Abstract
Here we present direct evidence for the vital role of RecO in Deinococcus radiodurans's radioresistance. A recO null mutant was constructed using a deletion replacement method. The mutant exhibited a growth defect and extreme sensitivity to irradiation with gamma rays and UV light. These results suggest that DNA repair in this organism occurs mainly via the RecF pathway.
Deinococcus radiodurans is best known for its astonishing ability to resist the lethal effects of many DNA-damaging agents, including ionizing radiation, UV, hydrogen peroxide, and desiccation (1, 2, 24, 32). This striking feature is due to its extraordinary ability for DNA repair: it can reconstruct a functional chromosome from hundreds of shattered DNA fragments within hours (24). It is believed that RecA-dependent homologous recombination DNA repair plays a vital role in the genome restitution of this organism (3), although DNA repair via RecA-independent pathways is also reported to take part in genome restitution (5, 17, 26, 29, 34).
Escherichia coli and many other bacteria possess two RecA-dependent recombinational systems: the RecBCD and RecF pathways (18). These two pathways normally operate independently of each other and have different functions in vivo: RecBCD is the predominant recombination pathway and is responsible for double-strand break repair, while the RecF pathway is involved mainly in the repair of single-stranded gaps. Mutation in the recBC genes results in the sensitivity of E. coli cells to various DNA-damaging agents, unless the cells acquire mutations in the sbcA, sbcB, and sbcC/sbcD genes. The RecF pathway becomes active in this situation. Whereas the RecF pathway is encoded more frequently in the bacterial genome, RecBCD is absent from many bacteria (28). D. radiodurans is one of them: orthologous genes of neither recBC nor addAB (recBCD orthologues in Bacillus subtilis) are present in its genome (22, 33), suggesting that the RecBCD pathway is absent in this organism. In contrast, the genes coding for the RecF pathway, such as recA, recF, recJ, recN, recO, recQ, recR, ssb, ruvA, ruvB, and ruvC, are present in the D. radiodurans genome. Moreover, the sbcA and sbcB genes are absent. The expression of E. coli exonuclease I (25) or recBC (11) in D. radiodurans causes the cells to be more sensitive to gamma radiation. Presumably, the RecF pathway plays a substantial role in the reconstitution of the D. radiodurans genome and DNA repair. Genetic studies have confirmed the importance of several RecF pathway genes in D. radiodurans. The deletion of recN (6) and recQ (10) and the mutation of ruvB (14) result in the increased radiosensitivity of the mutant bacteria. The functions and structures of the pathway proteins RecA (12, 13, 27), RecF (16), RecO (21, 23, 31), RecR (19, 20, 31), and RecQ (9) were also investigated. However, little in vivo evidence has been presented to date for the roles of the unique genes recF, recO, and recR of the RecF pathway in D. radiodurans's radioresistance. Only a recR (15) partial deletion mutant, with a 27-amino-acid substitution at the C-terminal region, was reported to be extremely sensitive to cross-linking reagents like mitomycin C but remains resistant to ionizing radiation. Considering that it is a partial deletion mutant, it is possible that this recR mutant maintains some degree of activity. The roles of the RecF pathway in D. radiodurans's radioresistance still need to be addressed experimentally. Here, we have successfully constructed a recO null mutant and the mutant phenotypes have been characterized.
Construction of a D. radiodurans recO null mutant.
The bacterial strains and plasmids used in this study are shown in Table 1, and the primers used in this study are shown in Table 2. Disruption of the D. radiodurans recO gene (recODr) was performed using a deletion replacement method as described previously (9). The construction strategy for recO::aadA is shown in Fig. 1A. The streptomycin resistance gene (kat-aadA) was obtained from the pkat-aadA plasmid (30), which was digested with HindIII and BamHI. A 543-bp DNA fragment corresponding to the immediate upstream portion of the dr0819 (recODr) initial codon was amplified using primers MO1 and MO2 containing a BamHI restriction site, and a 629-bp DNA fragment corresponding to the immediate downstream region of the dr0819 (recODr) stop codon was amplified using primers MO3 (containing a HindIII restriction site) and MO4. The PCR products were digested with BamHI or HindIII and then ligated to a kat-aadA cassette. The tripartite ligation products were amplified using MO1 and MO4, and the resulting fragments were transformed into D. radiodurans R1 as described previously (8). The recO::aadA mutant strain was selected on TGY (0.5% tryptone, 0.1% glucose, 0.3% yeast extract) agar containing 8 μg/ml streptomycin. Mutants were confirmed by PCR using primers MO5 and MO6 and sequenced. A 998-bp DNA fragment corresponding to intact dr0819 was the only product produced when the wild-type strain R1 chromosomal DNA was used as the template. In contrast, an approximately 1,181-bp product was obtained using genomic DNA isolated from streptomycin-resistant colonies. The 998-bp DNA fragment corresponding to intact dr0819 was not observed in streptomycin-resistant colonies, indicating that the strain was homozygous for the aadA gene, displacing recO in streptomycin-resistant colonies (Fig. 1B). The resulting recO null mutant was designated MOA.
TABLE 1.
Bacterial strains and plasmids
| Strain or plasmid | Relevant marker | Reference or resource |
|---|---|---|
| Strains | ||
| E. coli DH5α | hsdR17 recA1 endA1 lacZΔM15 | Invitrogen |
| D. radiodurans | ||
| R1 | ATCC 13939 | |
| MOA | As R1 but recO::aadA | This study |
| MOA-D | As MOA recO::aadA (pDO recODr+) | This study |
| MOA-E | As MOA recO::aadA (pEO recOEc+) | This study |
| TNK106 | As R1 but recA::cam | 29 |
| Plasmids | ||
| pMD18-T | TA cloning vector | Takara |
| pRADK | E. coli-D. radiodurans shuttle vector carrying D. radiodurans groEL promoter | 9 |
| pEO | pRADK derivative expressing D. radiodurans recO | This study |
| pDO | pRADK derivative expressing E. coli recO | This study |
TABLE 2.
Primers used in this study
| Primer | Sequence (5′-3′)a |
|---|---|
| MO1 | MGATTCAATCGGAATTTGTCTTACT |
| MO2 | CGCGGATCCGACGTGAGTCTAGAGAAAGA |
| MO3 | CCCAAGCTTAGCATTTGACAAAAGAATGG |
| MO4 | GCACGCGGGCCGAAATCATCCGTTT |
| MO5 | GGAAGCGAGTCACAGACCCTC |
| MO6 | GGATTTGAGGTCTGCCAGTTGA |
| DOF | CACCATATGCGCTCACGCACCGCCA |
| DOR | GAGGGATCCTGCCGTGAAGAAGTCCAAG |
| EOF | ACTCATATGGAAGGCTGGCAGCGCGCAT |
| EOR | TTCACGTAAATGCACGGTAAT |
Underlining indicates restriction sites.
FIG. 1.
recO mutant construction and verification by PCR. (A) Schematic of the construction of the recO deletion mutation. The map of recO in the D. radiodurans chromosome (top) and recO after disruption by its replacement with a streptomycin resistance cassette (bottom) are shown. (B) Ethidium bromide-stained agarose gel illustrating that the mutant carries a homozygous deletion of dr0819::aadA. Lane 1, R1; lane 2, MOA; lane 3, DNA marker.
Disruption of the recO gene of D. radiodurans results in a growth defect.
The influence of recO disruption on the growth rate was evaluated. The wild-type strain R1, the recO mutant MOA, and the recA mutant TNK106 (7) cells were grown overnight (with streptomycin for MOA and with chloramphenicol for TNK106). Next, 500-μl cultures were diluted into 100 ml TGY broth without antibiotics and shaken at 30°C. Cell growth was monitored using a spectrophotometer at 3-h intervals. As shown in Fig. 2, MOA exhibited a severe growth defect compared with the growth of its parent strain, R1; however, the growth rate of MOA was similar to that of TNK106, a recA mutant, indicating that recO is essential for cell viability, just as recA is.
FIG. 2.
Growth curves of wild-type R1 (triangles), TNK106 (recA mutant) (squares), and MOA (circles). The optical densities at 600 nm (OD600) are the means ± standard deviations from four independent experiments.
Disruption of the recO gene of D. radiodurans sensitizes this strain to DNA-damaging agents.
Since RecO plays an important role in DNA repair, the influence of a recO mutation on the sensitivity of D. radiodurans to UV and gamma radiation was investigated. Cells for each assay were grown in TGY broth with the appropriate antibiotics to exponential phase (optical density at 600 nm, 0.4 to 0.6). For gamma irradiation, cultures were diluted to an appropriate concentration in 1.5-ml tubes and irradiated on ice with different doses for 1 h. For UV exposure, appropriate cells were plated onto TGY agar. After the medium was completely absorbed, the plates were exposed to UV at the dose rate of 1.0 J/cm2/s. Irradiated and mock-irradiated cultures were diluted to appropriate concentrations and spread onto TGY agar plates without antibiotics. Colonies were counted after incubation at 30°C for 3 to 4 days.
Disruption of recO resulted in a dramatic sensitivity to UV and gamma radiation, which was of the same order of magnitude as that observed for the recA mutant (Fig. 3A and B). A dose of 50 J/m2 of UV radiation or 200 Gy gamma radiation was sufficient to kill 90% of MOA cells, indicating that recO is essential for UV and gamma radiation resistance.
FIG. 3.
Survival curves for R1 (triangles), TNK106 (squares), and MOA (circles) and its complementary strains MOA-D (inverted triangles) and MOA-E (diamonds) following exposure to UV (A and C) and gamma (B and D) radiation. The values are the means ± standard deviations from four independent experiments.
RecOEc only partially restores MOA gamma radiation resistance.
In an effort to identify the gene responsible for the sensitivity to DNA-damaging reagents as a result of the disruption of strain MOA, a complementation plasmid with a complete recO gene from D. radiodurans or E. coli (recOEc) was introduced into the disruptant. The clones capable of restoring the disruptant's ability to resist UV and gamma irradiation damage were screened.
The complete D. radiodurans recO coding sequence was amplified from the genomic DNA of wild-type strain R1 using primers DOF and DOR. The fragment was inserted into the pRADK plasmid, which was digested with the same enzymes. The newly constructed plasmid was designated pDO. The E. coli recO complementary plasmid pEO was constructed like pDO was, except that the gene was amplified using primers EOF and EOR and that E. coli DH5α genomic DNA was used as the template. The resulting complementary plasmids were confirmed by sequencing. The plasmids were transformed into MOA, and the constructs were selected on TGY agar containing 8 μg/ml streptomycin and 3 μg/ml chloramphenicol. The resulting constructs were designated MOA-D (complementation with pDO) and MOA-E (complementation with pEO).
The sensitivities of these strains to UV and gamma irradiation were then examined. As shown in Fig. 3C and D, the MOA-D strain was as resistant to UV and gamma irradiation as wild-type R1, a further confirmation that the sensitivity phenotype of MOA was caused by the disruption of recO but not by the polar effect of gene replacement, which might affect the expression of upstream and/or downstream genes. The pEO construct fully restored MOA's UV resistance, while it only partially compensated the gamma radiation sensitivity phenotype of the mutant strain. Two possible explanations exist: (i) the expression of recOEc did not occur in D. radiodurans, and (ii) RecODr has species-specific features. Since recOEc can fully restore MOA's UV resistance, we consider the first possibility unlikely. RecODr and RecOEc show low homology at the sequence level (4), and RecODr possesses a Zn domain within the C terminus which is absent from RecOEc. Biochemical studies revealed (21) that the Zn domain of RecODr modulates its DNA binding activity. Furthermore, gamma radiation generates more types of DNA lesions than UV radiation (4). We hypothesize that some DNA lesions, those only generated in response to ionizing radiation, may require the species-specific features of recODr. However, further experiments are needed to confirm the species-specific features of RecODr.
Here we reported the first evidence of the vital role of recO in D. radiodurans's radioresistance. A D. radiodurans recO null mutant was constructed, and it demonstrated recA mutant-like phenotypes: slow growth and extreme sensitivity to gamma and UV radiation. This work provides useful insight into the DNA repair mechanisms exhibited by D. radiodurans.
Acknowledgments
We thank John R. Battista (Department of Biological Sciences, Louisiana State University and A & M College) for providing the TNK106 strain and Junjie Fu, Xiaojun Zhao, and Zhiming Sun (Radiation Center of Zhejiang University) for their assistance with the radiation treatment.
This work was supported by a grant from the National Basic Research Program of China (2004 CB 19604), a grant from the National Hi-Tech Development Program (2007AA021305), a grant for Distinguished Young Scientist of China (30425038), and a key project from the National Natural Science Foundation of China (30330020) to Y.H.
This article is dedicated to the 50th anniversary of the Institute of Nuclear-Agricultural Sciences, Zhejiang University.
Footnotes
Published ahead of print on 25 January 2008.
REFERENCES
- 1.Battista, J. R. 1997. Against all odds: the survival strategies of Deinococcus radiodurans. Annu. Rev. Microbiol. 51203-224. [DOI] [PubMed] [Google Scholar]
- 2.Battista, J. R., A. M. Earl, and M. J. Park. 1999. Why is Deinococcus radiodurans so resistant to ionizing radiation? Trends Microbiol. 7362-365. [DOI] [PubMed] [Google Scholar]
- 3.Cox, M. M. 2007. Regulation of bacterial RecA protein function. Crit. Rev. Biochem. Mol. Biol. 4241-63. [DOI] [PubMed] [Google Scholar]
- 4.Cox, M. M., and J. R. Battista. 2005. Deinococcus radiodurans—the consummate survivor. Nat. Rev. Microbiol. 3882-892. [DOI] [PubMed] [Google Scholar]
- 5.Daly, M. J., L. Ouyang, P. Fuchs, and K. W. Minton. 1994. In vivo damage and recA-dependent repair of plasmid and chromosomal DNA in the radiation-resistant bacterium Deinococcus radiodurans. J. Bacteriol. 1763508-3517. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Funayama, T., I. Narumi, M. Kikuchi, S. Kitayama, H. Watanabe, and K. Yamamoto. 1999. Identification and disruption analysis of the recN gene in the extremely radioresistant bacterium Deinococcus radiodurans. Mutat. Res. 435151-161. [DOI] [PubMed] [Google Scholar]
- 7.Harris, D. R., M. Tanaka, S. V. Saveliev, E. Jolivet, A. M. Earl, M. M. Cox, and J. R. Battista. 2004. Preserving genome integrity: the DdrA protein of Deinococcus radiodurans R1. PLoS Biol. 2e304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hua, Y., I. Narumi, G. Gao, B. Tian, K. Satoh, S. Kitayama, and B. Shen. 2003. PprI: a general switch responsible for extreme radioresistance of Deinococcus radiodurans. Biochem. Biophys. Res. Commun. 306354-360. [DOI] [PubMed] [Google Scholar]
- 9.Huang, L., X. Hua, H. Lu, G. Gao, B. Tian, B. Shen, and Y. Hua. 2007. Three tandem HRDC domains have synergistic effect on the RecQ functions in Deinococcus radiodurans. DNA Repair 6167-176. [DOI] [PubMed] [Google Scholar]
- 10.Huang, L. F., S. W. Zhang, X. T. Hua, G. J. Gao, and Y. J. Hua. 2006. Construction of the recQ double mutants and analysis of adversity in Deinococcus radiodurans. Wei Sheng Wu Xue Bao 46205-209. (In Chinese.) [PubMed] [Google Scholar]
- 11.Khairnar, N. P., V. A. Kamble, and H. S. Misra. 2007. RecBC enzyme overproduction affects UV and gamma radiation survival of Deinococcus radiodurans. DNA Repair 740-47. [DOI] [PubMed] [Google Scholar]
- 12.Kim, J. I., and M. M. Cox. 2002. The RecA proteins of Deinococcus radiodurans and Escherichia coli promote DNA strand exchange via inverse pathways. Proc. Natl. Acad. Sci. USA 997917-7921. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kim, J.-I., A. K. Sharma, S. N. Abbott, E. A. Wood, D. W. Dwyer, A. Jambura, K. W. Minton, R. B. Inman, M. J. Daly, and M. M. Cox. 2002. RecA protein from the extremely radioresistant bacterium Deinococcus radiodurans: expression, purification, and characterization. J. Bacteriol. 1841649-1660. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kitayama, S., M. Kohoroku, A. Takagi, and H. Itoh. 1997. Mutation of D. radiodurans in a gene homologous to ruvB of E. coli. Mutat. Res. 385151-157. [DOI] [PubMed] [Google Scholar]
- 15.Kitayama, S., I. Narumi, M. Kikuchi, and H. Watanabe. 2000. Mutation in recR gene of Deinococcus radiodurans and possible involvement of its product in the repair of DNA interstrand cross-links. Mutat. Res. 461179-187. [DOI] [PubMed] [Google Scholar]
- 16.Koroleva, O., N. Makharashvili, C. T. Courcelle, J. Courcelle, and S. Korolev. 2007. Structural conservation of RecF and Rad50: implications for DNA recognition and RecF function. EMBO J. 26867-877. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kota, S., and H. S. Misra. 2006. PprA: a protein implicated in radioresistance of Deinococcus radiodurans stimulates catalase activity in Escherichia coli. Appl. Microbiol. Biotechnol. 72790-796. [DOI] [PubMed] [Google Scholar]
- 18.Kowalczykowski, S. C., D. A. Dixon, A. K. Eggleston, S. D. Lauder, and W. M. Rehrauer. 1994. Biochemistry of homologous recombination in Escherichia coli. Microbiol. Rev. 58401-465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Lee, B. I., K. H. Kim, S. J. Park, S. H. Eom, H. K. Song, and S. W. Suh. 2004. Ring-shaped architecture of RecR: implications for its role in homologous recombinational DNA repair. EMBO J. 232029-2038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Lee, B. I., K. H. Kim, S. M. Shim, K. S. Ha, J. K. Yang, H. J. Yoon, J. Y. Ha, and S. W. Suh. 2004. Crystallization and preliminary X-ray crystallographic analysis of the RecR protein from Deinococcus radiodurans, a member of the RecFOR DNA-repair pathway. Acta Crystallogr. D 60379-381. [DOI] [PubMed] [Google Scholar]
- 21.Leiros, I., J. Timmins, D. R. Hall, and S. McSweeney. 2005. Crystal structure and DNA-binding analysis of RecO from Deinococcus radiodurans. EMBO J. 24906-918. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Makarova, K. S., L. Aravind, Y. I. Wolf, R. L. Tatusov, K. W. Minton, E. V. Koonin, and M. J. Daly. 2001. Genome of the extremely radiation-resistant bacterium Deinococcus radiodurans viewed from the perspective of comparative genomics. Microbiol. Mol. Biol. Rev. 6544-79. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Makharashvili, N., O. Koroleva, S. Bera, D. P. Grandgenett, and S. Korolev. 2004. A novel structure of DNA repair protein RecO from Deinococcus radiodurans. Structure 121881-1889. [DOI] [PubMed] [Google Scholar]
- 24.Minton, K. W. 1994. DNA repair in the extremely radioresistant bacterium Deinococcus radiodurans. Mol. Microbiol. 139-15. [DOI] [PubMed] [Google Scholar]
- 25.Misra, H. S., N. P. Khairnar, S. Kota, S. Shrivastava, V. P. Joshi, and S. K. Apte. 2006. An exonuclease I-sensitive DNA repair pathway in Deinococcus radiodurans: a major determinant of radiation resistance. Mol. Microbiol. 591308-1316. [DOI] [PubMed] [Google Scholar]
- 26.Narumi, I., K. Satoh, S. Cui, T. Funayama, S. Kitayama, and H. Watanabe. 2004. PprA: a novel protein from Deinococcus radiodurans that stimulates DNA ligation. Mol. Microbiol. 54278-285. [DOI] [PubMed] [Google Scholar]
- 27.Rajan, R., and C. E. Bell. 2004. Crystal structure of RecA from Deinococcus radiodurans: insights into the structural basis of extreme radioresistance. J. Mol. Biol. 344951-963. [DOI] [PubMed] [Google Scholar]
- 28.Rocha, E. P., E. Cornet, and B. Michel. 2005. Comparative and evolutionary analysis of the bacterial homologous recombination systems. PLoS Genet. 1e15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Tanaka, M., A. M. Earl, H. A. Howell, M. J. Park, J. A. Eisen, S. N. Peterson, and J. R. Battista. 2004. Analysis of Deinococcus radiodurans's transcriptional response to ionizing radiation and desiccation reveals novel proteins that contribute to extreme radioresistance. Genetics 16821-33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Tanaka, M., I. Narumi, T. Funayama, M. Kikuchi, H. Watanabe, T. Matsunaga, O. Nikaido, and K. Yamamoto. 2005. Characterization of pathways dependent on the uvsE, uvrA1, or uvrA2 gene product for UV resistance in Deinococcus radiodurans. J. Bacteriol. 1873693-3697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Timmins, J., I. Leiros, and S. McSweeney. 2007. Crystal structure and mutational study of RecOR provide insight into its mode of DNA binding. EMBO J. 263260-3271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Wang, P., and H. E. Schellhorn. 1995. Induction of resistance to hydrogen peroxide and radiation in Deinococcus radiodurans. Can. J. Microbiol. 41170-176. [DOI] [PubMed] [Google Scholar]
- 33.White, O., J. A. Eisen, J. F. Heidelberg, E. K. Hickey, J. D. Peterson, R. J. Dodson, D. H. Haft, M. L. Gwinn, W. C. Nelson, D. L. Richardson, K. S. Moffat, H. Qin, L. Jiang, W. Pamphile, M. Crosby, M. Shen, J. J. Vamathevan, P. Lam, L. McDonald, T. Utterback, C. Zalewski, K. S. Makarova, L. Aravind, M. J. Daly, K. W. Minton, R. D. Fleischmann, K. A. Ketchum, K. E. Nelson, S. Salzberg, H. O. Smith, J. C. Venter, and C. M. Fraser. 1999. Genome sequence of the radioresistant bacterium Deinococcus radiodurans R1. Science 2861571-1577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Zahradka, K., D. Slade, A. Bailone, S. Sommer, D. Averbeck, M. Petranovic, A. B. Lindner, and M. Radman. 2006. Reassembly of shattered chromosomes in Deinococcus radiodurans. Nature 443569-573. [DOI] [PubMed] [Google Scholar]



