Abstract
Background
The Sox gene family of transcriptional regulators have essential roles during development and have been extensively studied in vertebrates. The mouse, human and fugu genomes contain at least 20 Sox genes, which are subdivided into groups based on sequence similarity of the highly conserved HMG domain. In the well-studied insect Drosophila melanogaster, eight Sox genes have been identified and are involved in processes such as neurogenesis, dorsal-ventral patterning and segmentation.
Results
We examined the available genome sequences of Apis mellifera, Nasonia vitripennis, Tribolium castaneum, Anopheles gambiae and identified Sox family members which were classified by phylogenetics using the HMG domains. Using in situ hybridisation we determined the expression patterns of eight honeybee Sox genes in honeybee embryo, adult brain and queen ovary. AmSoxB group genes were expressed in the nervous system, brain and Malphigian tubules. The restricted localization of AmSox21b and AmSoxB1 mRNAs within the oocyte, suggested a role in, or that they are regulated by, dorsal-ventral patterning. AmSoxC, D and F were expressed ubiquitously in late embryos and in the follicle cells of the queen ovary. Expression of AmSoxF and two AmSoxE genes was detected in the drone testis.
Conclusion
Insect genomes contain between eight and nine Sox genes, with at least four members belonging to Sox group B and other Sox subgroups each being represented by a single Sox gene. Hymenopteran insects have an additional SoxE gene, which may have arisen by gene duplication. Expression analyses of honeybee SoxB genes implies that this group of genes may be able to rapidly evolve new functions and expression domains, while the combined expression pattern of all the SoxB genes is maintained.
Background
The SOX gene family is a group of related transcription factors that play critical roles in embryonic development. This family was originally identified in mammals based on sequence similarity to SRY, the sex-determining region Y chromosome [1]. SOX proteins regulate gene expression by binding to DNA via a conserved DNA binding domain, the HMG (high mobility group) box (reviewed in [2]). Phylogenetic studies have determined that SOX family members segregate into ten groups (named A-J) on the basis of sequence similarities within the HMG box [3-5], with many groups containing multiple members from the same organism with related gene function. Human and mouse genomes each encode 20 Sox genes [3,6] and analysis of the genomes of many model organisms including chicken, Drosophila, Xenopus and Zebrafish reveal that the Sox gene family is conserved between animal phyla. Recently Sox genes have been identified in the genomes of the cnidarian Nematostella vectensis, ctenophores, and the sponge species Reniera indicating these are ancestral animal genes [7-9]. In vertebrates, SOX proteins have been shown to have essential roles in the formation of many body systems including the central nervous system, eye and heart development, bone cartilage, vasculature, sex determination and testis development [10-14]. Molecular and biochemical studies have shown that SOX proteins regulate cell fate and differentiation during development. Mutations in Sox genes have been shown to be the underlying cause of a number of human disorders and Sox genes are expressed during cancer progression [12,15-18].
In the arthropod model organism, Drosophila melanogaster, eight Sox genes have been identified and their expression patterns determined [19,20]. Drosophila Sox genes are expressed in the brain, developing eye, hindgut, nervous system and testes. Group B SOX proteins are present in the developing Drosophila central nervous system (CNS), and also in the CNS of vertebrates, implying that some Sox genes maintain a conserved role throughout evolution [19,21]. The phenotypes of Drosophila Sox gene mutants indicate that Sox genes are involved in dorsal-ventral patterning, segmentation and neurogenesis [22-28]. Collectively, these studies demonstrate that the SOX family is an evolutionally conserved group of proteins essential for development. In insects, however, only the Sox genes from Drosophila have been characterised.
Recent whole-genome sequencing projects for Apis mellifera (the honeybee), Nasonia vitripennis (a parasitic wasp), Tribolium castaneum (the red flour beetle) and Anopheles gambiae (the malaria mosquito) have been completed or are near completion [8,9,29-32] allowing the identification and classification of the complete complement of a gene family from several holometabolous insects. Here we identify Sox gene family members in the genomes of these insects and examine their relationship through phylogenetics. Additionally, we study the expression of the honeybee Sox genes by in situ hybridisation and RT-PCR.
An advanced social insect, the honeybee is fast becoming an important model organism for the study of behaviour, longevity, learning and memory, immunity, polyphenisms, evolution and development. Recently the honeybee genome has been sequenced [29] and analysis of developmental genes has revealed that some early acting developmental genes are absent [33]. Furthermore, the development of molecular techniques including in situ hybridisation and RNA interference (RNAi) [34-37] allow us to examine gene expression and the biological role of genes during honeybee embryogenesis and development, about which little is known despite the importance of the honeybee both scientifically and economically. Given the wide range of organ systems in which Sox genes are expressed, we aimed to identify and examine the expression of honeybee Sox genes. We identified nine Sox genes and used in situ hybridisation and RT-PCR to determine their expression patterns in the honeybee embryo, ovary and adult brain.
Results
Identification and relationships of insect Sox genes
BLAST searches [38] of the honeybee genome sequence with the SOX HMG box consensus sequence identified nine regions that encode homology to SOX proteins. We designated the genes encoding this homology AmSox. Each predicted AmSox gene was examined for the presence of a single HMG box and the sequence motif, RPMNAFMVW, conserved in all known SOX genes [3], to confirm that they were members of the SOX family of HMG transcription factors. The SOX family is subdivided into groups (A-J) based on phylogenetic comparisons [3]. Phylogenetic analysis of HMG domains from each predicted AmSOX protein placed them into groups B through F (Fig. 1). This allowed us to name AmSox genes based on their placement within each SOX groups. The honeybee genome has four group B Sox genes, two group E genes and one Sox gene for each of groups C, D and F. This data supports the notion that the major groups of Sox genes predate the separation of the lineages leading to Arthropods and vertebrates, as these groups exist in both lineages. Included in the tree as Sox gene sequences from a non-vertebrate deuterostome, the sea urchin Strongylocentrus purpuratus, and a lophotrochozoan, the annelid Capitella sp I. Examination of these genomes indicates that the different Sox gene classes are all present, in one copy, in these genomes. The only exception is that the sea urchin genome does not appear to contain a SoxE gene. As this class of Sox genes is found in diploblasts and all other metazoans, this must represent loss of this gene from the lineage leading to Strongylocentrus. SOX groups B-F are also found in the Nematostella, ctenophore and sponge genomes [7,8], indicating that the major groups of Sox genes predate the emergence of triploblastic animals.
Figure 1.
Phylogeny of metazoan Sox proteins based on alignment of their HMG domains. Phylogram drawn from Bayesian phylogenetic analysis of HMG domains. The tree was rooted with an established outgroup for SOX phylogenetics, Fu-MATA1 [3, 60]. The SOX proteins are subdivided into established subgroups (B-F). Abbreviations are fungi (Fu), Drosophila melanogaster (Dm), Apis mellifera (Am) and Mus musculus (Mm)Nasonia vitripennis (Nv), Anopheles gambiae (Ag) and Tribolium castaneum (Tc) Capitella sp I (Csp), Strongylocentrotus purpuratus (Sp).
To extend our analysis of insect Sox genes, we searched the publicly available insect genome projects for predicted SOX protein sequences. Eight Sox genes were identified in Anopheles gambiae and nine in both Tribolium castaneum and Nasonia vitripennis (Fig. 2A). In Drosophila, three SoxB genes are clustered within an 80 kb region, while SoxB1 (SoxNeuro) is located on a separate chromosome [20]. Similar arrangements are found in honeybees, Anopheles [20], Nasonia and Tribolium (Fig. 2B). Tribolium has five SoxB genes, four of which are clustered within a 90 kb region of the genome. In the honeybee and Nasonia there are large intergenic regions between each neighbouring SoxB gene and there are several predicted ORFs between NvSox21b and NvSoxB2 (Fig. 2B), suggesting they are unlikely to be co-regulated. In all cases, the SoxB1/Neuro orthologue is located in a different region of the genome. This confirms, as shown by [20], that there is an evolutionary conserved organisation of SoxB group genes between holometabolous insects, where at least three SoxB genes are located together in insect genomes (Fig. 2B).
Figure 2.
Insect SOX HMG phylogeny. A. A rooted Bayesian phylogeny for all identified SOX proteins encoded in A. mellifera, D. melanogaster, A. gambiae, N. vitripennis and T. castaneum genomes. SOX subgroups are indicated (B-F). B. An illustration of the genomic organisation of Sox group B genes in the honeybee, Nasonia and Tribolium. Exons are shown as coloured boxes with arrows indicating direction of transcription. Abbreviations are Nasonia vitripennis (Nv), Apis mellifera (Am), Drosophila melanogaster (Dm), Anopheles gambiae (Ag) and Tribolium castaneum (Tc).
In insects much of the diversity in Sox genes is found within the SoxB clade. Our phylogenetic analyses indicate that this clade is split into four groups (Fig. 2A), but that the details of the groupings are not well-resolved, due in part to the high sequence similarity of the HMG domains, and sequence divergence between SOX proteins outside of this domain. The SOX21/Dichaete clade is unresolved, but separate from the rest of the SOXB proteins. SOX21b proteins form a separate clade, as do the SOX21/Neuro orthologues. The SOXB2/21a clade is less well defined, with Drosophila SOX21a proteins being significantly different from SOXB2, perhaps indicating rapid evolution of these proteins in the lineage leading to Diptera.
Phylogenetic analyses revealed that honeybee and Nasonia both have one additional Sox group E gene compared to Drosophila, which has only one, DmSox100b (Fig. 2A). This additional SOXE protein seems likely to have arisen by gene duplication as both pairs of genes share a similar exon structure and appear to share a common promoter region (Fig 3A). This duplication must have occurred in an ancestor of hymenopteran insects before the split of Nasonia and Apis. Sequence analyses using full-length protein sequences revealed that invertebrate SOXE proteins form a clade separate to vertebrate SOXE proteins, and they are most closely related to the vertebrate SOXE protein, SOX8 (Fig 3B).
Figure 3.
SOXE group gene duplication in hymenoptera. A. Illustration of the SoxE gene genomic region from A. mellifera and N. vitripennis genomes. Both genomes encode two copies of SoxE group gene that share a common promoter region. B. Insect SOXE group proteins form a separate clade to the vertebrate SOXE proteins, that are split into three separate groupings, SOX8, SOX9 and SOX10. Insect SOXE proteins are most closely related to vertebrate SOX8 proteins. The unrooted tree was constructed using Phylip, bootstrap values are shown at internal branches.
The phylogenetic analysis demonstrates the evolutionary stability of the Sox gene complement in insect evolution. The major amount of diversification in sequence appears in the SoxB group and in the duplication of the SoxE genes, that is seen only in hymenoptera. Given the stability in sequence we examined the expression of these genes in honeybees to determine if sequence stability is matched with constancy of predicted function.
The expression patterns of SoxB group genes in the honeybee
Phylogenetic analysis reveals that the honeybee genome contains four group B Sox genes. These were also identified by McKimmie et al., [20], who investigated the genomic organisation of group SoxB genes in insects. We examined the expression patterns of these Sox genes in the queen ovariole, honeybee worker embryos and adult brains.
AmSoxB1 is strongly expressed by the nurse cells closest to the oocyte in the queen ovariole. In the oocyte, AmSoxB1 mRNA becomes localised to the dorsal surface (Fig. 4A and 4B). This expression pattern continues throughout oogenesis and AmSoxB1 mRNA is also detected on the dorsal surface of early (newly laid) embryos (data not shown).
Figure 4.
AmSoxB1 mRNA is localised in honeybee ooctyes and is expressed in the ventral neuroectoderm during honeybee embryogenesis. A. Ovariole from honeybee queen was stained for AmSoxB1 mRNA. B. A higher magnification image of AmSoxB1 expression in the queen oocyte. AmSoxB1 mRNA is detected in the posterior nurse (N) cells and in the neighbouring oocyte, where the RNA becomes localized to the dorsal side of the oocyte (O; arrow). C. Ventral view of stage 6 embryo showing staining for AmSoxB1 along the gastrulation folds in the ventral neuroectoderm (VNE). D. Side view of later stage 6 embryo, AmSoxB1 is strongly expressed in the procephalic neuroectoderm. E. AmSoxB1 is expressed in the neuroblasts along the ventral midline at stage. AmSoxB1 expression in the cephalic brain lobes. F. In later stage embryos, neuronal expression of AmSoxB1 continues along ventral midline in neurons that radiate from the ventral nerve cord. Side view of the same embryo (G). Scale bar is 100 μm.
During embryo development, AmSoxB1 is expressed along ventral gastrulation folds of stage 6 embryos (Fig. 4C), and in the procephalic neurogenic region. After gastrulation, AmSoxB1 expression continues in neuroblasts that arise from neuroectoderm along the ventral midline (Fig. 4E). At later stages these AmSoxB1-positive cells migrate to lateral positions along the ventral axis to differentiate and take up positions within the CNS. Strong expression of AmSoxB1 is also found in neurons of embryonic brain cephalic lobes. This expression continues in the brain of the adult worker honeybee, where AmSoxB1 continues to be expressed in Kenyon cells in each calyx of the mushroom bodies (data not shown), the key region of the honeybee brain required for sensory processing and memory formation.
AmSoxB2 expression is first detected in a group of cells at stage 8 in posterior region of the embryo, where the Malpighian tubules begin to form (Fig. 5A). This expression pattern is maintained in these tubules at later stages (Fig. 5B). AmSOXB2 is likely to have a role in the development of Malpighian tubules in the honeybee, which are essential for the removal of waste products and osmoregulation.
Figure 5.
AmSOXB2 and AmSOX21b expression in the honeybee. AmSoxB2 mRNA is expressed during Malpighian tube development. A. Late stage 8, AmSoxB2 mRNA is detected at the posterior of the embryo (arrowed). B. In later stages, AmSoxB2 is present throughout the Malpighian tubules (MT). C. Stage 9 embryo showing AmSox21b staining in paired clusters of neurons that run adjacent to the ventral midline. B. Higher magnification (20x) of AmSox21b staining in mandible and CNS. C. AmSox21b mRNA is localized in the oocyte to the dorsal and ventral sides of the egg (arrowed). D. Expression of AmSox21b in the worker adult brain. AmSox21 mRNA is detected in the Kenyon cells of each calcyx of both mushroom bodies. Abbreviations; Mandible (Mn), Maxillary (Mx), leg pair (LP), labrum (LB). Scale bar = 100 μm.
AmSox21b mRNA was detected in late embryos, in the CNS in paired/segmented ganglia on either side of the ventral nerve cord. Expression was also detected in the embryonic brain, intercalary head region and mandibles (Fig. 5C and 5D) and in the mushroom bodies of the adult worker brain (Fig. 5F). Strong AmSox21b expression is detected at the ventral tip of the developing mandible, implying that it may play a role in dorsal-ventral patterning of this appendage. In queen ovarioles, AmSox21b is strongly expressed by the nurse cells and its mRNA present in the oocyte, localized to both dorsal and ventral surfaces of the egg (Fig. 5E).
During late honeybee embryogenesis, the expression patterns of AmSoxB1 and AmSox21b group B genes do not overlap in the CNS (Figs 4F and 5C). These genes appear to be expressed in different neuronal cells along the ventral midline, implying that they play separate roles in the developing ÇNS. In the embryonic and adult brain, however, AmSoxB1 and AmSox21b are both expressed by the Kenyon cells of the mushroom bodies.
No expression was detected for AmSox21 by in situ hybridisation in honeybee embryos, queen ovaries or adult worker brains. AmSox21 is encoded by a single exon, making RT-PCR analysis of expression challenging, as RT-PCR analysis detects amplification from embryo cDNA but this is also seen in the control reaction in the absence of reverse transcriptase, indicating this band is most likely to be the result of genomic DNA contamination (Fig. 7). While previous studies [20] have identified AmSox21 in a brain EST library, an overlapping probe used in this study did not detect any expression. As AmSox21 expression is undetectable by RT-PCR and in situ hybridisation under our experimental conditions, we suggest that AmSox21 could be an inactive pseudogene. This implies the previously identified EST may be the result of genomic contamination.
Figure 7.

AmSoxE1, AmSoxE2, AmSoxF and AmSox21b are expressed in the testis of Drone honeybees. Gene-specific primers were used to detect the presence of AmSox genes in total RNA isolated from whole honeybee worker embryos and Drone testis. A negative control reaction (no reverse transcriptase added to the cDNA synthesis) was performed for each set of oligonucleotide pairs to detect contamination from genomic DNA. Abbreviations: Embryo (E), testis (T) and negative control (—).
Expression of SoxF, D and C group orthologues in the honeybee
AmSoxC, AmSoxD and AmSoxF were all expressed by nurse cells of the queen ovariole and the follicle cells that surround the oocyte (Fig 6A). All three were also expressed ubiquitously throughout late stage embryos (Fig. 6B), although AmSoxC expression was slightly higher in the embryonic brain (Fig. 6C). AmSoxC and AmSoxD were also expressed by the Kenyon cells in the calyces of the mushroom bodies (MB) (Fig. 6D),.
Figure 6.
Expression of AmSoxC, AmSoxD and AmSoxF. A. AmSoxF and AmSoxD expression was detected in the follicle cells surrounding each oocyte and all nurse cells in the queen ovariole. B. AmSoxD expression was unbiquous throughout late stage embryos. C. AmSoxC expression was stronger in the cephalic lobes of the honeybee embryo brain. D. AmSoxC and AmSoxD expression in the adult worker brain. Both are detected in the Kenyon cells of the mushroom bodies.
SoxE group honeybee orthologues are upregulated in the drone testis
As SOX proteins play key roles in gonad differentiation, we used RT-PCR to determine if the honeybee Sox genes were also expressed in the testis of the drone (Fig. 7). RNA was isolated from the testis of drone pupa, as the adult drone testis degenerates shortly after emergence [39]. Strong expression of AmSoxE1, AmSoxE2 and AmSoxF was detected in testis and weak expression of AmSox21b (Fig. 7). AmSoxF was also expressed in queen ovaries (Fig. 6A) but only AmSoxE group gene expression appears to be testis-specific. No expression was detected in queen ovaries and only weak ubiquitous expression was found in late stage worker embryos.
Discussion
We identified nine Sox genes in the honeybee genome, eight in Tribolium, seven in Nasonia and eight in Anopheles. Vertebrate genomes contain a much larger number of Sox genes; humans and mice have 20 Sox genes and fugu has 24 [6,40], with multiple Sox genes represented in each grouping, exhibiting overlapping expression patterns and functions. By contrast invertebrate deuterostome, ecdysozoan and lophotrochozoan genomes contain fewer Sox genes (8–9) and, apart from group B, only a single Sox gene represents most Sox groups. This is consistent with the hypothesis that the ancestral vertebrate genome underwent genome duplication(s) [41]. Non- bilaterian metazoa contain considerably more Sox genes [7,8] indicating Sox gene loss has been important in the evolution of the bilateria. While the HMG domain sequences of Sox group genes suggests that these genes are conserved, their expression when compared between Drosophila and honeybee indicates that these genes are evolving novel expression patterns and thus functions. Sox gene expression in Drosophila, Apis and vertebrates is summarised in Table 1.
Table 1.
Summary of honeybee Sox group expression analysis.
| Group | Honeybee expression summary | Drosophila expression summary | Vertebrate expression summary |
|---|---|---|---|
| B |
Adult brain: MB* Embryo: neuroectoderm, CNS (ventral midline), brain, malpighian tubules, mandibles, intercalary. Queen ovary: oocyte and nurse cells. |
Embryo: neuroectoderm, CNS, brain, hindgut, segments Ovary: oocyte and nurse cells |
Embryo: CNS, lens, brain, stem cells, pituitary. |
| C |
Embryo: ubiquitous expression Adult brain: MB Queen ovary: nurse and follicle cells of the ovary |
Embryo: ubiquitous | Embryo: many tissues including CNS, heart, lung |
| D |
Embryo: ubiquitous Adult brain: MB Queen ovary: nurse and follicle cells |
Embryo: brain | Embryo: many tissues including chrondrocytes, spermatogenesis, CNS, brain, thymus, ovary |
| E | Adult testis Embryo: no expression detected | Embryo: alimentary canal, gonadal mesoderm | Embryo: CNS, brain, limbs, heart, testes, chondrocytes, kidney, neural crest |
| F |
Embryo: ubiquitous Queen ovary: nurse and follicle cells |
Embryo: peripheral nervous system | Embryo: endoderm, blood vessel and hair follicles. |
* abbreviations: mushroom bodies (MB), central nervous system (CNS)
Expression and evolution of SoxB genes
The general features of group B gene expression are conserved for the honeybee, as their expression patterns suggest roles in neurogenesis and dorsal-ventral patterning. However, orthology based on phylogenetic evidence does not predict the expression pattern of an individual gene. Despite conservation in genomic organisation and sequence in insects [20], expression of the individual SoxB genes has changed considerably through the evolution of insects.
None of the AmSox B group genes show identical expression patterns to any of their orthologous DmSox B genes. For example, the AmSox21b expression pattern in the CNS is different to that of DmSox21b, which is expressed in abdominal epidermal stripes. AmSoxB1 expression pattern overlaps with both DmSoxB1 and DmDichaete (DmSoxB2.1) expression patterns. No expression was detected for AmSox21, which had been suggested to be a orthologue of DmDichaete by McKimmie et al. [20] based on phylogenetics and genome position, and is Dichaete's nearest neighbour in our phylogenetic analysis.
Recently, in Drosophila, examination of a DmDichaete (DmSoxB2.1) loss of function mutant found that Dichaete influenced dorsal-ventral patterning [23]. Mutant eggs had defects in Gurken-dependent formation of dorsal appendages and differentiation of dorsal/anterior follicle cells. Additionally, in zebrafish, both knock-down and ectopic expression of the SOX protein SOX21a indicates that it acts in dorsal-ventral patterning [42]. In the honeybee, two Sox genes appear to have a role in, or a regulated by, dorsal-ventral patterning. AmSoxB1 mRNA is localized to the dorsal surface of the oocyte and AmSox21b mRNA is localized to both the dorsal and ventral surface of the oocyte. As mRNA localization plays a critical part in axis specification in other insects [43,44], it is likely that these AmSox genes have roles in dorsal-ventral patterning in the oocyte and they may have overlapping functions. It is currently unknown how axes are specified in the honeybee oocyte and early embryo, as the honeybee genome is missing several key genes essential for axis organisation in Drosophila [33]. While these expression patterns suggest a conserved role for SOX group B proteins in dorsal-ventral patterning, the actual SoxB genes involved are not orthologous. The direct orthologue of DmDichaete, according to our phylogenetic analysis (and that of [20]) is AmSox21, which has no expression in the oocyte, while the honeybee orthologues of zebrafish Sox21a are AmSoxB2 and AmSox21a.
We have also found a novel expression pattern for a group B SOX protein, AmSOXB2, in the formation of the Malpighian tubules. The Drosophila group E SOX protein (DmSox100b) is also expressed in Malpighian tubules, while SOX proteins in mammals are expressed in analogous tissues, the foetal kidneys [45]. AmSOXB2 sequence is highly divergent outside of the HMG box[20] perhaps reflecting different selective pressure on its sequence due its co-option into a possible role in Malphigian tubule formation.
Other Sox genes
AmSoxC, AmSoxD and AmSoxF were expressed throughout late stage embryos. The Drosophila orthologue for SoxC is also ubiquitously expressed [19,46], although SoxD and SoxF orthologues show specific nervous system expression. Vertebrate SoxD orthologues are expressed broadly in embryonic tissues [47] and more specifically in bone and pancreas.
There is little conservation in expression of SOXF group members between species. Vertebrate SoxF family members are involved in a range of activities including endoderm specification, blood and hair follicle development. DmSoxF is found in the peripheral nervous system [19] whereas C. elegans does not have a SoxF group gene [3].
Drosophila DmSox100b is expressed in gonadal mesoderm and its expression becomes male-specific after stage 15 but it is also expressed in other tissues including the alimentary canal, intestinal cells and Malpighian tubules [45,48]. Upregulation of AmSOXE proteins solely in the drone testis implies that they may play a specific role in honeybee testis differentiation. Group F SOX proteins, a group closely related to SOXE proteins (Fig. 1), are also expressed in both testis and ovaries in other species including the eel [49] and human (sox17; [50]), indicating that SOXF proteins play a conserved evolutionary role in both male and female gonads.
Sequence analyses revealed the honeybee and Nasonia genomes encode two SoxE group members where-as there is only one in Drosophila (DmSox100b) and none in C. elegans [3]. Expression of both AmSoxE genes was upregulated in the testis of honeybee drones, suggesting they play a role in testicular development. SOXE group proteins are expressed during testis determination in many species [48,51-53]. Sequences outside of the HMG domains of SOXE1 and SOXE2 show little similarity. These sequence changes may have been necessary for interactions with other testis-related factors. Non-HMG domain sequences can play a role in protein partner selection between different SOX groups but SOX proteins within the same subgroup often interact with the same protein partners despite having sequences that are different outside of the HMG domain [54].
Conclusion
We identified and classified Sox genes in the genomes of Apis mellifera, Nasonia and Tribolium and examined the expression patterns of eight honeybee Sox genes by in situ hybridisation. The expression patterns of honeybee Sox genes confirm that members of this family are likely to play an essential role in embryogenesis and neural specification. Further studies are required including knock-down of gene expression to confirm the predicted roles of Sox genes in the honeybee.
Methods
Phylogenetics
SOX homologues were identified in insect genome sequences using tBlastN searches [38]. Each putative AmSOX protein was analysed for the presence of a sequence motif RPMNAFMVW located within the HMG box which is conserved for all SOX sequences [3], confirming that those genes identified were members of the SOX group of HMG domain transcription factors. Multiple alignments of honeybee SOX HMG sequences with SOX domains from other species were carried out in ClustalX (see Additional files 1, 2 and 3). For Figure 1 the multiple alignment was analysed using MrBAYES 3.1.2.[55] under the WAG model[56] with default priors. The WAG model was chosen as the most appropriate model of amino-acid substitution after preliminary analysis using MrBAYES with mixed models. The Monte Carlo Markov Chain search was run with four chains over 1500000 generations with trees sampled every 1000 generations. The first 375000 trees were discarded as 'burn-in'. The trees in figures 2 and 3 were constructed using the PHYLIP[57] package of programs from alignments bootstrapped using SEQBOOT. Maximum Likelihood trees were estimated using PROTML and majority-rule consensus trees derived using CONSENSE. Dendrograms were displayed using TreeViewPPC [58] or Dendroscope [59].
Genome sequence information for insects and other species was retrieved from their genome project websites [[32,61-63] and [64]]. Exon/intron gene structure was predicted by either Genemachine [65] or was already predicted during the genome assembly using sets of reference sequences (including Drosophila) to help identify transcripts. Insect Sox genes were named based on their placement within each SOX groups (see Additional file 4 for Genebank accession numbers).
Isolation of AmSox gene probes
Total RNA was extracted from Honeybee embryos or testis dissected from drone pupa using the RNeasy Mini Kit (Qiagen) and cDNA was produced using Superscript II reverse transcriptase (Invitrogen). AmSox gene fragments were amplified by RT-PCR from embryo cDNA using oligonucleotide primers corresponding to non-HMG box encoding regions from the coding sequence of each predicted AmSox gene. Oligonucleotide primers used were: SoxC – 5'AGAAGCTGAGGAAATCGGGT3' and 5'AATTCCATCTTCATCTTTCCGTC3'; SoxB1 – 5'GCTCAAGAAGGATAAATTCCCC3' and 5'AATCGCCGTGTGATGCTG3'; soxB2 – 5'TCACACGTTGATGAGCCAC3' and 5'GACGACGACAAATTCTCCTCTTC3'; Sox21 – 5'-TCCAGGATCGAAGACCACC3' and 5'CTAGAATATTACGGAGACTGGCC3'; Sox21b – 5'GAAGTATTCGATGGAAGCGG3' and 5'GATGACAGTGAGCGGTCGT3';SoxE1 – 5'CCAGAGCAACGTGACTTTCA3' and 5'CCACCTCGCACTCCTGAA3'; SoxE2 – 5'GAACGCGTTCATGGTCTG3' and 5'TCCTCGTGCACCGTGTAC3'; SoxF – 5'CTGAATTCAGGAAGACCAGTGG3' and 5'GACGGCTGTCTCTCGAAATT3'; SoxD – 5'GGAAGAAGATGCGCATATCC3' and 5'-TCAATCCTCGTCGTGGTG. Actin was amplified using 5'CTCTCTTTGATTGGGCTTCG3' and 5'TGACGAAGAAGTTGCTGCAC3' oligonucleotide primers as a positive control for RT-PCR. Amplified AmSox DNA fragments were then cloned into the pGEM-T Easy vector (Promega). The sequence and orientation of each cloned gene fragment was confirmed by DNA sequencing.
In situ hybridization
Honeybee embryos were collected and fixed as described [34]. Brains were dissected from worker honeybees, fixed in 4% PFA overnight at 4°C and stored in methanol. Anti-sense or sense digoxigenin (DIG)-labeled RNA probes were produced by in vitro transcription from linearized DNA templates containing AmSox cDNA fragments. In situ hybridization on honeybee embryos, oocytes and worker brains were performed as described [34].
Authors' contributions
MJW conceived and designed the study, performed sequence analysis and honeybee expression studies, and drafted the manuscript. PKD participated in the design of the study and sequence analysis and helped to draft the manuscript.
Supplementary Material
Multiple alignment of honeybee SOX and vertebrate HMG domains. Alignment of the HMG domains from honeybee SOX proteins and vertebrate SOX proteins created in ClustalX.
Multiple alignment of insect SOX HMG box sequences. Alignment of the HMG domains from predicted insect SOX proteins created in ClustalX
Multiple alignment of SOXE full length protein sequences. ClustalX alignment of full-length SOXE proteins from insects and vertebrates.
Naming of identified insect Sox genes. Renamed insect SOX genes (based on phylogenetics) and their protein Genbank accession numbers.
Contributor Information
Megan J Wilson, Email: meganj.wilson@otago.ac.nz.
Peter K Dearden, Email: peter.dearden@stonebow.otago.ac.nz.
Acknowledgements
This work was supported by a Royal Society of New Zealand Marsden Grant (UOO0401) to PKD and a University of Otago Research Grant to PKD. We thank James Smith and Elizabeth Duncan for critical reading of this manuscript. We also thank Lucas Smith and William Dearden for their comments on the manuscript.
References
- Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Munsterberg A, Vivian N, Goodfellow P, Lovell-Badge R. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature. 1990;346(6281):245–50. doi: 10.1038/346245a0. [DOI] [PubMed] [Google Scholar]
- Wegner M. From head to toes: the multiple facets of Sox proteins. Nucleic Acids Res. 1999;27(6):1409–20. doi: 10.1093/nar/27.6.1409. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bowles J, Schepers G, Koopman P. Phylogeny of the SOX family of developmental transcription factors based on sequence and structural indicators. Dev Biol. 2000;227(2):239–55. doi: 10.1006/dbio.2000.9883. [DOI] [PubMed] [Google Scholar]
- Wright EM, Snopek B, Koopman P. Seven new members of the Sox gene family expressed during mouse development. Nucleic Acids Research. 1993;21(3):744. doi: 10.1093/nar/21.3.744. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cremazy F, Soullier S, Berta P, Jay P. Further complexity of the human SOX gene family revealed by the combined use of highly degenerate primers and nested PCR. FEBS Letters. 1998;438(3):311–4. doi: 10.1016/S0014-5793(98)01294-0. [DOI] [PubMed] [Google Scholar]
- Schepers GE, Teasdale RD, Koopman P. Twenty pairs of sox: extent, homology, and nomenclature of the mouse and human sox transcription factor gene families. Dev Cell. 2002;3(2):167–70. doi: 10.1016/S1534-5807(02)00223-X. [DOI] [PubMed] [Google Scholar]
- Magie CR, Pang K, Martindale MQ. Genomic inventory and expression of Sox and Fox genes in the cnidarian Nematostella vectensis. Dev Genes Evol. 2005;215(12):618–30. doi: 10.1007/s00427-005-0022-y. [DOI] [PubMed] [Google Scholar]
- Jager M, Queinnec, Houliston E, Manuel M. Expansion of the SOX gene family predated the emergence of the Bilateria. Mol Phylogenet Evol. 2006;39(2):468–77. doi: 10.1016/j.ympev.2005.12.005. [DOI] [PubMed] [Google Scholar]
- Larroux C, Fahey B, Liubicich D, Hinman VF, Gauthier M, Gongora M, Green K, Worheide G, Leys SP, Degnan BM. Developmental expression of transcription factor genes in a demosponge: insights into the origin of metazoan multicellularity. Evol Dev. 2006;8(2):150–73. doi: 10.1111/j.1525-142X.2006.00086.x. [DOI] [PubMed] [Google Scholar]
- Koopman P. The molecular biology of SRY and its role in sex determination in mammals. Reprod Fertil Dev. 1995;7(4):713–22. doi: 10.1071/RD9950713. [DOI] [PubMed] [Google Scholar]
- Young N, Hahn CN, Poh A, Dong C, Wilhelm D, Olsson J, Muscat GE, Parsons P, Gamble JR, Koopman P. Effect of disrupted SOX18 transcription factor function on tumor growth, vascularization, and endothelial development. J Natl Cancer Inst. 2006;98(15):1060–7. doi: 10.1093/jnci/djj299. [DOI] [PubMed] [Google Scholar]
- Cameron FJ, Sinclair AH. Mutations in SRY and SOX9: testis-determining genes. Hum Mutat. 1997;9(5):388–95. doi: 10.1002/(SICI)1098-1004(1997)9:5<388::AID-HUMU2>3.0.CO;2-0. [DOI] [PubMed] [Google Scholar]
- Graham V, Khudyakov J, Ellis P, Pevny L. SOX2 functions to maintain neural progenitor identity. Neuron. 2003;39(5):749–65. doi: 10.1016/S0896-6273(03)00497-5. [DOI] [PubMed] [Google Scholar]
- Sandberg M, Kallstrom M, Muhr J. Sox21 promotes the progression of vertebrate neurogenesis. Nat Neurosci. 2005;8(8):995–1001. doi: 10.1038/nn1493. [DOI] [PubMed] [Google Scholar]
- Williamson KA, Hever AM, Rainger J, Rogers RC, Magee A, Fiedler Z, Keng WT, Sharkey FH, McGill N, Hill CJ, Schneider A, Messina M, Turnpenny Fantes JA, van Heyningen V, FitzPatrick DR. Mutations in SOX2 cause anophthalmia-esophageal-genital (AEG) syndrome. Hum Mol Genet. 2006;15(9):1413–22. doi: 10.1093/hmg/ddl064. [DOI] [PubMed] [Google Scholar]
- Dong C, Wilhelm D, Koopman P. Sox genes and cancer. Cytogenet Genome Res. 2004;105(2–4):442–7. doi: 10.1159/000078217. [DOI] [PubMed] [Google Scholar]
- Wagner T, Wirth J, Meyer J, Zabel iB, Held M, Zimmer J, Pasantes J, Bricarelli FD, Keutel J, Hustert E. et al. Autosomal sex reversal and campomelic dysplasia are caused by mutations in and around the SRY-related gene SOX9. Cell. 1994;79(6):1111–1120. doi: 10.1016/0092-8674(94)90041-8. [DOI] [PubMed] [Google Scholar]
- Inoue K, Shilo K, Boerkoel CF, Crowe C, Sawady J, Lupski JR, Agamanolis DP. Congenital hypomyelinating neuropathy, central dysmyelination, and Waardenburg-Hirschsprung disease: phenotypes linked by SOX10 mutation. Ann Neurol. 2002;52(6):836–42. doi: 10.1002/ana.10404. [DOI] [PubMed] [Google Scholar]
- Cremazy F, Berta P, Girard F. Genome-wide analysis of Sox genes in Drosophila melanogaster. Mech Dev. 2001;109(2):371–5. doi: 10.1016/S0925-4773(01)00529-9. [DOI] [PubMed] [Google Scholar]
- McKimmie C, Woerfel G, Russell S. Conserved genomic organisation of Group B Sox genes in insects. BMC Genet. 2005;6(1):26. doi: 10.1186/1471-2156-6-26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wegner M, Stolt CC. From stem cells to neurons and glia: a Soxist's view of neural development. Trends Neurosci. 2005;28(11):583–8. doi: 10.1016/j.tins.2005.08.008. [DOI] [PubMed] [Google Scholar]
- Buescher M, Hing FS, Chia W. Formation of neuroblasts in the embryonic central nervous system of Drosophila melanogaster is controlled by SoxNeuro. Development. 2002;129(18):4193–203. doi: 10.1242/dev.129.18.4193. [DOI] [PubMed] [Google Scholar]
- Mukherjee A, Melnattur KV, Zhang M, Nambu JR. Maternal expression and function of the Drosophila sox gene Dichaete during oogenesis. Dev Dyn. 2006;235(10):2828–2835. doi: 10.1002/dvdy.20904. [DOI] [PubMed] [Google Scholar]
- Nambu PA, Nambu JR. The Drosophila fish-hook gene encodes a HMG domain protein essential for segmentation and CNS development. Development. 1996;122(11):3467–75. doi: 10.1242/dev.122.11.3467. [DOI] [PubMed] [Google Scholar]
- Russell SR, Sanchez-Soriano N, Wright CR, Ashburner M. The Dichaete gene of Drosophila melanogaster encodes a SOX-domain protein required for embryonic segmentation. Development. 1996;122(11):3669–3676. doi: 10.1242/dev.122.11.3669. [DOI] [PubMed] [Google Scholar]
- Sanchez-Soriano N, Russell S. Regulatory mutations of the Drosophila Sox gene Dichaete reveal new functions in embryonic brain and hindgut development. Dev Biol. 2000;220(2):307–21. doi: 10.1006/dbio.2000.9648. [DOI] [PubMed] [Google Scholar]
- Zhao G, Wheeler SR, Skeath JB. Genetic control of dorsoventral patterning and neuroblast specification in the Drosophila Central Nervous System. Int J Dev Biol. 2007;51(2):107–15. doi: 10.1387/ijdb.062188gz. [DOI] [PubMed] [Google Scholar]
- Overton PM, Meadows LA, Urban J, Russell S. Evidence for differential and redundant function of the Sox genes Dichaete and SoxN during CNS development in Drosophila. Development. 2002;129(18):4219–4228. doi: 10.1242/dev.129.18.4219. [DOI] [PubMed] [Google Scholar]
- Honeybee Genome Sequencing Consortium. Insights into social insects from the genome of the honeybee Apis mellifera. Nature. 2006;443(7114):931–49. doi: 10.1038/nature05260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Holt RA, Subramanian GM, Halpern A, Sutton GG, Charlab R, Nusskern DR, Wincker P, Clark AG, Ribeiro JM, Wides R. et al. The genome sequence of the malaria mosquito Anopheles gambiae. Science. 2002;298(5591):129–149. doi: 10.1126/science.1076181. [DOI] [PubMed] [Google Scholar]
- BeetleBase. http://www.bioinformatics.ksu.edu/BeetleBase/
- Nasonia Genome Project. http://www.hgsc.bcm.tmc.edu/projects/nasonia/
- Dearden PK, Wilson MJ, Sablan L, Osborne PW, Havler M, McNaughton E, Kimura K, Milshina NV, Hasselmann M, Gempe T. et al. Patterns of conservation and change in honey bee developmental genes. Genome Res. 2006;16(11):1376–1384. doi: 10.1101/gr.5108606. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Osborne PW, Dearden PK. Expression of Pax group III genes in the honeybee (Apis mellifera) Dev Genes Evol. 2005;215(10):499–508. doi: 10.1007/s00427-005-0008-9. [DOI] [PubMed] [Google Scholar]
- Amdam GV, Simoes ZL, Guidugli KR, Norberg K, Omholt SW. Disruption of vitellogenin gene function in adult honeybees by intra-abdominal injection of double-stranded RNA. BMC Biotechnol. 2003;3:1. doi: 10.1186/1472-6750-3-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Beye M, Hasselmann M, Fondrk MK, Page RE, Omholt SW. The gene csd is the primary signal for sexual development in the honeybee and encodes an SR-type protein. Cell. 2003;114(4):419–429. doi: 10.1016/S0092-8674(03)00606-8. [DOI] [PubMed] [Google Scholar]
- Farooqui T, Vaessin H, Smith BH. Octopamine receptors in the honeybee (Apis mellifera) brain and their disruption by RNA-mediated interference. J Insect Physiol. 2004;50(8):701–13. doi: 10.1016/j.jinsphys.2004.04.014. [DOI] [PubMed] [Google Scholar]
- Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215(3):403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
- Dade HA. Anatomy and dissection of the honeybee. London: Bee Research Association; 1962. [Google Scholar]
- Koopman P, Schepers G, Brenner S, Venkatesh B. Origin and diversity of the SOX transcription factor gene family: genome-wide analysis in Fugu rubripes. Gene. 2004;328:177–186. doi: 10.1016/j.gene.2003.12.008. [DOI] [PubMed] [Google Scholar]
- Meyer A, Schartl M. Gene and genome duplications in vertebrates: the one-to-four (-to-eight in fish) rule and the evolution of novel gene functions. Curr Opin Cell Biol. 1999;11(6):699–704. doi: 10.1016/S0955-0674(99)00039-3. [DOI] [PubMed] [Google Scholar]
- Argenton F, Giudici S, Deflorian G, Cimbro S, Cotelli F, Beltrame M. Ectopic expression and knockdown of a zebrafish sox21 reveal its role as a transcriptional repressor in early development. Mech Dev. 2004;121(2):131–142. doi: 10.1016/j.mod.2004.01.001. [DOI] [PubMed] [Google Scholar]
- Grunert S, St Johnston D. RNA localization and the development of asymmetry during Drosophila oogenesis. Curr Opin Genet Dev. 1996;6(4):395–402. doi: 10.1016/S0959-437X(96)80059-1. [DOI] [PubMed] [Google Scholar]
- Brent AE, Yucel G, Small S, Desplan C. Permissive and instructive anterior patterning rely on mRNA localization in the wasp embryo. Science. 2007;315(5820):1841–1843. doi: 10.1126/science.1137528. [DOI] [PubMed] [Google Scholar]
- Hui Yong Loh S, Russell S. A Drosophila group E Sox gene is dynamically expressed in the embryonic alimentary canal. Mech Dev. 2000;93(1–2):185–8. doi: 10.1016/S0925-4773(00)00258-6. [DOI] [PubMed] [Google Scholar]
- Sparkes AC, Mumford KL, Patel UA, Newbury SF, Crane-Robinson C. Characterization of an SRY-like gene, DSox14, from Drosophila. Gene. 2001;272(1–2):121–129. doi: 10.1016/S0378-1119(01)00557-1. [DOI] [PubMed] [Google Scholar]
- Wang Y, Ristevski S, Harley VR. SOX13 exhibits a distinct spatial and temporal expression pattern during chondrogenesis, neurogenesis, and limb development. J Histochem Cytochem. 2006;54(12):1327–33. doi: 10.1369/jhc.6A6923.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- DeFalco TJ, Verney G, Jenkins AB, McCaffery JM, Russell S, Van Doren M. Sex-specific apoptosis regulates sexual dimorphism in the Drosophila embryonic gonad. Dev Cell. 2003;5(2):205–16. doi: 10.1016/S1534-5807(03)00204-1. [DOI] [PubMed] [Google Scholar]
- Wang R, Cheng H, Xia L, Guo Y, Huang X, Zhou R. Molecular cloning and expression of Sox17 in gonads during sex reversal in the rice field eel, a teleost fish with a characteristic of natural sex transformation. Biochem Biophys Res Commun. 2003;303(2):452–7. doi: 10.1016/S0006-291X(03)00361-9. [DOI] [PubMed] [Google Scholar]
- Katoh M. Molecular cloning and characterization of human SOX17. Int J Mol Med. 2002;9(2):153–7. [PubMed] [Google Scholar]
- Takada S, Mano H, Koopman P. Regulation of Amh during sex determination in chickens: Sox gene expression in male and female gonads. Cell Mol Life Sci. 2005;62(18):2140–6. doi: 10.1007/s00018-005-5270-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chaboissier MC, Kobayashi A, Vidal VI, Lutzkendorf S, van de Kant HJ, Wegner M, de Rooij DG, Behringer RR, Schedl A. Functional analysis of Sox8 and Sox9 during sex determination in the mouse. Development. 2004;131(9):1891–1901. doi: 10.1242/dev.01087. [DOI] [PubMed] [Google Scholar]
- Shoemaker C, Ramsey M, Queen J, Crews D. Expression of Sox9, Mis, and Dmrt1 in the gonad of a species with temperature-dependent sex determination. Dev Dyn. 2007;236(4):1055–1063. doi: 10.1002/dvdy.21096. [DOI] [PubMed] [Google Scholar]
- Wilson M, Koopman P. Matching SOX: partner proteins and co-factors of the SOX family of transcriptional regulators. Curr Opin Genet Dev. 2002;12(4):441–6. doi: 10.1016/S0959-437X(02)00323-4. [DOI] [PubMed] [Google Scholar]
- Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19(12):1572–4. doi: 10.1093/bioinformatics/btg180. [DOI] [PubMed] [Google Scholar]
- Whelan S, Goldman N. A general empirical model of protein evolution derived from multiple protein families using a maximum-likelihood approach. Mol Biol Evol. 2001;18(5):691–9. doi: 10.1093/oxfordjournals.molbev.a003851. [DOI] [PubMed] [Google Scholar]
- Felsenstein J. PHYLIP (Phylogeny Inference Package) version 3. 6. 2004.
- TreeView. http://taxonomy.zoology.gla.ac.uk/rod/treeview.html
- Tübingen Unversity: Algorithms in Bioinformatics: Dendroscope. http://www-ab.informatik.uni-tuebingen.de/software/dendroscope
- Laudet V, Stehelin D, Clevers H. Ancestry and diversity of the HMG box superfamily. Nucleic Acids Res. 1993;21(10):2493–501. doi: 10.1093/nar/21.10.2493. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tribolium castaneum Genome Project. http://www.hgsc.bcm.tmc.edu/projects/tribolium/
- Mosquito. http://www.ensembl.org/Anopheles_gambiae
- NCBI Sea Urchin Genome Resources. http://www.ncbi.nlm.nih.gov/projects/genome/guide/sea_urchin/
- JGI Capitella sp. http://genome.jgi-psf.org/Capca1/Capca1.home.html
- GeneMachine Submission. http://genemachine.nhgri.nih.gov/
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Multiple alignment of honeybee SOX and vertebrate HMG domains. Alignment of the HMG domains from honeybee SOX proteins and vertebrate SOX proteins created in ClustalX.
Multiple alignment of insect SOX HMG box sequences. Alignment of the HMG domains from predicted insect SOX proteins created in ClustalX
Multiple alignment of SOXE full length protein sequences. ClustalX alignment of full-length SOXE proteins from insects and vertebrates.
Naming of identified insect Sox genes. Renamed insect SOX genes (based on phylogenetics) and their protein Genbank accession numbers.






