Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 1997 Aug 5;94(16):8720–8725. doi: 10.1073/pnas.94.16.8720

Abrogation of the alternative complement pathway by targeted deletion of murine factor B

Mitsuru Matsumoto *,†,‡,§, Wataru Fukuda †,‡, Antonella Circolo †, Joseph Goellner , Jena Strauss-Schoenberger , Xuefeng Wang †, Shigeru Fujita ‖, Tunde Hidvegi †, David D Chaplin *,‡,**, Harvey R Colten †,‡‡
PMCID: PMC23097  PMID: 9238044

Abstract

To investigate the role of complement protein factor B (Bf) and alternative pathway activity in vivo, and to test the hypothesized potential genetic lethal effect of Bf deficiency, the murine Bf gene was interrupted by exchange of exon 3 through exon 7 (including the factor D cleaving site) with the neor gene. Mice heterozygous for the targeted Bf allele were interbred, yielding Bf-deficient offspring after the F1 generation at a frequency suggesting that Bf deficiency alone has no major effect on fertility or fetal development. However, in the context of one or more genes derived from the 129 mouse strain, offspring homozygous for Bf deficiency were generated at less than expected numbers (P = 0.012). Bf-deficient mice showed no gross phenotypic difference from wild-type littermates. Sera from Bf-deficient mice lacked detectable alternative complement pathway activity; purified mouse Bf overcame the deficit. Classical pathway-dependent total hemolytic activity was lower in Bf-deficient than wild-type mice, possibly reflecting loss of the alternative pathway amplification loop. Lymphoid organ structure and IgG1 antibody response to a T-dependent antigen appeared normal in Bf-deficient mice. Sensitivity to lethal endotoxic shock was not significantly altered in Bf-deficient mice. Thus, deficiency of Bf and alternative complement activation pathway led to a less dramatic phenotype than expected. Nevertheless, these mice provide an excellent model for the assessment of the role of Bf and the alternative pathway in host defense and other functions in vivo.


The alternative pathway of complement activation provides a mechanism for defense against infectious agents. Because the alternative pathway is activated in the absence of specific antibody, it provides an immediately available line of defense that does not require prior exposure to a specific microorganism, though specific antibody may also contribute to alternative pathway-mediated defenses (1, 2).

Factor B (Bf), a 93-kDa single-chain glycoprotein, is required for the initiation and propagation of alternative pathway activation. When Bf associates with a cleavage product of complement protein C3 (C3b) it is cleaved by factor D, releasing a 33-kDa amino-terminal fragment (Ba), and the bound 63-kDa carboxyl-terminal serine proteinase (Bb). Because C3 is a component of the C3bBb enzyme as well as its substrate, this pathway serves as a positive amplification loop for both pathways of complement activation (3). Bf is synthesized in liver (4) and at extrahepatic sites in endothelial, epithelial, and mesenchymal cells (5).

In addition to its role in activation of the alternative pathway, Bf is a cofactor in antibody-independent monocyte-mediated cytotoxicity (6), macrophage spreading (7), activation of plasminogen (8), and proliferation of B lymphocytes (9–11). All of these Bf-dependent functions were demonstrated in vitro. Inferences regarding the essential actions of the alternative pathway and Bf in vivo have been based on evaluation of patients and experimental animals in which several of the alternative pathway proteins are reduced in concentration, including C3, the target of both classical and alternative complement activation systems. Hence, definitive information about the importance of alternative pathway functions has not been available. Genetic deficiencies of classical pathway complement proteins, on the other hand, provided important insights into the role of this pathway in immunopathology (reviewed in ref. 12).

One of the most common of the human genetic deficiencies of complement is deficiency of C2, a functional and structural homologue of Bf that is encoded by a gene ≈400 bp upstream of Bf within the class III region of the major histocompatibility complex. Homozygous C2 deficiency occurs at a high frequency among populations of Western European origin (13), but until a recent preliminary report (14), no homozygous Bf-deficient individuals had been recognized. On the basis of this and the apparent importance of the alternative pathway in host defenses, many suggested that Bf deficiency might be a genetic lethal. To test this hypothesis and to provide a model for evaluating the importance of the alternative pathway in vivo, we generated a Bf-null mouse by gene targeting.

We found that mice rendered deficient in Bf were viable and showed no gross phenotypic abnormalities in spite of the complete absence of alternative pathway function. However, Bf deficiency in the context of one or more other genes imposed a reproductive disadvantage. Lymphoid organ structure was overtly normal in Bf-deficient mice, and the T-dependent antigen response was indistinguishable from that of wild-type mice. Sensitivity to endotoxic shock was also unaltered. Thus, Bf-deficient mice showed less dramatic phenotypic changes than had been anticipated. Nevertheless, this Bf-deficient mouse strain provides an excellent model in which to study the role of Bf and the alternative pathway in systemic host responses.

MATERIALS AND METHODS

Bf Targeting Vector.

The Bf targeting vector was assembled by using fragments of the BALB/C cosmid clone D-9 (15) and the pBluescript KS (+) vector (Stratagene). A gel-purified 5.3-kb BamHI–EcoRI 5′ Bf fragment, a 5.5-kb HindIII–SacII 3′ Bf fragment, and a 1.8-kb EcoRI–HindIII fragment encoding neomycin resistance (neor) under control of the pgk promoter (16) were ligated together with BamHI–SacII-digested pBluescript KS (+). Subsequently, its 12.6-kb insert was excised from the vector and transferred into pBluescript KS (+) containing the gene encoding herpes simplex virus-thymidine kinase (HSV-tk) under the control of a polyomavirus promoter and enhancer (17). Plasmid DNA for electroporation was linearized by digestion with SalI.

Generation of Bf-Deficient Mice.

D3 (provided by T. Doetschman, University of Cincinnati, Cincinnati, OH) and J1 (provided by R. Jaenisch, Whitehead Institute for Biomedical Research, Cambridge, MA) embryonic stem (ES) cells were electroporated with the linearized Bf targeting vector as previously described (18). Homologous recombinants were selected using 250 μg/ml G418 (GIBCO/BRL) and 2 μM ganciclovir (Cytovene; Syntex Laboratories, Palo Alto, CA) and screened by Southern blotting using a 3′ Bf external probe (Fig. 1A, probe A). After targeted cells had been injected into C57BL/6 blastocysts, resulting chimeric male mice were mated to C57BL/6J females (The Jackson Laboratory), and germ-line transmission was established. Mice were maintained under specific pathogen-free (SPF) conditions. Eight- to 12-week-old mice were used.

Figure 1.

Figure 1

Targeted disruption of the gene encoding Bf in mice. (A) Black boxes = exons of the Bf and C2 genes. Factor D cleavage site in Bf exon 6 is shown by an open triangle. The locations of the 3′ external probe (probe A) and internal probe (probe B) are indicated. Restriction sites: B, BamHI; E, EcoRI, H, HindIII, S, SacII, R, EcoRV. For HindIII, only the site relevant to the construction of the targeting vector is shown. (B) Southern blot of genomic DNA from offspring of Bf+/− intercrosses. Tail DNA was digested with either EcoRI and EcoRV or BamHI and was hybridized with probe A or probe B. (C) Detection of Bf exon 6 by PCR. Oligonucleotide primers: GAGAACAGCAGAAGAGGAAGATTGTCCTAG and CTTCTCAATCAAGTTGGTGAGGCACCGCTT. Exon 6 sequences were not amplified in tail DNA of Bf−/− mice.

Northern Blotting.

Mice were injected i.p. with 10 μg of lipopolysaccharide (LPS; Escherichia coli O111:B4; Sigma) and sacrificed 24 h later. Total RNA was extracted from liver and kidney using guanidinium thiocyanate/CsCl density gradient ultracentrifugation as previously described (19). Poly(A)+ RNA was prepared using oligo(dT)-cellulose spin columns (CLONTECH). Hybridization was with 32P-labeled nearly full-length fragments of the mouse Bf or C2 cDNAs (20).

Metabolic Labeling and Immunoprecipitation.

Resident peritoneal macrophages were cultured overnight in RPMI medium 1640 (Life Technologies), containing 10% heat-inactivated fetal bovine serum (FBS) (Life Technologies) as previously described (21). The cells were washed, then incubated in methionine-free medium with [35S]methionine (ICN; specific activity 1,100 Ci/mmol; 1 Ci = 37 GBq) at 350 μCi/ml and dialyzed FBS for 6 h. Bf protein was detected in the cell lysates and culture medium by immunoprecipitation (21) with goat anti-human Bf polyclonal Ab (Quidel, San Diego).

Alternative Pathway Activation on Zymosan Particles.

C3 deposition on zymosan particles was assessed by using flow cytometry as described (22). Zymosan (Sigma) suspension was boiled and washed twice in gelatin/Veronal-buffered saline (GVBS) (23). Particles (1 × 106) and mouse sera (10 μl) in 100 μl of GVBS containing either 2 mM MgCl2 and 10 mM EGTA or 10 mM EDTA and were incubated at 37°C for 15 min. The particles were washed three times in phosphate-buffered saline, pH 7.4 (PBS) with 1% bovine serum albumin (BSA), cooled to 4°C, and incubated with fluorescein-conjugated IgG goat anti-mouse C3 fraction (Cappel Laboratories) at 4°C for 30 min. After three more washes, deposition of C3 was analyzed by FACScan (Becton Dickinson) with CELLQuest software.

Hemolytic Activity.

Alternative pathway. Serial dilutions of serum in Veronal/Mg/EGTA buffer with 0.1% gelatin were added to rabbit erythrocytes in microtiter plates and incubated 1 h at 39°C, and the extent of lysis was measured in an automated enzyme-linked immunosorbent assay (ELISA) reader at 405 nm, and AP50 units (50% lysis) were calculated (24).

Classical pathway.

Sheep red blood cells (SRBC) were sensitized with polyclonal mouse antiserum. Twenty microliters of mouse serum diluted in GVBS with 0.15 mM CaCl2 and 0.5 mM MgCl2 (GVBS2+) was incubated with 70 μl of sensitized SRBC suspension at 37°C for 90 min (25). Percent lysis and calculation of CH50 was performed according to standard methods (23).

Purification of Murine Bf.

Bf was purified from pooled normal mouse serum (Rockland, Gilbertsville, PA) according to a modification of the method of Williams and Sim (26). The supernatant, after precipitation with saturated ammonium sulfate (45%) and after addition of protease inhibitors (1 mM phenylmethanesulfonyl fluoride, 2 μM pepstatin, 3 μM leupeptin, 2 mM iodoacetamide) in 25 mM Tris⋅HCl buffer, pH 7.4, with 0.5 mM Mg2+, 0.5 mM Ca2+, and 25 mM sodium caproate was applied to a 5-ml HiTrap Blue column (Pharmacia). After elution with a linear 0–2 M KCl gradient, fractions containing Bf were pooled and dialyzed overnight at 4°C against 10 mM potassium phosphate/5 mM NaEDTA buffer (pH 7.0) and applied to a 5-ml HiTrap SP ion-exchange column (Pharmacia), equilibrated with the same buffer. Bf-containing fractions were eluted with a linear 0–1 M NaCl gradient and dialyzed against Veronal-buffered saline (pH 7.3) overnight, at 4°C. The Bf yield was about 22% of the original serum. The final product had a protein content of 35 μg/ml. On Western blots bands corresponding to 108 kDa (Bf), 68 kDa (Bb), and ≈35 kDa (Ba fragment of Bf) were seen. Approximately 30% of Bf was converted to Bb and Ba. Only one other protein band (with the approximate mobility of albumin in the starting serum) was observed in the final preparation.

Mouse Factor B ELISA.

Micro ELISA plates (Nunc MaxiSorp) were coated with 10 μg/ml antiserum to human Bf (Incstar) overnight at 4°C, blocked by PBS (pH 7.4, containing 2% nonfat dry milk and 15 mM NaN3). Samples were diluted in 50 mM sodium carbonate buffer (pH 9.7) 1/10 to 1/104. Then biotinylated anti-human Bf IgG fraction (Incstar) was used with streptavidin-peroxidase (Sigma, 1:1000) and o-phenylenediamine (Sigma) as substrate. Normal pooled mouse serum was used as a standard.

Flow Cytometric Analysis.

Flow cytometric analysis of spleen cells, thymocytes, and peritoneal exudate cells was performed as previously described (27), using anti-CD3ɛ (clone 145–2C11), anti-CD45R/B220, anti-CD4 (L3T4), and anti-CD8, all from PharMingen.

Immunohistochemistry.

Ten days after i.p. injection of 100 μl of a 10% SRBC suspension in PBS, spleens were harvested and frozen sections were stained with anti-complement receptor 1 (CR1) mAb (8C12) (28) or peanut agglutinin (PNA) (Vector Laboratories) and polyclonal rat anti-mouse IgD (Southern Biotechnology Associates, Birmingham, AL) as previously described (29).

Antigen-Specific Antibody Response.

Mice were immunized i.p. with 5 μg of (4-hydroxy-3-nitrophenyl)acetyl (NP)-ovalbumin adsorbed to alum. Twenty-one days later, the mice were boosted using the same dose of antigen in alum. Sera were harvested at days 10 and 28 after the initial immunization. Anti-NP IgG1s of low and high affinity were assessed by ELISA with NP13-BSA- and NP2.5-BSA-coated plates, respectively (29). Mice were immunized i.v. with 1 × 106 SRBC per mouse and the response was analyzed by hemolytic plaque assay on days 5 and 13. Cobra venum factor was given 24 h before immunization in selected experiments.

Endotoxic Shock.

Shock was induced by i.p. injection of 0.75 or 1.0 mg of LPS (Salmonella typhosa 0901; Difco) in 200 μl of sterile PBS. Lethality was assessed 3 days later. Mice that survived at day 3 were observed for 1 week and appeared to recover completely.

RESULTS AND DISCUSSION

Generation of Bf-Deficient Mice.

The Bf gene was disrupted by replacing a segment from the EcoRI site in exon 3 through exon 7 by the neor gene (Fig. 1A). This site for targeting was chosen to avoid compromising C2 expression (the 3′ end of the C2 gene overlaps Bf promoter elements and is only ≈100 bp upstream of the most 5′ transcriptional Bf start site) and the deletion encompasses exon 6, which encodes the factor D cleavage site necessary for Bf activation. Homologous recombinants were obtained at a frequency of 1 of 30 doubly drug-resistant colonies for both D3 and J1 cell lines. Germ-line transmission was obtained with one D3 and one J1 targeted line. Heterozygous deficient mice were crossed to obtain homozygous Bf-deficient offspring. The Bf targeted allele was demonstrated by the presence of a 7.7-kb EcoRV–EcoRI fragment and a 6.6-kb BamHI fragment detected by 3′ Bf and C2 cDNA probes, respectively (Fig. 1B). Hybridization with a neor probe confirmed a single integration event (data not shown). Exon 6 sequences were not amplified from homozygous deficient mice (Fig. 1C).

Bf Expression.

Targeted disruption of the Bf gene was confirmed by Northern blotting and by studies of Bf synthesis in cell culture. Poly(A)+ RNA from liver of wild-type mice showed the normal Bf transcript (Fig. 2A). Bf-deficient liver showed no detectable intact Bf transcript, but did show a 1.6-kb band. This truncated transcript was detected with Bf cDNA probes encompassing sequences either 5′ or 3′ of the deleted segment. No neor signal was detected in the truncated transcript (data not shown), suggesting that neor is spliced out of the targeted transcript. Using oligonucleotides for exon 2 (5′-GATTGTCCAGAAGGCGG-3′) and 10 (5′-TTCACGGAGTCCACCAG-3′), reverse transcription–PCR amplification and sequencing of the truncated Bf mRNA from Bf−/− mouse liver revealed a deletion of exons 3–7 with in-frame splicing of exon 2 and 8. This mRNA in the Bf−/− mice is therefore capable of generating the truncated Bf protein observed in cell culture (see Fig. 3). Ala-97 is replaced by Asp because the codon G/CA at the exon 2–3 junction is replaced by G/AC at the new exon 2–8 junction in the truncated Bf. When the same oligonucleotides were used, amplification of wild-type mRNA yielded only full-length Bf message. Similar truncated transcripts have been observed in other targeted gene deletions (30). Bf+/− mice showed both intact and truncated Bf transcripts. C2 transcripts in the liver and kidney of LPS-stimulated Bf-deficient mice were similar in size and amount to those from wild-type mice (Fig. 2B), demonstrating no detectable effect on expression of the nearby C2 locus.

Figure 2.

Figure 2

Analysis of Bf and C2 transcripts in liver and kidney. (A) Poly(A)+ RNA from livers of LPS-stimulated mice hybridized with Bf cDNA. Upper arrow (→), 2.4-kb authentic Bf transcripts; lower arrow (⇐), 1.6-kb truncated Bf transcripts. (B) Liver and kidney total RNA hybridized with C2 cDNA.

Figure 3.

Figure 3

Biosynthesis of Bf in peritoneal macrophages. (Left) Macrophages from Bf−/− mice did not synthesize or secrete any detectable intact Bf protein (→) but showed small amounts of a truncated intracellular Bf-related protein (⇒). (Right) Longer exposure. Bb (←) was detected in Bf+/+ and Bf+/− cultures, but not Bf−/−. A small amount of a truncated Bf-related protein (⇐) was detected in the extracellular fraction from Bf+/− and Bf−/−.

Radiolabeled Bf protein and cleavage products of appropriate sizes were detected in wild-type macrophage cultures (Fig. 3). In Bf-deficient mice, no intact Bf protein was detected. However, small amounts of a truncated Bf protein (≈50 kDa) were found in cell lysate and media from Bf−/− macrophages. Bf+/− macrophages showed both intact and truncated Bf protein. Levels of the truncated transcript and protein were increased by treatment of the Bf-deficient mice with LPS (data not shown), consistent with transcription of the truncated transcript from the LPS-responsive Bf promoter.

Alternative Pathway Activity.

Three independent lines of evidence established that the sera of the Bf-deficient mice had no detectable Bf activity. Serum from wild-type mice deposited C3 on zymosan in Mg/EGTA buffer, whereas serum from Bf−/− mice showed no detectable C3 deposition (Fig. 4). Mixing Bf−/− with Bf+/+ serum did not inhibit alternative pathway activity in wild-type serum. Bf−/− failed to support in vitro cleavage of C3 by cobra venom factor (data not shown). Finally, alternative pathway-dependent hemolytic activity was undetectable in homozygous Bf-deficient serum, and purified Bf reconstituted the activity (normal AP50 = 224 units; Bf−/−, <10 units; Bf−/− reconstituted with purified mouse Bf, 200 units). Together, these findings demonstrate that targeting the Bf gene resulted in ablation of both functional Bf and alternative pathway activity.

Figure 4.

Figure 4

Absence of alternative pathway activation in Bf-deficient serum. Wild-type serum (b), Bf-deficient serum (d), and mixture of wild-type and Bf-deficient serum in equal proportions (c) were incubated with zymosan in Mg/EGTA. Alternative pathway activation was assessed by measuring C3 deposition on zymosan by flow cytometry. Bf-deficient serum did not show any detectable C3 deposition, similar to wild-type serum incubated with zymosan in EDTA (a).

Growth and Development of Bf-Deficient Mice.

Bf−/− mice grew normally and showed no gross phenotypic differences from their wild-type littermates. Although heterozygous matings in one mouse line, J24, produced homozygous deficient mice at a frequency of 1 in 4, matings of heterozygous animals from mouse line D68 produced fewer homozygous deficient mice than expected (P = 0.030) (Table 1). F1 heterozygous matings of the D68 strain showed even greater deviation from the predicted number of Bf−/− offspring (P = 0.012). These data suggest an effect on reproduction of Bf, together with one or more genes derived from the 129 strain which is/are lost by breeding of the Bf− locus into C57BL/6. Variable numbers of genes from 129 are contributed apparently randomly to each of the founders, so the difference between the D68 and J24 strains is not surprising. That this effect is specific for Bf and certain 129 gene(s) is also suggested by analysis of two other targeted deletions in D3 embryonic stem cells that showed no significant bias in genotype of the F1 heterozygous matings. Matings of homozygous males and heterozygous females or matings of homozygous females and heterozygous males produced appropriate numbers of offspring. Furthermore, live pups were obtained from crosses between male and female homozygous Bf-deficient mice for both the D68 and J24 mouse lines. These results suggest that Bf deficiency alone has no major effect on fertility or fetal development.

Table 1.

Genotype frequency: Offspring from heterozygous matings of Bf-deficient mice

Strain/generation n No. (frequency) with genotype
−/− +/− +/+
J24 45 11  (0.244) 23  (0.512) 11  (0.244)
D68 260 47  (0.181)* 138  (0.531) 75  (0.288)
 F1 125 17  (0.136)† 70  (0.560) 38  (0.304)
 ≥F2 160 38  (0.238)‡ 82  (0.513) 40  (0.250)

J24 is from J1 embryonic stem cells, and D68 is from D3 embryonic stem cells. Difference from expected analyzed by 1 × 3 χ2: ∗, P = 0.030; †, P = 0.012; ‡, not significant. 

Taken together, these data indicate that under unstressed conditions in specific pathogen-free animal quarters, homozygous deficiency of Bf alone and absence of alternative pathway function has no significant adverse effect on reproductive capacity and postnatal growth. This was surprising because of past predictions that homozygous Bf deficiency was likely to be a genetic lethal or at least impose a major selective disadvantage. That prediction was based on several considerations: (i) The alternative pathway provides innate host defense against certain microorganisms. Relative decreases in alternative pathway proteins, due to either developmental delay or hypercatabolism, result in increased susceptibility to infection (31, 32). Clearly the importance of complement and other innate host defenses could not be assessed from these earlier studies because the “relative deficiency” was not selective for Bf or the alternative complement activation pathway. The development of this Bf-deficient mouse strain will make it possible to directly test this question in the future. (ii) Studies of Bf expression suggested that Bf might be necessary for several nonimmune functions (33) that affect reproductive efficiency and/or optimum postnatal survival—i.e., that Bf has a major role in diverse functions of fat cells, uterine and renal epithelium, etc. At least under unstressed conditions, our data indicate that Bf is not absolutely required for these functions. However, thus far the results suggest a negative effect of Bf deficiency on reproduction in the context of gene(s) found in the 129 mouse strain. (iii) Genetic deficiency of C2 (C2D), the highly homologous Bf counterpart in the classical component pathway, is the most common deficiency of complement in populations of European origin (gene frequency of C2-null = 1–1.5%) (12, 13), but no instances of homozygous Bf deficiency in humans or other animal species had been reported.†† More than 93% of cases of C2 deficiency (type I) are due to a single mutation (a 28-bp deletion) found in the context of a specific major histocompatibility complex extended haplotype (34). Only three other C2 deficiency alleles in two kindred have been recognized (ref. 35; X.W., A.C., R.A.W., M.L., and H.R.C., unpublished data). Hence, the high frequency of C2 deficiency results from a founder effect for C2D type I in which a single mutation occurs within an HLA haplotype (that itself may confer selective advantage). A comparison of the frequencies of type II C2 deficiency with Bf deficiency would show that they do not differ significantly.

Total Hemolytic Activity.

Activation of the classical complement pathway generates C3b, which can serve either in the amplification of further C3 cleavage (by means of components of the alternative pathway) or as a constituent of the C5 cleaving enzyme, which in turn leads to assembly of the membrane attack complex (C5b–9) (5). To test the importance of this amplification loop in cytolysis, we measured total hemolytic complement activation (CH50) in wild-type and Bf−/− mouse sera from littermates. CH50 in Bf-deficient sera was 50% that in wild-type sera (Fig. 5). This reduction in CH50 was significant (P = 0.006) and not likely due to relative deficiencies of classical pathway constituents (C3 and C4 protein and C2 mRNA levels were similar in wild-type and Bf-deficient mice).

Figure 5.

Figure 5

Total hemolytic complement in the serum of Bf-deficient mice. Each symbol represents activity from an individual mouse. Horizontal bars indicate mean for each group; difference between means of +/+ and +/−, P = 0.46; between means of +/+ and −/−, P = 0.006. Addition of purified Bf (equal to 1.5 × normal mouse Bf plasma concentration) to each of two Bf−/− sera increased CH50 from 62% and 42% of mean to 85% and 78% of mean CH50, respectively.

Lymphoid Organ Development and Antibody Response.

Both Ba and Bb fragments have been implicated as modulators of the proliferation of B lymphocytes in vitro (9, 10, 36). To evaluate these activities of Bf in vivo, we examined the lymphoid compartment and humoral immune response in Bf-deficient mice. In Bf-deficient and wild-type mice numbers of peripheral blood lymphocytes and total serum IgM, IgG, and IgA were equivalent. Flow cytometric analysis showed similar expression of B220, CD3, CD4, and CD8 in spleen and thymus of Bf−/− and wild-type mice. Peritoneal B-1 cell population detected by CD5 mAb showed no phenotypic differences between wild-type and Bf−/− mice (data not shown). Histology of spleen, organization of follicular dendritic cells (detected by staining for CR1) and germinal centers (peanut agglutinin staining) in mice immunized with the T-dependent antigen SRBC were similar in Bf+/+ and Bf−/− mice (data not shown).

To evaluate the T-dependent antigen-specific antibody response in Bf-deficient mice, 5 μg of NP-ovalbumin was injected i.p. and anti-NP antibodies were measured at day 10 and day 28. When assayed with densely haptenated protein NP13-BSA, both high- and low-affinity anti-NP antibodies are bound; with sparsely haptenated NP2.5-BSA, only high-affinity anti-NP antibodies are bound. Therefore, an increasing ratio of NP2.5-binding/NP13-binding antibody demonstrates affinity maturation (29). Compared with wild-type mice, Bf-deficient mice produced high-affinity NP-specific IgG1 at similar or slightly greater levels, demonstrating that the T-dependent humoral response is retained (Fig. 6) and that affinity maturation may occur with greater efficiency in Bf-deficient mice, though the differences were not statistically significant (P = 0.06). Peters and co-workers (36) showed dominant growth-suppressive action of Ba in vitro on pre-activated B lymphocytes when both Ba and Bb fragments are present in equal proportion. Therefore, it is possible that relative B cell growth support in Bf−/− is the result of absence of both Ba and Bb. Alternatively, this subtle change could be due to potential differences between the genetic background of the wild-type (C57BL/6) and homozygous deficient (Sv129 × C57BL/6 partially backcrossed to C57BL/6) mice. Immunization of Bf-deficient and wild-type mice with SRBC (5 × 105 i.v.) showed similar numbers of IgM on day 5 and IgG anti-SRBC plaque-forming cells (PFC) on day 13 (direct PFC/106: Bf+/+ = 723 ± 328; Bf−/− = 810 ± 325; indirect PFC/106: Bf+/+ = 2230 ± 1272; Bf−/− = 2312 ± 1047) although in cobra venom factor-treated animals the IgM and IgG responses were decreased nearly to background levels. Taken together, these data showed no major effect of Bf on the humoral immune response.

Figure 6.

Figure 6

Antigen-specific antibody responses in Bf−/− mice. (Left and Center) NP-specific IgG1 antibody of low and high affinity detected by ELISA with NP13-BSA- and NP2.5-BSA-coated plates, respectively. (Right) Ratios. NP-specific serum IgG1 in each experiment is expressed in relative units compared with a standard hyperimmune mouse serum. •, Bf+/+; ▴, Bf+/−; ○, Bf−/−. The differences between the mean antibody responses and affinities were not significant (P ≥ 0.06).

Endotoxic Shock.

It has been suggested that activation of the complement system by endotoxin contributes to the pathophysiology of endotoxic shock (37). Although some data suggest that endotoxin-induced complement activation primarily involves the alternative pathway (38), the role of the alternative pathway in the development of endotoxic shock in vivo remains unclear. To evaluate this question, Bf-deficient mice were injected i.p. with either 0.75 or 1 mg of S. typhosa LPS. Wild-type and Bf-deficient mice showed similar endotoxin sensitivities in this shock model. [Mortality for 0.75 and 1.0 mg challenge: Bf+/+ = 3/8 (37.5%) and 31/38 (81.6%); Bf−/− = 7/13 (53.8%) and 19/30 (63.3%)]. An apparent increased susceptibility to the lethal effects of LPS in C3- and C4-null mice has been reported by Carroll and co-workers (39). Our data, therefore, support the conclusions of Carroll that the classical pathway of complement is a major mechanism for LPS clearance and that the complement system is protective in endotoxic shock.

Acknowledgments

We thank G. Huang for assistance with histological evaluations, V. M. Holers and T. Kinoshita for anti-CR1 mAb, and B. Hermann for secretarial assistance. D.D.C. is an investigator of the Howard Hughes Medical Institute. This work was supported by U.S. Public Health Service Grants HL37591, AI24836, AI24739, and HD17461 (H.R.C.).

ABBREVIATIONS

Bf

factor B

LPS

lipopolysaccharide

SRBC

sheep red blood cells

CR1

complement receptor 1

NP

(4-hydroxy-3-nitrophenyl)acetyl

Footnotes

††

An individual with genetic deficiency of Bf was described in an abstract (14), but important molecular biological details are lacking.

References

  • 1.Edwards M S, Nicholson-Weller A, Baker C J, Kasper D L. J Exp Med. 1980;151:1275–1287. doi: 10.1084/jem.151.5.1275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Muller-Eberhard H J. Annu Rev Biochem. 1988;57:321–347. doi: 10.1146/annurev.bi.57.070188.001541. [DOI] [PubMed] [Google Scholar]
  • 3.Pangburn M K. In: Immunobiology of the Complement System. Ross G D, editor. New York: Academic; 1986. pp. 45–62. [Google Scholar]
  • 4.Alper C A, Raum D, Awdeh Z, Petersen B H, Taylor P D, Starzl T E. Clin Immunol Immunopathol. 1980;16:84–91. doi: 10.1016/0090-1229(80)90169-5. [DOI] [PubMed] [Google Scholar]
  • 5.Colten H R. In: New Aspects of Complement Structure and Function: Molecular Biology Intelligence Unit Series. Erdei A, editor. Austin, TX: Landes; 1994. pp. 1–13. [Google Scholar]
  • 6.Hall R E, Blaese R M, Davis A E, III, Decker J M, Tack B F, Colten H R, Muchmore A V. J Exp Med. 1982;156:834–843. doi: 10.1084/jem.156.3.834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Gotze O, Bianco C, Cohn Z A. J Exp Med. 1979;149:372–386. doi: 10.1084/jem.149.2.372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sundsmo J S, Wood L M. J Immunol. 1981;127:877–880. [PubMed] [Google Scholar]
  • 9.Praz F, Ruuth E. J Exp Med. 1986;163:1349–1354. doi: 10.1084/jem.163.5.1349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Peters M G, Ambrus J L, Jr, Fauci A S, Brown E J. J Exp Med. 1988;168:1225–1235. doi: 10.1084/jem.168.4.1225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kolb W P, Morrow P R, Tamerius J D. Complement Inflammation. 1989;6:175–204. doi: 10.1159/000463093. [DOI] [PubMed] [Google Scholar]
  • 12.Colten H R, Rosen F S. Annu Rev Immunol. 1992;10:809–834. doi: 10.1146/annurev.iy.10.040192.004113. [DOI] [PubMed] [Google Scholar]
  • 13.Glass D, Raum D, Gibson D, Stillman J S, Schur P. J Clin Invest. 1976;58:853–861. doi: 10.1172/JCI108538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Densen P, Weiler J, Ackermann L, Barson B, Zhu Z-B, Volanakis J. Molec Immunol. 1996;33:68. (abstr.). [Google Scholar]
  • 15.Chaplin D D, Woods D E, Whitehead A S, Goldberger G, Colten H R, Seidman J G. Proc Natl Acad Sci USA. 1983;80:6947–6951. doi: 10.1073/pnas.80.22.6947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Rudnicki M A, Braun T, Hinuma S, Jaenisch R. Cell. 1992;71:383–390. doi: 10.1016/0092-8674(92)90508-a. [DOI] [PubMed] [Google Scholar]
  • 17.Mansour S L, Thomas K R, Capecchi M R. Nature (London) 1988;336:348–352. doi: 10.1038/336348a0. [DOI] [PubMed] [Google Scholar]
  • 18.DeTogni P, Goellner J, Ruddle N H, Streeter P R, Fick A, Mariathasan S, Smith S C, Carlson R, Shornick L P, Strauss-Schoenberger J, Russell J H, Karr R, Chaplin D D. Science. 1994;264:703–707. doi: 10.1126/science.8171322. [DOI] [PubMed] [Google Scholar]
  • 19.Garnier G, Ault B, Kramer M, Colten H R. J Exp Med. 1992;175:471–479. doi: 10.1084/jem.175.2.471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ishikawa N, Nonaka M, Wetsel R A, Colten H R. J Biol Chem. 1990;265:19040–19046. [PubMed] [Google Scholar]
  • 21.Sackstein R, Colten H R. J Immunol. 1984;133:1618–1626. [PubMed] [Google Scholar]
  • 22.Foley S, Li B, Dehoff M, Molina H, Holers V M. Eur J Immunol. 1993;23:1381–1384. doi: 10.1002/eji.1830230630. [DOI] [PubMed] [Google Scholar]
  • 23.Rapp H J, Borsos T, editors. Molecular Basis of Complement Action. New York: Century Crofts; 1970. [Google Scholar]
  • 24.Klerx J P, Beukelman C J, Van Dijk H, Willers J M. J Immunol Methods. 1983;63:215–220. doi: 10.1016/0022-1759(83)90425-8. [DOI] [PubMed] [Google Scholar]
  • 25.DeWaal R M W, Schrijver G, Bogman M J J T, Assmann K J M, Koene R A P. J Immunol Methods. 1988;108:213–221. doi: 10.1016/0022-1759(88)90422-x. [DOI] [PubMed] [Google Scholar]
  • 26.Williams S L, Sim R B. J Immunol Methods. 1993;157:25–30. doi: 10.1016/0022-1759(93)90066-g. [DOI] [PubMed] [Google Scholar]
  • 27.Mariathasan S, Matsumoto M, Baranyay F, Nahm M H, Kanagawa O, Chaplin D D. J Inflamm. 1995;45:72–78. [PubMed] [Google Scholar]
  • 28.Kinoshita T, Takeda J, Hong K, Kozono H, Sakai H, Inoue K. J Immunol. 1988;140:3066–3072. [PubMed] [Google Scholar]
  • 29.Matsumoto M, Mariathasan S, Nahm M H, Baranyay F, Peschon J J, Chaplin D D. Science. 1996;271:1289–1291. doi: 10.1126/science.271.5253.1289. [DOI] [PubMed] [Google Scholar]
  • 30.DeChiara T M, Vejsada R, Poueymirou W T, Acheson A, Suri C, Conover J C, Friedman B, McClain J, Pan L, Stahl N. Cell. 1995;83:313–322. doi: 10.1016/0092-8674(95)90172-8. [DOI] [PubMed] [Google Scholar]
  • 31.Stossel T P, Alper C A, Rosen F S. Pediatrics. 1973;50:134–136. [PubMed] [Google Scholar]
  • 32.Alper C A, Abramson N, Johnston R B, Jr, Jandl J H, Rosen F S. N Engl J Med. 1970;282:349–354. doi: 10.1056/nejm197002122820701. [DOI] [PubMed] [Google Scholar]
  • 33.Hasty L A, Brockman W W, Lambris J D, Lyttle C R. Am J Reprod Immunol. 1993;30:63–67. doi: 10.1111/j.1600-0897.1993.tb00603.x. [DOI] [PubMed] [Google Scholar]
  • 34.Johnson C A, Densen P, Hurford R, Colten H R, Wetsel R A. J Biol Chem. 1992;267:9347–9353. [PubMed] [Google Scholar]
  • 35.Wetsel R A, Kulics J, Lokki M-L, Kiepiela P, Akama H, Johnson C A C, Densen P, Colten H R. J Biol Chem. 1996;271:5824–5831. doi: 10.1074/jbc.271.10.5824. [DOI] [PubMed] [Google Scholar]
  • 36.Ambrus J L, Jr, Peters M G, Fauci A S, Brown E J. J Immunol. 1990;144:1549–1553. [PubMed] [Google Scholar]
  • 37.Hsueh W, Sun X, Rioja L N, Gonzalez-Crussi F. Immunology. 1990;70:309–314. [PMC free article] [PubMed] [Google Scholar]
  • 38.Clardy C W. Infect Immun. 1994;62:4549–4555. doi: 10.1128/iai.62.10.4549-4555.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Prodeus, A. P., Fischer, M. B., Ma, M., Murrow, J., Reid, R., Nicholson-Weller, A., Warren, H., Lage, A. & Carroll, M. C. (1996) Molec. Immunol. 33 Suppl. 1, 79 (abstr.) [PubMed]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES