids. We also thank Maxine L. Linial for her critical reading of the manuscript.

This work was supported by the National Basic Research Program of China (grant 2005CB522903) and the National Natural Science Foundation of China (grants 30570072 and 30770097).

Footnotes

▿

Published ahead of print on 27 February 2008.

REFERENCES

  • 1.Anderson, S. L., J. M. Carton, J. Lou, L. Xing, and B. Y. Rubin. 1999. Interferon-induced guanylate binding protein-1 (GBP-1) mediates an antiviral effect against vesicular stomatitis virus and encephalomyocarditis virus. Virology 2568-14. [DOI] [PubMed] [Google Scholar]
  • 2.Arnheiter, H., M. Frese, R. Kambadur, E. Meier, and O. Haller. 1996. Mx transgenic mice—animal models of health. Curr. Top. Microbiol. Immunol. 206119-147. [DOI] [PubMed] [Google Scholar]
  • 3.Bange, F. C., U. Vogel, T. Flohr, M. Kiekenbeck, B. Denecke, and E. C. Bottger. 1994. IFP 35 is an interferon-induced leucine zipper protein that undergoes interferon-regulated cellular redistribution. J. Biol. Chem. 2691091-1098. [PubMed] [Google Scholar]
  • 4.Benezra, R., R. L. Davis, D. Lockshon, D. L. Turner, and H. Weintraub. 1990. The protein Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell 6149-59. [DOI] [PubMed] [Google Scholar]
  • 5.Chen, J., R. L. Shpall, A. Meyerdierks, M. Hagemeier, E. C. Bottger, and L. Naumovski. 2000. Interferon-inducible Myc/STAT-interacting protein Nmi associates with IFP 35 into a high molecular mass complex and inhibits proteasome-mediated degradation of IFP 35. J. Biol. Chem. 27536278-36284. [DOI] [PubMed] [Google Scholar]
  • 6.Crabtree, G. R. 1999. Generic signals and specific outcomes: signaling through Ca2+, calcineurin, and NF-AT. Cell 96611-614. [DOI] [PubMed] [Google Scholar]
  • 7.Darnell, J. E., Jr., I. M. Kerr, and G. R. Stark. 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 2641415-1421. [DOI] [PubMed] [Google Scholar]
  • 8.DeFranco, D. B. 1999. Regulation of steroid receptor subcellular trafficking. Cell Biochem. Biophys. 301-24. [DOI] [PubMed] [Google Scholar]
  • 9.Durocher, Y., S. Perret, and A. Kamen. 2002. High-level and high-throughput recombinant protein production by transient transfection of suspension-growing human 293-EBNA1 cells. Nucleic Acids Res. 30E9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Enari, M., H. Sakahira, H. Yokoyama, K. Okawa, A. Iwamatsu, and S. Nagata. 1998. A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 39143-50. [DOI] [PubMed] [Google Scholar]
  • 11.Espert, L., G. Degols, C. Gongora, D. Blondel, B. R. Williams, R. H. Silverman, and N. Mechti. 2003. ISG20, a new interferon-induced RNase specific for single-stranded RNA, defines an alternative antiviral pathway against RNA genomic viruses. J. Biol. Chem. 27816151-16158. [DOI] [PubMed] [Google Scholar]
  • 12.Espert, L., G. Degols, Y. L. Lin, T. Vincent, M. Benkirane, and N. Mechti. 2005. Interferon-induced exonuclease ISG20 exhibits an antiviral activity against human immunodeficiency virus type 1. J. Gen. Virol. 862221-2229. [DOI] [PubMed] [Google Scholar]
  • 13.Falcone, V., M. Schweizer, A. Toniolo, D. Neumann-Haefelin, and A. Meyerhans. 1999. Gamma interferon is a major suppressive factor produced by activated human peripheral blood lymphocytes that is able to inhibit foamy virus-induced cytopathic effects. J. Virol. 731724-1728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gale, M., Jr., and M. G. Katze. 1998. Molecular mechanisms of interferon resistance mediated by viral-directed inhibition of PKR, the interferon-induced protein kinase. Pharmacol. Ther. 7829-46. [DOI] [PubMed] [Google Scholar]
  • 15.Ghosh, S., and D. Baltimore. 1990. Activation in vitro of NF-kappa B by phosphorylation of its inhibitor I kappa B. Nature 344678-682. [DOI] [PubMed] [Google Scholar]
  • 16.Ghosh, S., M. J. May, and E. B. Kopp. 1998. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16225-260. [DOI] [PubMed] [Google Scholar]
  • 17.Guo, J., K. L. Peters, and G. C. Sen. 2000. Induction of the human protein P56 by interferon, double-stranded RNA, or virus infection. Virology 267209-219. [DOI] [PubMed] [Google Scholar]
  • 18.Haller, O., M. Frese, and G. Kochs. 1998. Mx proteins: mediators of innate resistance to RNA viruses. Rev. Sci. Tech. 17220-230. [DOI] [PubMed] [Google Scholar]
  • 19.He, F., W. S. Blair, J. Fukushima, and B. R. Cullen. 1996. The human foamy virus Bel-1 transcription factor is a sequence-specific DNA binding protein. J. Virol. 703902-3908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hui, D. J., C. R. Bhasker, W. C. Merrick, and G. C. Sen. 2003. Viral stress-inducible protein p56 inhibits translation by blocking the interaction of eIF3 with the ternary complex eIF2.GTP.Met-tRNAi. J. Biol. Chem. 27839477-39482. [DOI] [PubMed] [Google Scholar]
  • 21.Kido, K., A. Doerks, M. Lochelt, and R. M. Flugel. 2002. Identification and functional characterization of an intragenic DNA binding site for the spumaretroviral trans-activator in the human p57Kip2 gene. J. Biol. Chem. 27712032-12039. [DOI] [PubMed] [Google Scholar]
  • 22.Lenschow, D. J., C. Lai, N. Frias-Staheli, N. V. Giannakopoulos, A. Lutz, T. Wolff, A. Osiak, B. Levine, R. E. Schmidt, A. Garcia-Sastre, D. A. Leib, A. Pekosz, K. P. Knobeloch, I. Horak, and H. W. Virgin IV. 2007. IFN-stimulated gene 15 functions as a critical antiviral molecule against influenza, herpes, and Sindbis viruses. Proc. Natl. Acad. Sci. USA 1041371-1376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Linial, M. L. 1999. Foamy viruses are unconventional retroviruses. J. Virol. 731747-1755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Liu, J., S. Liu, Q. Chen, and Y. Geng. 1999. Borf-1 protein identified as a transcriptional trans-activator of bovine foamy virus. Chin. Sci. Bull. 441017-1021. [Google Scholar]
  • 25.Meiering, C. D., and M. L. Linial. 2003. The promyelocytic leukemia protein does not mediate foamy virus latency in vitro. J. Virol. 772207-2213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Meiering, C. D., and M. L. Linial. 2002. Reactivation of a complex retrovirus is controlled by a molecular switch and is inhibited by a viral protein. Proc. Natl. Acad. Sci. USA 9915130-15135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Meurs, E., K. Chong, J. Galabru, N. S. Thomas, I. M. Kerr, B. R. Williams, and A. G. Hovanessian. 1990. Molecular cloning and characterization of the human double-stranded RNA-activated protein kinase induced by interferon. Cell 62379-390. [DOI] [PubMed] [Google Scholar]
  • 28.Meurs, E. F., Y. Watanabe, S. Kadereit, G. N. Barber, M. G. Katze, K. Chong, B. R. Williams, and A. G. Hovanessian. 1992. Constitutive expression of human double-stranded RNA-activated p68 kinase in murine cells mediates phosphorylation of eukaryotic initiation factor 2 and partial resistance to encephalomyocarditis virus growth. J. Virol. 665805-5814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Okumura, A., G. Lu, I. Pitha-Rowe, and P. M. Pitha. 2006. Innate antiviral response targets HIV-1 release by the induction of ubiquitin-like protein ISG15. Proc. Natl. Acad. Sci. USA 1031440-1445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Pavlovic, J., A. Schroder, A. Blank, F. Pitossi, and P. Staeheli. 1993. Mx proteins: GTPases involved in the interferon-induced antiviral state. Ciba Found. Symp. 176233-247. [DOI] [PubMed] [Google Scholar]
  • 31.Regad, T., A. Saib, V. Lallemand-Breitenbach, P. P. Pandolfi, H. de The, and M. K. Chelbi-Alix. 2001. PML mediates the interferon-induced antiviral state against a complex retrovirus via its association with the viral transactivator. EMBO J. 203495-3505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Reich, N. C. 2002. Nuclear/cytoplasmic localization of IRFs in response to viral infection or interferon stimulation. J. Interferon Cytokine Res. 22103-109. [DOI] [PubMed] [Google Scholar]
  • 33.Sabile, A., A. Rhodes-Feuillette, F. Z. Jaoui, J. Tobaly-Tapiero, M. L. Giron, J. Lasneret, J. Peries, and M. Canivet. 1996. In vitro studies on interferon-inducing capacity and sensitivity to IFN of human foamy virus. Res. Virol. 14729-37. [DOI] [PubMed] [Google Scholar]
  • 34.Taniguchi, T., K. Ogasawara, A. Takaoka, and N. Tanaka. 2001. IRF family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19623-655. [DOI] [PubMed] [Google Scholar]
  • 35.Taylor, D. R., M. Puig, M. E. Darnell, K. Mihalik, and S. M. Feinstone. 2005. New antiviral pathway that mediates hepatitis C virus replicon interferon sensitivity through ADAR1. J. Virol. 796291-6298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Tjian, R., and T. Maniatis. 1994. Transcriptional activation: a complex puzzle with few easy pieces. Cell 775-8. [DOI] [PubMed] [Google Scholar]
  • 37.Wang, X., L. M. Johansen, H. J. Tae, and E. J. Taparowsky. 1996. IFP 35 forms complexes with B-ATF, a member of the AP1 family of transcription factors. Biochem. Biophys. Res. Commun. 229316-322. [DOI] [PubMed] [Google Scholar]
  • 38.Wong, S. K., and D. W. Lazinski. 2002. Replicating hepatitis delta virus RNA is edited in the nucleus by the small form of ADAR1. Proc. Natl. Acad. Sci. USA 9915118-15123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Yang, F., Y. Zhang, Y. L. Cao, S. H. Wang, and L. Liu. 2005. Establishment and utilization of a tetracycline-controlled inducible RNA interfering system to repress gene expression in chronic myelogenous leukemia cells. Acta Biochim. Biophys. Sin. (Shanghai) 37851-856. [DOI] [PubMed] [Google Scholar]
  • 40.Zhang, L., Y. Tang, Y. Tie, C. Tian, J. Wang, Y. Dong, Z. Sun, and F. He. 2006. The PH domain containing protein CKIP-1 binds to IFP35 and Nmi and is involved in cytokine signaling. Cell Signal. 19932-944. [DOI] [PubMed] [Google Scholar]
  • 41.Zhou, A., B. A. Hassel, and R. H. Silverman. 1993. Expression cloning of 2-5A-dependent RNAase: a uniquely regulated mediator of interferon action. Cell 72753-765. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES