Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2008 Feb 29;74(8):2391–2397. doi: 10.1128/AEM.02587-07

Effects of Carbon Dioxide on Neurotoxin Gene Expression in Nonproteolytic Clostridium botulinum Type E

Ingrid Artin 1,2,3, Andrew T Carter 2, Elisabet Holst 3, Maria Lövenklev 1,, David R Mason 2, Michael W Peck 2, Peter Rådström 1,*
PMCID: PMC2293167  PMID: 18310434

Abstract

Carbon dioxide is an antimicrobial gas commonly used in modified atmosphere packaging. In the present study, the effects of carbon dioxide on the growth of and neurotoxin production by nonproteolytic Clostridium botulinum type E were studied during the growth cycle. Quantitative reverse transcription-PCR and an enzyme-linked immunosorbent assay were used to quantify expression of the type E botulinum neurotoxin gene (cntE) and the formation of type E neurotoxin. The expression levels of cntE were similar in two strains, with relative expression peaking in the transition between exponential phase and stationary phase. In stationary phase, cntE mRNA expression declined rapidly. The cntE mRNA half-life was calculated to be approximately 9 minutes. Neurotoxin formation occurred in late exponential phase and stationary phase. High carbon dioxide concentrations delayed growth by increasing the lag time and decreasing the maximum growth rate. The effects of carbon dioxide concentration on relative neurotoxin gene expression and neurotoxin formation were significant. Expression of cntE mRNA and the formation of extracellular neurotoxin were twofold higher with a headspace carbon dioxide concentration of 70% (vol/vol) compared to 10% (vol/vol). This finding sheds a new, cautionary light on the potential risks of botulism associated with the use of modified atmosphere packaging.


Clostridium botulinum is a group of four distinct spore-forming, obligately anaerobic bacteria that share the common feature of forming a botulinum neurotoxin (BoNT). There are seven different PNT serotypes ([BoNT/A to BoNT/G), and these are the most potent toxins known. Food-borne botulism is caused by consuming preformed neurotoxin in foods, with as little as 30 ng of neurotoxin being potentially lethal (32). Proteolytic C. botulinum (group I C. botulinum) and nonproteolytic C. botulinum (group II C. botulinum) are the two groups of C. botulinum most frequently associated with food-borne botulism. BoNT/E produced by nonproteolytic C. botulinum type E is the most frequent cause of food-borne botulism in the colder regions of the northern hemisphere. Foods associated with these outbreaks include vacuum-packed smoked fish, salted fish, and fermented marine mammals (7, 8, 11, 22, 25, 31, 34). Nonproteolytic C. botulinum derives energy by degrading sugars and can grow and produce toxin at temperatures as low as 3°C (19, 31).

Recent consumer demand for mildly processed foods that are convenient, easy to use, and low in preservatives (e.g., salt and nitrite) has led to the development of new processes and packaging techniques. The safety and quality of minimally heated chilled foods commonly relies on a combination of a mild heat treatment, refrigerated storage, and low-oxygen modified-atmosphere packaging (MAP). Carbon dioxide is frequently included in a modified atmosphere because of its antimicrobial activity (13). While the mild heat treatments applied to these foods are sufficient to kill vegetative cells, they will not eliminate all bacterial spores; in fact, they may even induce their germination. The anaerobic atmosphere used in MAP is strongly inhibitory to aerobic organisms but has a lesser effect on anaerobic bacteria such as nonproteolytic C. botulinum (16, 18). Nonproteolytic C. botulinum is the principal microbiological safety hazard in these new minimally heated chilled foods (31). Fish packed in modified atmosphere is one of the greatest hazards, as fish may be heavily contaminated with spores of nonproteolytic C. botulinum (26), and toxin production may precede microbial spoilage and sensory rejection (1, 17).

Formations of botulinum neurotoxin are reported to vary with serotype, strain, medium, and culture condition (21). However, little is known about the direct regulation of the neurotoxin gene (cnt) or of neurotoxin formation by nonproteolytic C. botulinum type E. While a positive regulator, cntR, has been found in other types of C. botulinum, it appears to be absent in C. botulinum type E (9, 24, 36). Several in vitro methods have been developed for monitoring cnt expression in proteolytic C. botulinum and nonproteolytic C. botulinum, including a gene reporter system (12), competitive reverse transcription (RT)-PCR (29, 39, 40), and quantitative RT-PCR (qRT-PCR) (10, 23, 27, 28, 42). Experiments using these methods found a peak in neurotoxin gene expression in late exponential or early stationary phase. However, many of these studies examined only one or two points during growth, making it uncertain if the full cnt expression profile had been found. To establish the position for C. botulinum type E, a qRT-PCR method was developed to quantify the relative expression of cntE mRNA during all stages of growth, using two different strains. An enzyme-linked immunosorbent assay (ELISA) was used to correlate the levels of cntE mRNA with the amount of extracellular neurotoxin formed.

A recent study of nonproteolytic C. botulinum type B (27) showed that the expression of cntB and the formation of BoNT/B in a 70% carbon dioxide atmosphere were fivefold greater than those in a 10% carbon dioxide atmosphere. Intermediate gene expression and neurotoxin formation occurred in a 35% carbon dioxide atmosphere (27). In order to determine if this response to carbon dioxide is also shown by nonproteolytic C. botulinum type E, the effects of three concentrations of carbon dioxide on the growth of cntE expression and BoNT/E production by C. botulinum type E strain ATCC 9564 were investigated. Finally, in order to establish that there is a close relationship between cntE mRNA accumulation (as measured by qRT-PCR) and its rate of gene expression, the rate of cntE mRNA breakdown was determined.

MATERIALS AND METHODS

Bacterial strains and culture conditions.

Two strains of nonproteolytic C. botulinum type E, ATCC 9564 and BL 1177, were used. Strain BL 1177 was isolated from salmon implicated in a case of food-borne botulism in Sweden. Overnight cultures of each strain were prepared in tryptone-peptone-yeast extract (TPY) broth and incubated anaerobically for 18 to 20 h at 30°C. The TPY broth contained tryptone (50 g/liter; Oxoid, Basingstoke, United Kingdom), proteose peptone (5 g/liter; Oxoid), yeast extract (20 g/liter; Oxoid), and sodium thioglycolate (1 g/liter; Merck, Darmstadt, Germany). After sterilization, the medium was incubated for 24 to 36 h in an anaerobic workstation (Electrotek AW 800 TG; addVise, Bromma, Sweden) to allow for temperature and gas atmosphere equilibration. The standard atmosphere inside the workstation contained nitrogen, carbon dioxide, and hydrogen (80:10:10 [per vol]). Flasks containing 237.5 ml TPY-C broth, i.e., TPY supplemented with 0.4% (wt/vol) glucose (BDH Laboratory Supplies, Poole, United Kingdom), 0.1% (wt/vol) each of the disaccharides maltose (ICN Biochemicals, Aurora, OH) and cellobiose (Sigma-Aldrich, St. Louis, MO), and 0.1% (wt/vol) soluble starch (Merck), were each inoculated with 12.5 ml of an overnight single-strain culture and incubated under the same conditions described above. Growth was followed using measurements of optical density at 620 nm (OD620) with a Hitachi UV-1500 spectrophotometer (Hitachi Instruments). Samples for total RNA extraction were withdrawn at different sampling times throughout growth (after 4.75 h, 5.75 h, 6.5 h, 7.25 h, 8.75 h, 9.25 h, 10.25 h, 12.5 h, 29 h 55 min, and 75.5 h). At the same times, separate samples were removed and frozen immediately for subsequent ELISA analysis for neurotoxin.

qRT-PCR primer and probe design.

Two assays were used, one for cntE and one for the housekeeping gene encoding the 16S rRNA (rrn). This gene has previously been used as a reference gene for quantification of both the toxin gene in nonproteolytic C. botulinum type B (27, 28) and the germination gene (gerA) in proteolytic C. botulinum type B (5). The primers and probes used in this study are listed in Table 1. Primers and probes previously designed for the detection of the cntE gene were used (2). The primers of Lövenklev et al. (28) for the rrn gene were compared to the sequence of the rrn gene for nonproteolytic C. botulinum type E and found to be compatible, as this is a highly conserved region. Several probes were designed and compared. The hybridization probes consist of two parts: a donor probe labeled with fluorescein at the 3′ end and an acceptor probe labeled with LC Red640 (LC) at the 5′ end with its 3′ end blocked with a phosphate moiety. Agarose gel electrophoresis showed that the amplified products were of the expected sizes.

TABLE 1.

Sequences and fluorescent dye of primers and hybridization probes used for qRT-PCR

Target gene GenBank accession no. Primer/probe Nucleotide positions Nucleotide sequence (5′→ 3′) Reference
cntE X62683 fToxE 1658-1673 TGAATCAGCACCTGGA 2
rToxE 1974-1982 GGTTAGCTTCAGTAGTAAA 2
ToxE-Fluo 1913-1936 TGTCAATAAACCTGTGCAAGCAGC-FLa 2
ToxE-Red 1939-1973 LC-TATTTGTA(A/G)GCTGGATACAACAAGT(A/G)TTAGTAGAT-pb 2
rrn X68170 f16S 1045-1066 GTGTCGTGAGATGTTGGGTTAA 28
r16S 1232-1251 TAGCTCCACCTCGCGGTATT 28
16S-Fluo 1119-1138 CTCTAGCGAGACTGCCGTGG-FLa This study
16S-Red 1141-1157 LC-AACGCGGAGGAAGGTGG-pb This study
a

The donor probe is labeled with fluorescein (FL) at the 3′ end.

b

The acceptor probe is labeled with LC Red640 (LC) at the 5′ end and a 3′ hydroxyl blocked with a phosphate moiety (p).

Analysis of neurotoxin gene expression.

Total RNA was extracted using a modified method for extraction of total RNA from Bacillus spp. with acidic phenol (35). Cells from a 10-ml suspension were harvested by centrifugation (10,400 × g at 4°C) for 10 min and resuspended in 500 μl ice-cold TES buffer, pH 7.5 (50 mM Tris [ICN Biochemicals], 5 mM EDTA [sigma], and 50 mM NaCl [sigma]). Total RNA was recovered using the bead-beating method described by Lövenklev et al. (28). Before RT, contaminating DNA was degraded by treatment with RNase-free DNase (Promega, Madison, WI). Total RNA concentrations were determined using a RiboGreen RNA quantification kit (Molecular Probes, Leiden, The Netherlands) and by measuring fluorescence at 525 nm with a TD-700 fluorometer (Turner Designs, Sunnyvale, CA). The RNA was stored at −80°C before analysis.

First-strand cDNA was synthesized in two separate RT assays using the reverse primers for the cntE gene and the rrn gene (Table 1). Synthesis of cDNA was performed in a Gene Amp 9700 thermal cycler (Perkin-Elmer Cetus, Norwalk, CT). The total volume of the reaction mixture was 20 μl and contained 0.1 μg total RNA, 0.5 μM of each primer (Sigma-Genosys), 0.5 mM each of nucleotides dATP, dTTP, dCTP, and dGTP (Roche Diagnostics GmbH, Mannheim, Germany), 20 U RNasin RNase inhibitor (Promega), 5 mM DTT (Life Technologies, Gaithersburg, MD), 1× first-strand buffer, and 200 U Superscript II RNase H reverse transecriptase (Life Technologies). Before RT enzymes were added, the reaction mixture was heated to 65°C for 5 min and then chilled on ice. After a brief centrifugation and the addition of RT enzymes, the reaction mixture was incubated at 42°C for 50 min and the reaction was terminated by incubation at 70°C for 15 min.

PCR amplification was carried out in a LightCycler instrument (Roche Diagnostics). The PCR mixture specific for the cntE gene contained 1× PCR buffer (Roche Diagnostics), 4 mM MgCl2 (Roche Diagnostics), 0.2 mM of each dNTP (Roche Diagnostics), 0.3 μM of each primer, 0.3 μM of each probe (TIB Molbiol, Berlin, Germany), 1.25 U Tth DNA polymerase (Roche Diagnostics), and 4 μl of template solution. For the rrn gene, the mixture was the same except for the primer concentration (0.5 μM). The cDNA solution for the rrn gene was diluted 100-fold in water treated with diethyl pyrocarbonate before PCR amplification. The total volume added to each capillary was 20 μl. The LightCycler amplification protocol that was used started with an initial denaturation at 95°C for 60 s, followed by 45 cycles of 95°C for 0 s (i.e., no hold at 95°C), annealing and fluorescence acquisition at 56°C for 5 s, and elongation at 72°C for 25 s. The temperature transition rate was 20°C/s. The specificity was confirmed using melting curve analysis. It consisted of 95°C for 0 s, 50°C for 15 s, and then an increase in temperature of 0.2°C/s up to 90°C. Each sample was analyzed three times for each gene. The crossing point was determined using the second derivative maximum mathematical model in the LightCycler software (version 3.5; Roche Molecular Biochemicals).

A dilution series of total RNA was reverse transcribed and amplified with the LightCycler to determine the amplification efficiency (AE) and log-linear range of amplification for each real-time assay. The AE in the exponential phase was calculated as 10(−1/s) − 1, where s is the slope of the crossing point value (CP) plotted against the logarithm of the amount of RNA transcribed. The cntE assay had a linear range of amplification between 50 pg and 5 μg of added total RNA, and the AE was determined to be EcntE = 0.87. The rrn assay had a linear range of amplification between 5 pg and 0.5 μg of added total RNA, and the AE was Errn = 1.3.

To confirm the effectiveness of the DNase treatment, DNase-treated RNA was amplified using real-time PCR assays. None of the controls gave a fluorescent signal with real-time PCR, confirming that the DNase treatment removed all genomic DNA (data not shown).

The relative expression (RE) of the cntE gene compared to that of the rrn gene was calculated using these E values and the crossing point deviation (ΔCP) of the unknown sample compared to a calibrator sample using the equation Inline graphic (33).

Measurement of neurotoxin concentration.

The concentrations of type E neurotoxin in culture supernatant samples were determined using a commercial ELISA procedure according to the manufacturer's instructions (Metabiologics, Madison, WI). The ELISA procedure incorporates polyclonal antibodies from rabbits specific for type E neurotoxin. Culture samples were centrifuged (4°C, 10,000 × g, 10 min) to separate the bacteria from the supernatant fluid. The supernatant samples were then diluted in casein buffer so that the concentration was within the linear range of the calibration curve (seven standards: 0.0, 0.1, 0.2, 0.4, 0.6, 0.8, 1.0 ng/ml). A 100-μl sample of culture supernatant was placed in each well and the absorbance measured at 450 nm using an ELISA plate reader. Each sample was measured in duplicate, and the mean and standard deviation were calculated.

Assessment of mRNA degradation.

An aliquot (12.5 ml) of overnight culture of exponentially growing strain ATCC 9564 was inoculated into 237.5 ml of TPY-C broth and incubated in the standard anaerobic atmosphere at 37°C. Growth was monitored by determining the OD620. The result was a typical sigmoid curve. When the cells were in mid-exponential phase (OD620 = 2.3), rifampin was added at a final concentration of 100 mg/liter. Samples (10 ml) were removed at the time of the rifampin addition and thereafter at appropriate time intervals for RNA extraction, in order to quantify mRNA degradation. The RNA extraction was performed as stated earlier, with the exception that cells were harvested by centrifugation for 4 min at 12,500 × g at 4°C. The shorter centrifugation time enabled more-frequent sampling. RT-PCR for cntE mRNA was performed on 1 μg of total RNA, as described above. A standard curve was made by serial dilution of RNA from the reference sample, the sample taken at the time of the rifampin addition. The percentage of cntE mRNA remaining was calculated using the reference sample as 100%.

The effects of carbon dioxide concentration on growth, neurotoxin gene expression, and neurotoxin formation.

Strain ATCC 9564 was used. Three different modified atmospheres containing 10%, 35%, and 70% (per vol) CO2 were tested. The concentration of H2 was 10%, and the balance was N2. Three flasks, each containing 237.5 ml TPY-C, were boiled to create anaerobic conditions and then flushed with the appropriate gas mixture, before autoclaving. The flasks were equilibrated in a Macs MG 1000 anaerobic workstation (Don Whitley, Shipley, United Kingdom) with the same atmosphere. Each flask was inoculated with 12.5 ml of an overnight culture and incubated at 30°C. Growth was followed by measuring the OD620. Samples for total RNA extraction and ELISA were withdrawn in early exponential phase (OD620 = 0.5 to 1), in late exponential phase (OD620 ≈ 3), and in late stationary phase (after ca. 30 h). The growth experiment was carried out in triplicate for each CO2 concentration. Maximum specific growth rates [μ (OD)] and lag times [λ (OD)] of the change in OD620 with time data were estimated by fitting the equation of Baranyi and Roberts (3). It is noted that λ (OD), the period during which the cell population reaches a detectable turbidity, is longer than the lag time (λ) of the cell population estimated using viable count data. Regression analysis was carried out to describe the relationship between the percentage of CO2 in the atmosphere and the growth parameters.

RESULTS

Expression of the type E neurotoxin gene by C. botulinum.

A qRT-PCR method was developed to quantify the relative expression of cntE. Two assays were designed, one specific for cntE and one for rrn. The linear range of amplification and the AE for each qRT-PCR assay were determined by serial dilution of the total RNA before the RT. The AE was 0.87 for the cntE gene and 1.3 for the rrn gene.

Relative quantification of cntE expression in strain ATCC 9564 showed that the transcript level of cntE mRNA increased sharply during growth and reached a maximum in the transition between exponential phase and stationary phase (Fig. 1). It then decreased rapidly and did not rise again. Similar results were also obtained with strain BL 1177 (data not shown).

FIG. 1.

FIG. 1.

Effect of growth stage on relative expression of cntE and neurotoxin (BoNT/E) production by nonproteolytic C. botulinum strain ATCC 9564. Growth in TPY-C medium at 30°C with 10% H2, 10% CO2, and 80% N2. Diamonds, OD620; squares, RE of cntE; triangles, BoNT/E. Data are mean values of three independent experiments. Error bars show standard deviations.

The rate of cntE mRNA breakdown was measured to confirm that there is a close relationship between its mRNA accumulation (as measured by qRT-PCR) and its rate of gene expression (Fig. 2). Breakdown of mRNA showed a log-linear relationship, with less than 1 percent remaining after 1 hour. The cntE mRNA half-life was calculated to be approximately 9 minutes.

FIG. 2.

FIG. 2.

Breakdown of cntE mRNA in nonproteolytic C. botulinum strain ATCC 9564. The amount of cntE mRNA remaining is expressed as a percentage of the starting concentration (at the time of the rifampin addition). Data are from two independent experiments. The means and standard deviations are based on three technical replicates.

The effects of carbon dioxide on growth and neurotoxin expression.

A higher concentration of carbon dioxide resulted in slower growth of C. botulinum strain ATCC 9564 (Fig. 3). The effect of carbon dioxide on the μ (OD) was significant (P value of <0.05). Regression analysis was carried out to quantify the relationship between the concentration of carbon dioxide and the maximum specific growth rate (assuming that this relationship is linear). The resulting model can be written as follows: μ (OD) = 0.3949 − (0.00221 × [% CO2]). The adjusted R2 was 0.90, and the standard error of the fit was 0.0194. The λ (OD) increased with carbon dioxide concentration (Table 2).

FIG. 3.

FIG. 3.

Effect of carbon dioxide concentration on the growth of nonproteolytic C. botulinum strain ATCC 9564. Diamonds, 10% CO2; squares, 35% CO2; triangles, 70% CO2. The mean values and standard deviations are based on three independent growth experiments for each gas atmosphere.

TABLE 2.

Effect of carbon dioxide concentration on the growth parameters of nonproteolytic C. botulinum type E strain ATCC 9564 in TPY-C medium at 30°C in an atmosphere of 10% H2, 10 to 70% CO2, and 20 to 80% N2a

% CO2 μ (OD) (ln[OD]/h) λ (OD) (h)
10 0.36 ± 0.01 0.67 ± 0.24
35 0.34 ± 0.00 1.49 ± 0.12
70 0.23 ± 0.01 1.47 ± 0.09
a

Means ± standard deviations are shown.

Relative expression of cntE was affected by both the stage of growth and the concentration of carbon dioxide (Fig. 4). A two-way factorial analysis was used to evaluate the effect of the stage of growth and the concentration of carbon dioxide on the relative expression of cntE (Table 3). The effect of the stage of growth and the carbon dioxide concentration on cntE expression were both highly significant (P value of <0.0001). A multiple-means comparison test was carried out to determine the differences between the three growth stages and between the three carbon dioxide concentrations. Expression of cntE was significantly higher in late exponential phase than in early exponential phase, and expression in stationary phase was significantly lower than in exponential phase (Table 3). Furthermore, cntE expression was significantly higher with 70% CO2 than with lower concentrations of CO2. The concentration of BoNT/E in late-stationary-phase cultures was consistent with the observations of relative cntE expression. The concentrations of BoNT/E after 30 h were 265 ± 78 ng/ml at 10% CO2, 374 ± 80 ng/ml at 35% CO2, and 570 ± 43 ng/ml at 70% CO2 (Fig. 4).

FIG. 4.

FIG. 4.

Effect of carbon dioxide concentration and growth phase on the RE of cntE (bars) and the formation of neurotoxin (diamonds, BoNT/E) by nonproteolytic C. botulinum strain ATCC 9564. Light gray, 10% CO2; dark gray, 35% CO2; black, 70% CO2. The mean values and standard deviations are based on three independent growth experiments for each treatment.

TABLE 3.

Effect of carbon dioxide concentration and stage of growth on expression of the neurotoxin gene (cntE) by nonproteolytic C. botulinum type E strain ATCC 9564

% CO2 cntE expression at indicate growth stagea
Early exponential Late exponential Late stationary
10 4.21 ± 1.65b,β 12.95 ± 3.57a,β 0.29 ± 0.12b,β
35 4.34 ± 1.57b,β 16.75 ± 1.37a,β 0.49 ± 0.22c,β
70 14.17 ± 3.12b,α 27.55 ± 4.72a,α 1.41 ± 0.36c,α
a

Means ± standard deviations are shown. Latin letters show the results of Tukey's test for each CO2 concentration. Greek letters show the results of Tukey's test for each growth stage. Means with the same letter are not significantly different.

DISCUSSION

Expression of cntE by nonproteolytic C. botulinum type E strains ATCC 9564 and BL1177 was found to be related to growth phase. The relative expression of cntE mRNA peaked sharply, reached a maximum in the transition between late exponential phase and early stationary phase, and then fell rapidly to a low level during stationary phase. This observation is in agreement with previous reports on nonproteolytic C. botulinum type E strains HV and EVH (10, 39), although McGrath et al. (29), working with strain E VH Dolman, reported a greater expression of cntE in stationary phase than in mid-exponential phase. In the present study, while the decrease in cntE expression was rapid, it was not completely arrested in stationary phase. It was found that the concentration of cntE mRNA fell only 10-fold in the hour immediately after peaking, not 100-fold as would be expected based on the degradation rate of cntE mRNA if transcription of cntE had ceased immediately. This may be due to the continued transcription of cntE, albeit at a lower level, and/or the cells in the population not all entering stationary phase at exactly the same time. In addition, the degradation rate of cntE mRNA may be different in stationary phase than in mid-exponential phase.

The expression profile of cntE mRNA has both similarities and differences to those reported previously for other neurotoxin genes. The general trends for nonproteolytic C. botulinum type B at 30°C seem very similar, with an increase in cntB mRNA expression during growth, followed by a peak in early stationary phase, although the decrease in mRNA expression in stationary phase is neither as rapid nor as full as that in nonproteolytic C. botulinum type E (28). In proteolytic C. botulinum types A and B, a second rise in cnt mRNA expression has been observed in late stationary phase (10, 28). Furthermore, the decrease in mRNA expression in early stationary phase is not as rapid as that in cntE mRNA (4, 10, 28, 37, 42). The choice of media has also been reported to affect the expression profile (4). The differences between different types and strains may be due to differences in regulation, since nonproteolytic C. botulinum type E does not appear to have the positive regulator cntR, which has been found in the other botulinum toxin gene clusters (9, 24, 36). The tight regulation of expression of cntE in nonproteolytic C. botulinum type E does, however, suggest the presence of a positive regulator that remains to be identified.

Previous studies have reported that growth of nonproteolytic C. botulinum is slowed by high concentrations of carbon dioxide (16, 18, 27). The present study has extended these studies by demonstrating that this delay in turbidity is due to both an increased lag time and a decreased growth rate. However, from a food safety perspective, it is the production of neurotoxin, not cell growth, that is the important parameter. The present study has established that neurotoxin formation by nonproteolytic C. botulinum type E is greater at a higher concentration of carbon dioxide, confirming similar observations made previously by Lövenklev et al. (27) with nonproteolytic C. botulinum type B. In the present study, both relative gene expression and the amount of neurotoxin produced after 30 h were twofold higher when the headspace CO2 concentration was 70% than when the CO2 was 10%. It is possible that this is a growth rate phenomenon, where toxin production is enhanced due to a lowered growth rate, as reported for Clostridium difficile under stress conditions (30). Sharkey et al. (39), however, indicated that for nonproteolytic C. botulinum type E, an increased growth rate was associated with an increased expression of cntE, while the presence of sorbic acid and sodium nitrite reduced both the growth rate and expression of cntE (40). Lövenklev et al. (27, 28) also reported an inhibitory effect of nitrite on cntB expression. These reports, taken together, imply that the increase in neurotoxin gene expression and neurotoxin formation in our experiments is more likely to be related to the increased carbon dioxide concentration than to the decrease in growth rate. Similar trends have been found in other species. In Streptococcus pyogenes, it was found that expression of emm, the gene encoding M protein, and scpA, encoding the C5a endopeptidase Scp, which are major virulence factors, were stimulated by an increased concentration of carbon dioxide (6, 43). Carbon dioxide has also been found to stimulate toxin production in Staphylococcus aureus, Vibrio cholerae, and Bacillus anthracis (14, 15, 20, 38, 41, 43).

In conclusion, the finding that carbon dioxide, frequently used as an antimicrobial in MAP, actually stimulates neurotoxin production in nonproteolytic C. botulinum types B and E sheds a new, cautionary light on the risk of botulism and the use of MAP. Thus, in order to ensure the continued production of microbiologically safe food that also shows a high quality for human consumption, data about microbial virulence (including the formation of toxins) is required to complement existing knowledge on the growth and survival of pathogenic microbes. Further investigations are therefore required to identify the effect of factors such as food composition, gas atmosphere, preservatives, and temperature on the down- and upregulation of virulence factors (including toxin formation) in food-borne pathogens. This information will enable the development of new knowledge-led molecule-based strategies for food formulation and food preservation and will also inform quantitative risk assessments.

Acknowledgments

This work was supported by the Swedish Governmental Agency for Innovation Systems; the Swedish Research Council for Environment, Agricultural Sciences, and Spatial Planning; the Competitive Strategic Grant of the BBSRC; and a Marie Curie training site fellowship.

We are very grateful to Carmen Pin for statistical advice.

Footnotes

Published ahead of print on 29 February 2008.

REFERENCES

  • 1.Arritt, F. M., J. D. Eifert, M. L. Jahncke, M. D. Pierson, and R. C. Williams. 2007. Effects of modified atmosphere packaging on toxin production by Clostridium botulinum in raw aquacultured summer flounder fillets (Paralichthys dentatus). J. Food Prot. 70:1159-1164. [DOI] [PubMed] [Google Scholar]
  • 2.Artin, I., P. Björkman, J. Cronqvist, P. Rådström, and E. Holst. 2007. First case of type E wound botulism diagnosed using real-time PCR. J. Clin. Microbiol. 45:3589-3594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Baranyi, J., and T. A. Roberts. 1994. A dynamic approach to predicting bacterial growth in food. Int. J. Food Microbiol. 23:277-294. [DOI] [PubMed] [Google Scholar]
  • 4.Bradshaw, M., S. S. Dineen, N. D. Maks, and E. A. Johnson. 2004. Regulation of neurotoxin complex expression in Clostridium botulinum strains 62A, Hall A-hyper, and NCTC 2916. Anaerobe 10:321-333. [DOI] [PubMed] [Google Scholar]
  • 5.Broussolle, V., F. Alberto, C. A. Shearman, D. R. Mason, L. Botella, C. Nguyen-The, M. W. Peck, and F. Carlin. 2002. Molecular and physiological characterisation of spore germination in Clostridium botulinum and C. sporogenes. Anaerobe 8:89-100. [Google Scholar]
  • 6.Caparon, M. G., R. T. Geist, J. Perez-Casal, and J. R. Scott. 1992. Environmental regulation of virulence in group A streptococci: transcription of the gene encoding M protein is stimulated by carbon dioxide. J. Bacteriol. 174:5693-5701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.CDC. 2001. Botulism outbreak associated with eating fermented food—Alaska, 2001. MMWR Morb. Mortal. Wkly. Rep. 50:680-682. [PubMed] [Google Scholar]
  • 8.CDC. 2003. Outbreak of botulism type E associated with eating a beached whale—western Alaska, July 2002. MMWR Morb. Mortal. Wkly. Rep. 52:24-26. [PubMed] [Google Scholar]
  • 9.Chen, Y., H. Korkeala, J. Aarnikunnas, and M. Lindström. 2007. Sequencing the botulinum neurotoxin and related genes in Clostridium botulinum type E strains reveals orfx3 and a novel type E neurotoxin subtype. J. Bacteriol. 189:8643-8650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Couesnon, A., S. Raffestin, and M. R. Popoff. 2006. Expression of botulinum neurotoxins A and E, and associated non-toxin genes, during the transition phase and stability at high temperature: analysis by quantitative reverse transcription-PCR. Microbiology 152:759-770. [DOI] [PubMed] [Google Scholar]
  • 11.Dawar, M., L. Moody, J. D. Martin, C. Fung, J. Isaac-Renton, and D. M. Patrick. 2002. Two outbreaks of botulism associated with fermented salmon roe-—British Columbia, August 2001. Can. Commun. Dis. Rep. 28:45-49. [PubMed] [Google Scholar]
  • 12.Davis, T. O., I. Henderson, J. K. Brehm, and N. P. Minton. 2000. Development of a transformation and gene reporter system for group II, non-proteolytic Clostridium botulinum type B strains. J. Mol. Microbiol. Biotechnol. 2:59-69. [PubMed] [Google Scholar]
  • 13.Devlieghere, F., J. Debevere, and J. Van Impe. 1998. Concentration of carbon dioxide in the water-phase as a parameter to model the effect of a modified atmosphere on microorganisms. Int. J. Food Microbiol. 43:105-113. [DOI] [PubMed] [Google Scholar]
  • 14.Drysdale, M., A. Bourgogne, S. G. Hilsenbeck, and T. M. Koehler. 2004. atxA controls Bacillus anthracis capsule synthesis via acpA and a newly discovered regulator, acpB. J. Bacteriol. 186:307-315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Drysdale, M., A. Bourgogne, and T. M. Koehler. 2005. Transcriptional analysis of the Bacillus anthracis capsule regulators. J. Bacteriol. 187:5108-5114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Fernandez, P. S., J. Baranyi, and M. W. Peck. 2001. A predictive model of growth from spores of non-proteolytic Clostridium botulinum in the presence of different CO2 concentrations as influenced by chill temperature, pH and NaCl. Food Microbiol. 18:453-461. [Google Scholar]
  • 17.Genigeorgis, C. A. 1985. Microbial and safety implications of the use of modified atmospheres to extend the storage life of fresh meat and fish. Int. J. Food Microbiol. 1:237-251. [Google Scholar]
  • 18.Gibson, A. M., R. C. Ellis-Brownlee, M. E. Cahill, E. A. Szabo, G. C. Fletcher, and P. J. Bremer. 2000. The effect of 100% CO2 on the growth of nonproteolytic Clostridium botulinum at chill temperatures. Int. J. Food Microbiol. 54:39-48. [DOI] [PubMed] [Google Scholar]
  • 19.Graham, A. F., D. R. Mason, F. J. Maxwell, and M. W. Peck. 1997. Effect of pH and NaCl on growth from spores of non-proteolytic Clostridium botulinum at chill temperature. Lett. Appl. Microbiol. 24:95-100. [DOI] [PubMed] [Google Scholar]
  • 20.Hoffmaster, A. R., and T. M. Koehler. 1997. The anthrax toxin activator gene atxA is associated with CO2-enhanced non-toxin gene expression in Bacillus anthracis. Infect. Immun. 65:3091-3099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Johnson, E. A., and M. Bradshaw. 2001. Clostridium botulinum and its neurotoxins: a metabolic and cellular perspective. Toxicon 39:1703-1722. [DOI] [PubMed] [Google Scholar]
  • 22.Korkeala, H., G. Stengel, E. Hyytiä, B. Vogelsang, A. Bohl, H. Wihlman, P. Pakkala, and S. Hielm. 1998. Type E botulism associated with vacuum-packaged hot-smoked whitefish. Int. J. Food Microbiol. 43:1-5. [DOI] [PubMed] [Google Scholar]
  • 23.Kouguchi, H., T. Suzuki, K. Hasegawa, S. Mutoh, T. Watanabe, K. Niwa, T. Yoneyama, Y. Katoh, and T. Ohyama. 2006. Quantitative detection of gene expression and toxin complex produced by Clostridium botulinum serotype D strain 4947. J. Microbiol. Methods 67:416-423. [DOI] [PubMed] [Google Scholar]
  • 24.Li, B., X. Qian, H. K. Sarkar, and B. R. Singh. 1998. Molecular characterization of type E Clostridium botulinum and comparison to other types of Clostridium botulinum. Biochim. Biophys. Acta 1395:21-27. [PubMed] [Google Scholar]
  • 25.Lindström, M., M. Vuorela, K. Hinderink, H. Korkeala, E. Dahlsten, M. Raahenmaa, and M. Kuusi. 2006. Botulism associated with vacuum-packed smoked whitefish in Finland, June-July 2006. Euro. Surveill. 11:E060720.3. [DOI] [PubMed] [Google Scholar]
  • 26.Lund, B. M., and M. W. Peck. 2000. Clostridium botulinum, p. 1057-1109. In B. M. Lund, T. C. Baird-Parker, and G. W. Gould (ed.), The microbiological safety and quality of food. Aspen, Gaithersburg, MD.
  • 27.Lövenklev, M., I. Artin, O. Hagberg, E. Borch, E. Holst, and P. Rådström. 2004. Quantitative interaction effects of carbon dioxide, sodium chloride, and sodium nitrite on neurotoxin gene expression in nonproteolytic Clostridium botulinum type B. Appl. Environ. Microbiol. 70:2928-2934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lövenklev, M., E. Holst, E. Borch, and P. Rådström. 2004. Relative neurotoxin gene expression in Clostridium botulinum type B, determined using quantitative reverse transcription-PCR. Appl. Environ. Microbiol. 70:2919-2927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.McGrath, S., J. S. Dooley, and R. W. Haylock. 2000. Quantification of Clostridium botulinum toxin gene expression by competitive reverse transcription-PCR. Appl. Environ. Microbiol. 66:1423-1428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Moncrief, J. S., L. A. Barroso, and T. D. Wilkins. 1997. Positive regulation of Clostridium difficile toxins. Infect. Immun. 65:1105-1108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Peck, M. W. 2006. Clostridium botulinum and the safety of minimally heated, chilled foods: an emerging issue? J. Appl. Microbiol. 101:556-570. [DOI] [PubMed] [Google Scholar]
  • 32.Peck, M. W., and S. C. Stringer. 2005. The safety of pasteurised in-pack chilled meat products with respect to the foodborne botulism hazard. Meat Sci. 70:461-476. [DOI] [PubMed] [Google Scholar]
  • 33.Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:E45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Proulx, J. F., V. Milor-Roy, and J. Austin. 1997. Four outbreaks of botulism in Ungava Bay, Nunavik, Quebec. Can. Commun. Dis. Rep. 23:30-32. [PubMed] [Google Scholar]
  • 35.Putzer, H., N. Gendron, and M. Grunberg-Manago. 1992. Co-ordinate expression of the two threonyl-tRNA synthetase genes in Bacillus subtilis: control by transcriptional antitermination involving a conserved regulatory sequence. EMBO J. 11:3117-3127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Raffestin, S., J. C. Marvaud, R. Cerrato, B. Dupuy, and M. R. Popoff. 2004. Organization and regulation of the neurotoxin genes in Clostridium botulinum and Clostridium tetani. Anaerobe 10:93-100. [DOI] [PubMed] [Google Scholar]
  • 37.Rao, S., R. L. Starr, M. G. Morris, and W. J. Lin. 2007. Variations in expression and release of botulinum neurotoxin in Clostridium botulinum type A strains. Foodborne Pathog. Dis. 4:201-207. [DOI] [PubMed] [Google Scholar]
  • 38.Ross, R. A., and A. B. Onderdonk. 2000. Production of toxic shock syndrome toxin 1 by Staphylococcus aureus requires both oxygen and carbon dioxide. Infect. Immun. 68:5205-5209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Sharkey, F. H., J. S. Dooley, and R. W. Haylock. 2005. Quantitative effects of carbohydrates and aromatic amino acids on Clostridium botulinum toxin gene expression using a rapid competitive RT/PCR assay. J. Mol. Microbiol. Biotechnol. 9:35-43. [DOI] [PubMed] [Google Scholar]
  • 40.Sharkey, F. H., S. I. Markos, and R. W. Haylock. 2004. Quantification of toxin-encoding mRNA from Clostridium botulinum type E in media containing sorbic acid or sodium nitrite by competitive RT-PCR. FEMS Microbiol. Lett. 232:139-144. [DOI] [PubMed] [Google Scholar]
  • 41.Shimamura, T., S. Watanabe, and S. Sasaki. 1985. Enhancement of enterotoxin production by carbon dioxide in Vibrio cholerae. Infect. Immun. 49:455-456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Shin, N. R., J. H. Shin, J. H. Chun, S. Y. Yoon, B. S. Kim, H. B. Oh, and G. E. Rhie. 2006. Determination of neurotoxin gene expression in Clostridium botulinum type A by quantitative RT-PCR. Mol. Cells 22:336-342. [PubMed] [Google Scholar]
  • 43.Stretton, S., and A. E. Goodman. 1998. Carbon dioxide as a regulator of gene expression in microorganisms. Antonie van Leeuwenhoek 73:79-85. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES