Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Feb 28.
Published in final edited form as: J Mol Biol. 2008 Jan 16;376(4):938–949. doi: 10.1016/j.jmb.2007.12.037

Poising of E. coli RNA polymerase and its release from the σ38 C-terminal tail for osmY transcription

Adam Z Rosenthal 1, Youngbae Kim 1, Jay D Gralla 1,*
PMCID: PMC2390820  NIHMSID: NIHMS41396  PMID: 18201723

Summary

Bacteria must adapt their transcription to overcome the osmotic stress associated with the gastrointestinal tract of their host. This requires the σ38 (rpoS) form of RNA polymerase. Here, CHIP experiments show that activation is associated with a poise and release mechanism in vivo. A C-terminal tail unique among σ factors is shown to be required for in vivo recruitment of RNA polymerase to the promoter region prior to osmotic shock. CTD tail-dependent transcription in vivo can be mimicked by using the intracellular signaling molecule potassium glutamate in vitro. Following signaling, the barrier to elongation into the gene body is overcome and RNA polymerase is released to produce osmY m-RNA.

Introduction

As bacteria have limited mobility they need to respond rapidly and effectively to environmental stress. Although stress response pathways are diverse, most rely on transcription by RNA polymerase that uses various σ factors other than the major housekeeping factor σ70. The major stress RNA polymerase typically contains the product of the rpoS gene, σ38, a smaller, but closely related σ factor. The σ38 holoenzyme has the potential to transcribe many stress response genes, but each stress induces a unique pattern of expression 1; 2; 3.

As a gastroenteric bacterium, E. coli is subject to diverse stresses and environments, both inside and outside a human host. Many such environments are associated with increased salinity and osmolarity. Examples include the lower gastrointestinal tract of animal hosts, expelled fecal matter and seawater. To avoid the loss of water and survive, E. coli couples increased σ38 transcription of osmo-protective genes with reductions in σ70 transcription of genes that are unnecessary or harmful in hyper-osmotic environments 2; 3; 4; 5; 6.

Hyper-osmolarity and most other stresses lead to increased amount of σ38 protein beyond the low basal level 7. This makes a major contribution to activation. Because stressors yield unique (but overlapping) patterns of transcripts other signaling events must make important additional contributions 3. No sets of “master” repressors or activators have been identified that regulate these groups of promoters. Potassium glutamate, which accumulates rapidly upon osmotic shock, appears to be involved in both activation of σ38 osmotic transcription 8; 9; 10; 11; 12 and repression of bulk σ70 transcription 5.

In the case of the strongly induced osmY promoter, and many other σ38 responsive genes, potassium glutamate strongly activates transcription in vitro. However, potassium glutamate is not required for the binding of σ38 RNA polymerase to the osmY promoter. Supercoiled osmY DNA can be engaged by σ38 RNA polymerase in the absence of potassium glutamate, but the transcription complex is inactive. Potassium glutamate allows the poised RNA polymerase to escape into elongation mode 9. Such a poise and release mechanism of activation has the potential to be quite common in E. coli. A CHIP-CHIP study found that nearly a quarter of all E. coli σ70 promoter transcription complexes consisted of poised RNA polymerases; this raised the possibility that environmental cues might be required to activate RNA polymerase release 13. However, evidence for the physiological significance of poise and release mechanisms is limited. It has not been established in vitro for σ70 RNA polymerase at any of these genes. The osmY poise and release pathway has only been studied using supercoiled DNA in vitro. DNA supercoiling density varies significantly in vivo, including changes induced by stresses met via σ38 2; 14; 15; 16; 17, so the relevance of the mechanism in vivo is not assured.

The events responsible for activation of osmotic promoters are not well characterized. Several lines of evidence point to the central involvement of the C-terminal region of σ38 in osmotic induction. Mutations in the σ38 CTD alter osmotic induction of transcription 18; 19. The CTD consists of 2 regions, a DNA-binding region that resembles σ70 and a C-terminal non-conserved region (see below). The DNA-binding segment of the CTD can contact -35 DNA 20; 21, which at σ38 promoters is very poorly conserved 3; 22; removal of this DNA sequence at several osmotic promoters strongly reduces transcription 19; 23. At the osmY promoter σ38 RNA polymerase appears to contact this -35 DNA and then makes extensive contacts with DNA further upstream 9. In vitro, potassium glutamate disrupts these far upstream contacts, which is thought to contribute to the release of σ38 RNA polymerase for transcription. The role of the σ38 CTD in establishing these upstream contacts and in contributing to the regulation of initiation is very unsettled.

Given the degree of uncertainty about the osmY induction mechanism and the possible general relevance of the proposed poise and release mechanism, we have undertaken studies of its nature and relevance in vivo. To learn whether poise and release can occur in vivo CHIP studies are used to look directly for poised RNA polymerases at the osmY promoter and at their potential release upon hyper-osmotic shock. The role of the CTD of σ38 in activation is also addressed in CHIP studies. An integration of in vivo studies with those using potassium glutamate to activate in vitro is attempted. The outcome strongly supports the relevance of the osmY poise and release mechanism and extends our knowledge of the role of the σ factor in directing it.

Results

RNA polymerase collects near the osmY promoter prior to osmotic stress

Chromatin immunoprecipitation (ChIP) was used to explore whether RNA polymerase occupies the osmY promoter in vivo prior to any osmotic stress. CHIP has been used successfully for genome-wide studies and has been applied to individual genes 24. The procedure is commonly used to give a snapshot of protein:DNA complexes in vivo. The cellular complexes are cross-linked by adding formaldehyde to cells and shearing the chromosome to obtain smaller than gene size fragments with attached proteins. DNA fragments containing RNA polymerase are collected using antibody against the core beta′ subunit. To determine how much osmY DNA is bound by RNA polymerase, the DNA is de-proteinized and the amount of osmY DNA is determined by quantitative PCR. Our procedure follows that described previously for individual σ70 and σ38 transcription units. 25 The only modifications were minor changes in the growth conditions and the protocol for DNA shearing.

Samples of E. coli are grown in rich media to an approximate OD600 of 0.8, corresponding to late exponential phase, where σ38 levels are just beginning to rise. The samples are cross-linked, immuno-precipitated to collect RNA polymerase and attached DNA, the DNA is released and then the amount of the sample that consists of osmY DNA is determined by use of specific primers in quantitative PCR. The goal is to compare the amount of RNA polymerase associated with DNA near the osmY promoter to the amount within the transcribed osmY gene body.

To do this, two pairs of primers were used, each yielding a 190 base pair product. One pair (called the “promoter” pair) is centered at the osmY promoter and extends beyond it within the non-coding leader region (see figure 1, bottom panel). The other pair (termed “downstream”) is centered on the transcribed region within the coding gene body located approximately 700 nucleotides beyond the transcription start site. As the 2 PCR (P and D in figure 1) products are the same size and are amplified from the same immuno-precipitated sample any differences in signal should reflect differences in the numbers of associated RNA polymerases at the time of cross-linking in vivo. The results are typically taken to represent a snapshot of average density of RNA polymerases within each region during the steady-state situation that applies in vivo.24

Figure 1. RNA polymerase is poised at the osmY promoter region prior to osmotic stress, and can be released upon addition of salt.

Figure 1

Open in a new tab

A. CHIP in late exponential phase at the osmY promoter. Gray bars denote samples enriched with β′ antibodies. Black bars denote the no antibody negative control. The results in the promoter and downstream gene body are indicated.

Inset: Transcription of osmY is induced by osmotic stress. A radiograph comparing the osmY in vivo mRNA levels before (lane 1) and after (lane 2) salt stress as assayed by primer extension using an radio-labeled primer to osmY.

B. CHIP after the addition of 400 mM NaCl for 8 minutes. Gray bars denote samples enriched with β′ antibodies. Black bars denote no antibody negative control.

Shown below is a schematic of the locations of the 190 base pair PCR fragments used for CHIP analysis. The promoter fragment (P) is centered near the transcriptional start site (+1) and overlaps with the long untranslated leader region. The downstream fragment (D) is centered near position +700 and is wholly included within the osmY gene body (boxed).

The quantitation of the promoter fragment showed an enrichment when using beta′ antibody (gray bar at left in figure 1A; 0.65% of input, comparable to prior CHIP enrichments 26) compared to controls lacking antibody (dark bar; less than 0.05% of input). When normalized to the signal at this uninduced promoter (set at 100% relative signal in figure 1A) this background signal is less than 5% of the experimental signal. We infer that detectable amounts of RNA polymerase specifically cross-links to the osmY promoter region fragment in the absence of osmotic stress.

The same samples were probed in parallel using primers that quantified the amount of RNA polymerase within the downstream osmY gene body. In this case the amount of cross-linked DNA was significantly less, approximately 35% of the uninduced promoter signal strength (gray bar in Figure 1A, right). The background signal was again low (black bar in figure 1A, right). We conclude that there is approximately a 3 times greater RNA polymerase density associated with the osmY promoter fragment compared to the downstream gene body fragment. Prior CHIP experiments that show a very similar pattern interpreted the excess RNA polymerase associated with the promoter region to be poised there 13, consistent with the poising observed previously in vitro at the osmY promoter 9.

Release of RNA polymerases into the osmY gene body upon osmotic stress

To learn if osmotic stress triggers the release of RNA polymerases from the promoter region into the gene body the CHIP experiments were repeated 8 minutes after the addition of 400mM NaCl. The addition of this concentration of salt is known to induce the osmotic transcription program 2; 27 which is confirmed by osmY m-RNA measurements before and after the addition of salt (figure 1A inset). An 8 minute time frame was chosen because it is long enough for transcriptional induction of osmY, yet not so long as to allow the unchallenged cells to reach much higher optical density than the challenged cells. CHIP experiments have not been reported previously in the presence of added salt. The time of sonication required to give equivalent DNA shearing was slightly shortened in salt stressed samples. However, the total amount of DNA recovered after immuno-purification was not significantly different from that obtained in the absence of salt, indicating that salt does not grossly interfere with cross-linking. The CHIP experiment assays the amount of RNA polymerase associated with osmY promoter and gene body regions to compare directly to the results obtained prior to osmotic shock.

The results (figure 1B) show that the distribution of RNA polymerases changes after osmotic shock. Instead of RNA polymerase collecting at the osmY promoter, as occurs prior to shock (figure 1A), the RNA polymerases now occur at roughly equal densities within the promoter and gene body (gray bars in figure 1B). That is, the addition of NaCl to the culture media has effected a re-distribution of RNA polymerases from the promoter region to the gene body. We infer that osmotic stress increases the probability that RNA polymerase will be released into elongation mode.

The data also shows that a greater amount of RNA polymerase is associated with the promoter region after osmotic shock (approximately 4 times greater than the uninduced comparison). Hyper-osmotic shock is known to increase the total amount of σ38 within the cell 7; 10; 28 and this was confirmed under the conditions of this experiment (data not shown). We suspect that the increase in promoter occupancy is a consequence of the greater amount of σ38 holoenzyme present after addition of salt.

Taken together these 2 observations suggest the following effect of an increase in external osmolarity on osmY transcription. During unstressed growth some RNA polymerase is at or near the osmY promoter and little leaks into the gene to transcribe. Upon addition of salt the restriction that poises RNA polymerase there is relieved, allowing it to be released for elongation of transcript. In addition, because under osmotic conditions a higher level of RNA polymerase is present in both promoter and downstream regions it is apparent that more RNA polymerases have been recruited to initiate osmY transcription. In this view salt has 2 effects that jointly activate; salt leads to the production of more σ38 holoenzyme that can be recruited to the osmY promoter region and also facilitates the ability of these RNA polymerases to initiate and be released into elongation mode.

Activation of RNA polymerase in vivo in the absence of increasing σ38 levels

The above model suggests that there are independent contributions to activation made by the increase of σ38 levels and by other effects of salt. When σ38 is expressed from a heterologous plasmid-based promoter the increase in levels induced by increase in osmolarity have been reported to be nearly abolished, presumably by a lack of effective translational control 29. This would allow one to assess osmY activation by salt in the absence of higher σ38 levels. Figure 2A shows that osmY transcription can be activated by salt when σ38 is expressed from a plasmid in cells lacking σ38 on the chromosome (lane 1 vs 2). The level of σ38 in the cell is not increased after the addition of salt (Figure 2B). The data demonstrate that osmY transcription is induced by osmotic upshift in the absence of increasing σ38 protein levels.

Figure 2. Plasmid expressed σ38 induces osmotic transcription at the osmY promoter by releasing RNA polymerases for elongation.

Figure 2

Open in a new tab

A. in vivo osmY mRNA levels before (lane 1) and after (lane 2) salt stress.

B. σ38 protein levels from plasmid expression before (lane 1) and after (lane 2) salt stress.

C. CHIP in a σ38 plasmid expression context prior to salt shock. Gray bars denote samples enriched with β′ antibodies. Black bars denote no antibody negative control. The results in the promoter and downstream gene body are indicated.

D. CHIP after the addition of 400 mM NaCl for 8 minutes. Gray bars denote samples enriched with β′ antibodies. Black bars denote no antibody negative control.

We repeated the CHIP experiments in this context to see if RNA polymerase was still poised when expression was via a plasmid. Figure 2C shows that under non-stressed conditions the signal at the promoter (gray bar at the left) is far above the background signal in the absence of RNA polymerase antibody (dark bar). This indicates that some RNA polymerase has also collected at the promoter in this plasmid expression-based system. The amount of polymerase present downstream of the promoter is approximately 35% of the amount a the promoter (gray bar at the right of Figure 2C) but still well above background levels (dark bar). Overall, the data are very similar to those obtained when σ38 is expressed from the chromosome (figure 1A). The high ratio of RNA polymerase at the promoter compared to within the gene is consistent with the accumulation of poised RNA polymerases under non-stressed conditions.

The experiment was repeated after addition of salt. Figure 2D shows that osmotic shock leads to the preferential accumulation of RNA polymerase within the downstream gene body at the expense of the promoter (see gray bars). That is, in contrast to the situation pertaining prior to salt induction (figure 2C) RNA polymerase appears to flow more freely out of the promoter and into elongation, indicating that osmotic shock helps release poised RNA polymerases.

We note that the amount of RNA polymerase at the osmY promoter appears to decrease slightly after osmotic shock (to the 67% level comparing the promoter in figures 2C and D). This minimal change contrasts with the 4-fold increase seen when expression of σ38 is in its normal chromosomal context (figure 1AB). The difference is likely due to plasmid-based expression not leading to an increase in σ38 levels, as occurs in the chromosomal context (figure 2B). Note, however that the signal at the promoter in stressed cells tested via plasmid expression is significantly less than that from chromosomal expression (figures 1B and 2D). This is surprising because there is several-fold more σ38 in the plasmid context (not shown); we don’t know why plasmid-based expression seems to be less efficient at directing RNA polymerase to the promoter, but apparently not all the plasmid expressed protein is available to support promoter binding. Nonetheless, the data as a whole confirm that salt treatment of cells can relieve the restriction on release of RNA polymerases poised at the osmY promoter.

The non-conserved σ38 CTD is generally required for osmotic transcription in vivo

Several lines of evidence have implicated the C-terminal region of σ38 as a central player in osmY transcription. These include genetic 19, in vitro transcription 18; 30 and footprinting studies 9. Both conserved and non-conserved regions of the CTD have been proposed to be involved. The C-terminal domain of σ38 contains residues that are quite similar to those of σ70 in conserved region 4 that contacts DNA 20 (shaded in figure 3A). Beyond amino acid R 314 the sequences diverge and are not obviously related. To investigate systematically the role of the CTD in vivo a series of C-terminal truncations were constructed; these progressively shortened the nonconserved region. The loss of CTD tail residues did not change the expression levels of σ38 protein, either before or after salt induction (figure 3B).

Figure 3. Residues near Q320 of the σ38 CTD are critical for in vivo transcription of σ38 promoters.

Figure 3

Open in a new tab

A. Sequence comparison of the CTDs of E. coli σ70 and σ38. Areas of highest conservation are shaded.

B. Western blot of σ38 and truncated variants 1-319 and 1-314. Lane 1, 3, and 5 show the amount of σ38 protein under non-osmotic conditions for full length, 1-319, and 1-314 variants, respectively. Lanes 2, 4, and 6 show the amount of σ38 after addition of salt for full length, 1-319, and 1-314 variants.

C. osmY m-RNA under osmotic conditions. Cells were grown to late exponential phase and osmotically induced by the addition of 400mM NaCl. Full-length σ38 (FL) and truncated variants 1-322, 1-320, and 1-319 are shown.

D. In vivo transcription using σ38 CTD truncations on 5 σ38 promoters. The endpoint of each truncation is shown below the graph. In each set the promoters used from left to right were: cfa, otsB, gadA, gadB, and osmY. Transcription is normalized to the full-length in each set.

These truncated versions of σ38 were tested for their ability to support salt-activated transcription in vivo in a context lacking chromosomally expressed protein. In initial experiments 4 versions of σ38 were tested for support of osmY m-RNA synthesis: 1-330 (full length protein), 1-322, 1-320 and 1-319. The results show that truncation protein 1-322 supports wild type levels of osmY m-RNA, but the more extensive truncations support reduced transcription (figure 3C). In the absence of salt transcription was very low for all constructs and essentially undetectable for 1-320 and 1-319 (not shown). A more extensive set of σ38 truncations were made and assayed for osmY m-RNA in vivo (black bars in figure 3D). The shortest deletion to show a significant loss of activity is 1-320 and removal of most of the non-conserved tail leads to a nearly total loss of osmY activity (construct 1-316). Overall, the data demonstrate that amino acids at or near position Q320 are important for osmY transcription. We note that this residue and the region surrounding it is non-conserved compared to σ70 (figure 3A).

To learn if the requirement for this region of the σ38 CTD is general or specific for osmY, m-RNA was assayed for several other salt-inducible promoters. This basically involves dividing common preparations of cellular RNA and assaying with different gene-specific primers. The collective results for the osmY, otsB P1, gadA. gadB and cfa P2 promoters are shown in figure 3D. In aggregate, the data show that the majority of transcription is lost at all promoters when using truncations in the series from 1-321 to 1-318. (The levels of transcription in the absence of salt ranged from very low to not detectable for these constructs.) There are some differences in how sensitive different promoters are to truncation within this region, but for all promoters the small segment is required to maintain significant transcription levels. This highlights the general importance of the tail residues surrounding amino acid Q320 for general salt-induced transcription.

The role of the σ38 non-conserved CTD as assessed by ChIP

The general requirement for a small segment of the σ38 CTD for transcription could have several sources. Two prominent possibilities would be a role in recruiting RNA polymerase to the promoter or a role in allowing a poised RNA polymerase to escape into elongation mode. To evaluate these possibilities CHIP studies were done using selected CTD truncations. These compared the full length 1-330 protein with truncations 1-319 and 1-314. 1-319 was chosen as it is the first truncation in which a majority of transcription is lost (see figure 3D). 1-314 removes the entire non-conserved region and is essentially transcriptionally inactive 18. The experiments basically followed the procedure described above for wild type protein expressed from a plasmid in cells lacking chromosomally expressed σ38.

The role of the σ38 CTD in bringing RNA polymerase to the osmY promoter was assessed using CHIP assays of unstressed cells. Figure 4A compares the amount of RNA polymerase brought to the osmY promoter by the 3 versions of σ38. The data show a progressive reduction in RNA polymerase occupancy as the CTD is progressively shortened. Specifically, the 1-319 protein binds at the 40% level and the 1-314 protein binds at the 30% level compared to the full-length 1-330 σ38. The comparisons show that the CTD tail has a role in directing uninduced promoter occupancy by σ38 RNA polymerase. When experiments are done in the absence of σ38 (no plasmid) the level of binding is comparable to the 30% binding using the 1-314 construct (not shown). These levels are significantly above the background obtained with no antibody; the result suggests that some RNA polymerase can associate with the osmY promoter in the absence of σ38, perhaps via other σ factors. However, the main point is that truncation of the σ38 CTD leads to a lowering of the amount of RNA polymerase associated with the osmY promoter. It appears that the CTD tail is used to recruit RNA polymerase at the osmY promoter in vivo.

Figure 4. Deletions of the σ38 CTD decrease RNA-polymerase binding in vivo.

Figure 4

Open in a new tab

A. CHIP using full-length σ38 (textured bars), truncations 1-319 (black bars) and 1-314 (gray bars), and the σ38 null strain not supplemented by plasmid expressed protein (checkered bars). The results in the promoter and downstream gene body are indicated.

B. CHIP after salt addition using full-length σ38 (textured bars), and truncations 1-319 (black bars) and 1-314 (gray bars).

The data also help evaluate the role of the CTD tail in directing the release of RNA polymerase from the osmY promoter. When the downstream region is probed, one sees reduced amounts of RNA polymerase within the downstream gene body compared to at the promoter for all 3 proteins (figure 4A). The residual association within the gene body for the truncation mutants does seem to represent escape from the promoter as the level in a σ38 null context is below the 5% level (checkered bars in figure 4A), which could include significant contributions from other forms of holoenzyme. But overall, there is no convincing evidence that truncation of the CTD tail leads to either excess retention of RNA polymerase at the promoter or its promiscuous release into elongation mode. However, minor effects on release cannot be excluded.

Further information comes from repetition of the CHIP experiment after salt induction. Again, the procedure follows that described for wild type σ38, described above. The results are fully consistent with truncation reducing the ability of σ38 to bring RNA polymerase to the osmY promoter. Full length σ38 binding is slightly reduced at the promoter compared to prior to induction (at 67% level; textured bar in figure 4B), while the 2 truncations lead to further reductions (gray and black bars). Induction leads to proportionally less RNA polymerase associated with the downstream gene body in the case of truncated proteins (figure 4B). There appears to be no defect in the ability of those RNA polymerases that bind to the promoter to be released into the gene body by salt treatment. Taken together with the results from unstressed cells the data show that the primary reason that CTD truncations lower transcription is that they fail to bring the full complement of RNA polymerase to the osmY promoter.

The role of the CTD can be reproduced in vitro using potassium glutamate activation

The CTD of σ70 can be used to regulate transcription by serving as a target for activator proteins 31; 32; 33. No such evidence yet exists for σ38 promoters. The results presented here demonstrate a role for the CTD in general σ38 transcription and the CHIP experiments suggest that this role is to recruit RNA polymerase to the osmY promoter. We have previously demonstrated that the osmY promoter can be activated to transcribe in vitro by the addition of potassium glutamate to a system which contains only σ38, core RNA polymerase, NTPs and DNA, without the presence of any additional factors 9. Activation by potassium glutamate has been observed at many promoters but the effect is not universal and some promoters are inhibited 5; 6; 9; 34. We now wish to learn if the in vivo behavior of σ38 CTD truncations can be reproduced by potassium glutamate activated transcription in vitro in the absence of other factors.

The experiment was done using the osmY, cfa and otsB promoters. Each promoter can be activated by potassium glutamate, with maximal transcription occurring between added 300 and 500 mM. This is shown for the osmY promoter in figure 5A, lanes 1–4. Truncation of σ to 1-322 retains the full response (figure 5A, lanes 5–8). Using 400 mM potassium glutamate each of the 3 promoters was transcribed with each of 8 forms of σ38 RNA polymerase. As an example, figure 5B shows that truncation 1-319 is defective at transcribing the osmY and cfa P2 promoters under these conditions. These in vitro results using potassium glutamate activation may be compared to the same data in vivo presented in figure 3C above; they are essentially the same demonstrating that the effect of this CTD truncation is the same in the 2 cases.

Figure 5. potassium glutamate activated transcription in vitro mimics m-RNA production in vivo.

Figure 5

Open in a new tab

A. in vitro transcription of osmY by either full-length σ38 (lanes 1–4) or 1-322 (lanes 5–8). Potassium glutamate was titrated into the transcription reactions: Lanes 1 and 5 have 200 mM; lanes 2 and 6 have 300 mM; lanes 3 and 7 have 400 mM; lanes 4 and 8 have 500 mM.

B. In vitro transcription of osmY and cfa P2 promoters under osmotic conditions comparing full-length σ38 and 1-319.

C. In vitro transcription using σ38 CTD truncations on three σ38 promoters. In each set the promoters are from left to right: cfa P2, osmY, and otsB. Transcription is normalized to the full-length (wt) band in each set.

The full data set for potassium glutamate activated transcription is presented in figure 5C. As the CTD is truncated general reductions are observed beginning with protein 1-321 and extending to protein 1-318. The data may be compared to transcription studies in vivo using the same set of promoters and constructs (figure 3D). Although there are some minor differences the effects of truncation are very similar in vivo and using potassium glutamate to activate in vitro. We conclude that potassium glutamate activation in vitro mimics cellular activation at these promoters; there is no suggestion that activators or repressors are needed to interact with the CTD as part of activation.

The σ38 CTD is required to recruit core RNA polymerase into holoenzyme

These experiments indicate that the effect of the σ38 CTD tail is general rather than promoter specific. This derives from transcription experiments, both in vivo and in vitro. In addition, the CHIP experiments suggest that the CTD is needed to recruit the RNA polymerase to the osmY promoter. Taken together, this raises the possibility that the CTD is required for σ38 to bind core RNA polymerase. Furthermore, the major core binding determinants for σ70 are known and do not rely centrally on the σ70 extreme CTD 35. In that case the contacts between σ and core involve very extensive complementary surfaces. But σ38 and σ70 have completely dissimilar sequences in the extreme CTD (figure 2A) and have different interactions with the CTD as a whole 36 and so a central role of this σ38 region in core binding cannot be excluded. However, a previous report 18 suggested that the CTD was not required for σ38 to bind RNA polymerase. In that study heterologously expressed mutant 314 and wild type proteins were found to cause similar growth defects; this was interpreted to mean that they both were likely to bind core RNA polymerase and hinder growth.

To directly test the role of the extreme CTD in the interaction of σ38 with core a pulldown assay was used. In this assay his-tagged σ38 is pre-incubated with core polymerase. After 10 minutes magnetic Ni-NTA beads are added to the reaction and any σ38 holoenzyme that forms is pulled down. To remove core protein that is not bound tightly to σ 2 washes are carried out. Finally, the proteins are eluted and run on an SDS PAGE gel to observe whether holoenzyme forms. The procedure was modified to include potassium glutamate and no significant effects were seen at 400 mM (not shown).

The procedure was repeated with selected CTD truncations to learn if the CTD is needed for σ38 and core to bind each other and form holoenzyme.

Figure 6 shows the result using wild type protein 1-330 and truncations 1-319 and 1-314. The amount of core is represented by the upper band and the amount of σ by the lower band. The result shows that there is a progressive loss of core binding to σ as the CTD is truncated; 1-319 binds core less well than wild type and 1-314 shows nearly background levels. These results are similar to those obtained in transcription where 1-319 shows partial reductions (figures 3D and 5C) and 1-316 is inactive. The data are also fully consistent with the CHIP results, which showed that the CTD was needed to collect the RNA polymerase and bring it to the osmY promoter, where it is poised to activate transcription. Taken together with the in vitro transcription experiments with potassium glutamate the data suggests, but by no means proves, the view that the release of the poised RNA polymerase for transcription requires no factors other than RNA polymerase itself, DNA and potassium glutamate.

Figure 6. σ38 residues near Q320 are important for holoenzyme formation in vitro His-tagged σ38 was incubated with core RNA polymerase and bound by NTA beads and washed.

Figure 6

Open in a new tab

A silver stain after 8% PAGE is shown. The upper bands represent core (β and β′ subunits) and the lower band are σ38. The length σ38 and 1-319 and 1-314 are compare

Discussion

These CHIP data have provided evidence that hyper-osmotic stress induces a poise and release mechanism that helps activates osmY transcription. The master stress regulator σ38 is shown to contain a unique tail element that recruits RNA polymerase to the osmY promoter region in vivo in the absence of stress. The addition of salt to cells is shown to cause the release of RNA polymerase from this region into the main gene body for transcription. We show that tail-dependent transcription in vivo can be mimicked in vitro by the addition of potassium glutamate; this compound is known to accumulate intracellularly when cells are salt-shocked. The activation does not require a macromolecular activator or repressor to interact with the σ38 CTD tail, as can occur with σ70 37; 38. Because CHIP studies have suggested that poising of RNA polymerase may be very common in the bacterial genome 13, the poise and release mechanism has the potential to be of widespread significance. We believe that the poising at osmY is likely by RNA polymerases that are engaged at the promoter and have difficulty escaping because our prior studies found such a state in vitro that could be triggered to support elongation upon addition of potassium glutamate. 9

Hyper-osmotic stress is one of many stresses that are countered by transcription using forms of bacterial RNA polymerase containing σ factors other than the “housekeeping” σ70. σ38 is by far the most common of these as it mediates the response to a very wide variety of stresses. Outside the laboratory stress is likely the norm, as osmotic and other stresses exist normally in the gastrointestinal tract of animal hosts, in expelled fecal matter and in diverse marine environments. The various alternative forms of σ often have overlapping promoter specificities and thus the interplay amongst them can be quite complex 13; 25; 39. That is, the effect of occupying a promoter with one form of RNA polymerase has the consequence of inhibiting recognition by other forms of RNA polymerase. In the example of osmY this means that the poising of σ38 RNA polymerase in the absence of osmotic shock can interfere with inappropriate promoter usage by the other forms of RNA polymerase. It is possible that this type of repression is a significant attribute of the use of poise and release mechanisms. In the case of osmY, potassium glutamate, which triggers release, is an osmotic-specific signal, but other poised RNA polymerases could respond to other environmental cues.

The current data show that the CTD tail of σ38, which is directly adjacent to the -35 binding region and is not at all related to σ70, is needed to bind RNA polymerase and recruit it to the osmY promoter. This was unexpected in view of prior growth rate experiments 18 that were interpreted as suggesting that the tail was not needed for this function. Nonetheless, in a direct test, the short CTD segment was removed from σ38 and then RNA polymerase failed to bind in a pull-down assay. The same simple mutant severely reduced polymerase binding to osmY in vivo, as measured by the CHIP assay. By contrast, σ70 does not rely centrally on a single determinant as it has an extensive surface that helps it attract core polymerase and bind it tightly 35. Even though σ38 overall binds core much less well than σ70 40, its ability to bind the beta flap near the promoter -35 region is much stronger than that of σ70 41. Thus, it appears that σ38 differs from σ70 in that it has evolved to rely primarily on a localized determinant for forming RNA polymerase holoenzyme.

This reliance on a localized σ38 CTD determinant for making effective contact to core could possibly play a central role in the osmotic control mechanism. The adjacent region of the CTD has been implicated in induction and contacts -35 DNA 9; 18; 19; 20; 21. The network of interactions between the σ factor, the -35 DNA and the RNA polymerase core 42 is typically disrupted to effect the release of core into elongation mode43. The extreme localization of core binding determinants within this network in the case of σ38 may allow potassium glutamate to easily switch the network to an alternate state and release the poised RNA polymerase upon accumulation after osmotic shock.

The osmY promoter is subject to repression by global transcription factors Lrp, CRP and IHF and global regulators such as H-NS and Fis co-regulate other osmotic promoters 44. At the osmY promoter, lrp and IHF are reported to repress from locations centered more than 50 base pairs upstream from the promoter -35 region 44, well beyond the normal range of repressor action by steric hindrance 45. We showed previously that supercoiled DNA can poise σ38 RNA polymerase in an inactive complex at the osmY promoter in vitro and in doing so the upstream DNA appears to wrap around the RNA polymerase9. It is possible that this mechanism of poising makes the promoter a potential target for somewhat remote regulation that interferes with the ability to wrap DNA.

Under non-stressed conditions the amount of σ38 7; 28 and other alternative members of the σ70 family is quite low. One expects that the amounts of holoenzyme could be even lower as σ70 has the highest affinity for core. The effect of poising RNA polymerase at the osmY promoter could be a way to collect limited σ38 holoenzyme at this promoter to mark it for selective activation in vivo upon receipt of the osmotic signal. σ54 promoters are also bound by poised RNA polymerases, although in these cases the signaling is via macromolecular activators 46. By contrast, E. coli σ70 RNA genes have not yet been shown to be subject to poise and release mechanisms. However, the potential clearly exists; viruses regulate σ70 holoenzyme in this manner (for example 47) and slow promoter escape 48 can limit the σ70 transcription rate in vivo 49; 50. The use of genomic probing methods such as CHIP 13; 24; 25; 39 has provided unexpected insights into mechanisms in vivo and the combination of such studies with in vitro reconstruction, as done here for osmY, is needed to discover the extent of the variety of transcription mechanisms used by E. coli and other bacteria.

Materials and Methods

Plasmids and proteins

Plasmids carrying cfa P2, otsB P1, and osmY promoters were previously described 19. Plasmid pRpoS 51, was mutated to remove the C-terminal His tag by addition of an ochre stop codon (TAA) after amino-acid 330 of σ38 and its truncations were used for in vivo experiments (Invitrogen). Plasmid pETF 52 was used for purification of N-terminally HIS tagged full-length and truncated σ38 for in vitro experiments.

Truncations of the CTD of σ38 (rpoS) were constructed by site specific insertion of stop codons into the desired sites on plasmids pETF and pRpoS as described in the Quikchange site directed mutagenesis protocol (Invitrogen). σ38 proteins were purified as described 51.

Media and growth conditions

Escherichia coli K12 (from the ATCC) was used for chromosomal ChIP experiments. In plasmid expression experiments a σ38 null derivative of E. coli K12, RJ4099, was used 53. Bacteria were grown overnight in 5 ml of Luria broth (LB) at 37°C. The cells were diluted 1:100 and grown to an approximate optical density of 0.8. Osmotically challenged cultures were collected 8 min after the addition of 400 mM NaCl.

Chromatin Immunoprecipitations

ChIP experiments were done following the protocol of Raffaelle et al. 25 with slight modifications. Overnight cultures of E. coli were subcultured 1:100 into 100 mL LB media. Upon reaching OD600 of 0.8 the cultures were either crosslinked (1% final concentration of formaldehyde for 10 minutes at room temperature) or 400 mM final concentration of NaCl was added for 8 minutes. If salt was added bacterial samples were crosslinked immediately following the 8 minute salt shock. The crosslinking was quenched by addition of 100 mM glycine for 20 minutes at 4°C. Samples were washed 3 times in TBS buffer, and frozen at −70°C until use.

To process the samples further they were resuspended in 250uL ChIP IP buffer (10 mM Tris-HCl, 300 mM NaCl, 2% Triton X-100) and the DNA was sheared with a Bioruptor (Diagenode) water bath sonication system. All sonications were done in a 4°C water bath. Non-stressed samples were sonicated 8 times for 30 seconds, while salt stressed samples were sonicated for 7 times 30 seconds, yielding average DNA fragments of approximately 500 bp in length, as determined by agarose gel electrophoresis. After sonication an additional 500 uL of ChIP IP buffer was added, and cellular debris were removed by centrifugation, and the lysates were pre cleared by incubation with protein G beads for 3 hours. 50 uL of the original sample was saved as a total DNA input control, and the remaining sample was split and Immunoprecipitated by β′ antibody (Neoclone® catalog number W0001) or used as a mock experiment without the presence of antibody. Samples were incubated for 1 hr at 4°C with 30 uL of Protein G Sepharose beads. Washes of the IP reactions consisted of two washes each with IP buffer, High Salt IP buffer (600 mM NaCl, 100 mM Tris-HCl, 2% Triton X-100), LiCl buffer (250 mM LiCl, 100 mM Tris-HCl, 2% Triton X-100, and one final wash with buffer TE to remove the salts. The beads were eluted in ChIP elution buffer (150 μl of TE buffer with 1% SDS) by overnight incubation at 65°C. Eluted DNA fragments were purified using a qiagen PCR purification kit.

Primers of 24 bp length for the osmY promoter (TCCCTTCCTTATTAGCCGCTTACG; ATCGGTAGAATGACAATCGACGGC) and the osmY gene body (ACACCGCCACCACCAGTGAAATCA; CGCTTTTCACACCATCTACCGCTT) were designed to have an equal amplification product length to avoid differences in fluorescent intensity. The primers to the promoter were centered around the promoter, and the downstream primers were approximately 700 nucleotides after the transcription start site. Each pair of primers was tested for melting temperature, specificity, and amplification efficiency and were found to be specific for osmY and suitable for ChIP assays (each having an E factor greater than 1.75, determined according to 54). Quantification of ChIP signal was done using a Qiagen Quantitect SYBR Green PCR kit and an ABI 7300 qPCR instrument. Duplicate or triplicate qRT PCR reactions were used for each data point. All ChIP values reflect the percent of DNA pulled down as compared to input DNA collected before antibody immunoprecipitation. Each Chip experiment from chromosomally expressed σ38 and full length σ38 expressed from the chromosome was repeated at least 4 separate times. Each experiment using truncated σ38 was repeated at least twice.

In vitro transcription

In vitro transcription experiments were as described 9. 200 nM σ38 and 50 nM core RNA polymerase were pre-incubated at 37 °C for 10 min in 1x buffer B (50 mM Tris-HCl at pH 7.9, 3 mM MgCl2, 1 mM EDTA, 1 mM DTT, 100 μg/ml BSA, variable amount of potassium glutamate as indicated). Unless otherwise indicated 400 mM neutralized potassium glutamate was present. 2.5 nM of supercoiled plasmid DNA was then added and the incubation continued for 15 min. 200 μM of NTP mix (50 μM ATP, 50 μM TTP, 50 μM GTP, 10 μM CTP, and 200 nCi P32 labeled CTP) was then added. After 12 min the reaction was stopped and samples were run on 6% PAGE with 1x TBE at 21 Watts for 70 min. Radioactive bands were visualized and quantified by phosphorimager analysis. Each experiment was conducted at least 3 times. Core RNA polymerase was from Epicentre.

In vivo m-RNA

Primer extension experiments were as described 19. E. coli K12 (from the ATCC) was grown overnight in 5 ml of Luria Broth with glucose (LB) at 37 °C. The cells were diluted 1:100 and grown to an optical density of 0.5. Osmotic challenge cultures were harvested either immediately before or 10 min after the addition of NaCl to a final concentration of 400 mM. This concentration of NaCl led to a delay in cell growth. Cells were harvested by centrifugation and stored at −70°C. RNA was extracted from the pellets using the Qiagen RNeasy kit. Total amount of RNA of each reaction was normalized, and the RNA from each promoter (osmY, otsB, cfa, gadA, and gadB) was detected by primer extension. Primers for otsB, cfa, and gadB promoter were previously described 19. The osmY primer (AGGGAGAGACTTCACCCTCTACAGAAG) and the gadA primer (CTCCGCGATAGTAGAAATGGCCTTT) were used here for the first time. 10 μl reactions for primer extension analysis contained 10 μg of total RNA, 10 nM labeled primer, reverse transcriptase buffer (Promega), 5 units of reverse transcriptase, and 0.2 mM dNTPs. Urea stop dye was added and samples run at 21 watts on a 6% polyacrylamide sequencing gel. Radioactive bands were visualized and quantified by phosphorimager analysis. RNA samples were prepared at least three separate times, and the average was taken.

Western Blot

The procedure for western blotting for σ38 was as described (14, 15). 50 mls of K12 E. coli and RJ4099 null strain carrying plasmids expressing either full-length or truncated versions of σ38 were grown O.D.600 of 0.8. All plasmid expressing samples were grown in LB media without the addition of IPTG. Samples of each strain were then split into 2 separate tubes. One sample was spun down and kept frozen for subsequent protein measurements and NaCl was added to the remaining sample to a final concentration of 400 mM and the sample was left to incubate at 37° C for 8 minutes. Total cellular protein was extracted from sonicated cells and samples were diluted so that the overall total of protein would be the same for each sample. The σ38 antibody was from NeoClone. The goat anti-mouse immunoglobulin G conjugated with Horseradish Peroxidase was from Promega.

Core pulldown assay

3 ug of N-terminally his tagged σ38 or truncated variants were incubated with 1.5 ug of core RNA polymerase (Epicentre) for 10 minutes at room temperature to allow holoenzyme formation. 10 ul of NTA magnetic beads suspended NPI-20 buffer (Qiagen) were added to each sample and they were incubated on a rocker at room temperature. After 15 minutes the supernatant was removed and beads were washed twice with NPI-20 buffer. Σ38 and associated core were eluted from the NTA beads with NPI-250 elution buffer, containing 250 mM imidazole. SDS loading dye was added, and the samples were run on 8% SDS-PAGE. Gels were silver-stained using the Biorad silverstain plus kit.

Acknowledgments

We would like to thank current members of the lab and former members Dr. Michael Fenton and Dr. Yin Lin for help reviewing this manuscript. We are grateful to the laboratories of Dr. Aaseem Ansari, Dr. Arnold Berk and Dr. Guillaume Chanfreau for help with the setup of ChIP experiments. This work was supported by NIH grant USPHS35754.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Arnold CN, McElhanon J, Lee A, Leonhart R, Siegele DA. Global analysis of Escherichia coli gene expression during the acetate-induced acid tolerance response. J Bacteriol. 2001;183:2178–86. doi: 10.1128/JB.183.7.2178-2186.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Cheung KJ, Badarinarayana V, Selinger DW, Janse D, Church GM. A microarray-based antibiotic screen identifies a regulatory role for supercoiling in the osmotic stress response of Escherichia coli. Genome Res. 2003;13:206–15. doi: 10.1101/gr.401003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Weber H, Polen T, Heuveling J, Wendisch VF, Hengge R. Genome-wide analysis of the general stress response network in Escherichia coli: sigmaS-dependent genes, promoters, and sigma factor selectivity. J Bacteriol. 2005;187:1591–603. doi: 10.1128/JB.187.5.1591-1603.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hengge-Aronis R, Lange R, Henneberg N, Fischer D. Osmotic regulation of rpoS-dependent genes in Escherichia coli. J Bacteriol. 1993;175:259–65. doi: 10.1128/jb.175.1.259-265.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Gralla JD, Vargas DR. Potassium glutamate as a transcriptional inhibitor during bacterial osmoregulation. Embo J. 2006;25:1515–21. doi: 10.1038/sj.emboj.7601041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ding Q, Kusano S, Villarejo M, Ishihama A. Promoter selectivity control of Escherichia coli RNA polymerase by ionic strength: differential recognition of osmoregulated promoters by E sigma D and E sigma S holoenzymes. Mol Microbiol. 1995;16:649–56. doi: 10.1111/j.1365-2958.1995.tb02427.x. [DOI] [PubMed] [Google Scholar]
  • 7.Hengge-Aronis R. Signal transduction and regulatory mechanisms involved in control of the sigma(S) (RpoS) subunit of RNA polymerase. Microbiol Mol Biol Rev. 2002;66:373–95. doi: 10.1128/MMBR.66.3.373-395.2002. table of contents. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gowrishankar J, Manna D. How is osmotic regulation of transcription of the Escherichia coli proU operon achieved? A review and a model. Genetica. 1996;97:363–78. doi: 10.1007/BF00055322. [DOI] [PubMed] [Google Scholar]
  • 9.Lee SJ, Gralla JD. Osmo-regulation of bacterial transcription via poised RNA polymerase. Mol Cell. 2004;14:153–62. doi: 10.1016/s1097-2765(04)00202-3. [DOI] [PubMed] [Google Scholar]
  • 10.Ueguchi C, Mizuno T. The Escherichia coli nucleoid protein H-NS functions directly as a transcriptional repressor. Embo J. 1993;12:1039–46. doi: 10.1002/j.1460-2075.1993.tb05745.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Record MT, Jr, Courtenay ES, Cayley DS, Guttman HJ. Responses of E. coli to osmotic stress: large changes in amounts of cytoplasmic solutes and water. Trends Biochem Sci. 1998;23:143–8. doi: 10.1016/s0968-0004(98)01196-7. [DOI] [PubMed] [Google Scholar]
  • 12.Kempf B, Bremer E. Uptake and synthesis of compatible solutes as microbial stress responses to high-osmolality environments. Arch Microbiol. 1998;170:319–30. doi: 10.1007/s002030050649. [DOI] [PubMed] [Google Scholar]
  • 13.Reppas NB, Wade JT, Church GM, Struhl K. The transition between transcriptional initiation and elongation in E. coli is highly variable and often rate limiting. Mol Cell. 2006;24:747–57. doi: 10.1016/j.molcel.2006.10.030. [DOI] [PubMed] [Google Scholar]
  • 14.Balke VL, Gralla JD. Changes in the linking number of supercoiled DNA accompany growth transitions in Escherichia coli. J Bacteriol. 1987;169:4499–506. doi: 10.1128/jb.169.10.4499-4506.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Higgins CF, Dorman CJ, Stirling DA, Waddell L, Booth IR, May G, Bremer E. A physiological role for DNA supercoiling in the osmotic regulation of gene expression in S. typhimurium and E. coli. Cell. 1988;52:569–84. doi: 10.1016/0092-8674(88)90470-9. [DOI] [PubMed] [Google Scholar]
  • 16.Kusano S, Ding Q, Fujita N, Ishihama A. Promoter selectivity of Escherichia coli RNA polymerase E sigma 70 and E sigma 38 holoenzymes. Effect of DNA supercoiling. J Biol Chem. 1996;271:1998–2004. doi: 10.1074/jbc.271.4.1998. [DOI] [PubMed] [Google Scholar]
  • 17.Ohlsen KL, Gralla JD. Interrelated effects of DNA supercoiling, ppGpp, and low salt on melting within the Escherichia coli ribosomal RNA rrnB P1 promoter. Mol Microbiol. 1992;6:2243–51. doi: 10.1111/j.1365-2958.1992.tb01400.x. [DOI] [PubMed] [Google Scholar]
  • 18.Ohnuma M, Fujita N, Ishihama A, Tanaka K, Takahashi H. A carboxyterminal 16-amino-acid region of sigma(38) of Escherichia coli is important for transcription under high-salt conditions and sigma activities in vivo. J Bacteriol. 2000;182:4628–31. doi: 10.1128/jb.182.16.4628-4631.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Rosenthal AZ, Hu M, Gralla JD. Osmolyte-induced transcription: -35 region elements and recognition by sigma38 (rpoS) Mol Microbiol. 2006;59:1052–61. doi: 10.1111/j.1365-2958.2005.04999.x. [DOI] [PubMed] [Google Scholar]
  • 20.Colland F, Fujita N, Kotlarz D, Bown JA, Meares CF, Ishihama A, Kolb A. Positioning of sigma(S), the stationary phase sigma factor, in Escherichia coli RNA polymerase-promoter open complexes. Embo J. 1999;18:4049–59. doi: 10.1093/emboj/18.14.4049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Gaal T, Ross W, Estrem ST, Nguyen LH, Burgess RR, Gourse RL. Promoter recognition and discrimination by EsigmaS RNA polymerase. Mol Microbiol. 2001;42:939–54. doi: 10.1046/j.1365-2958.2001.02703.x. [DOI] [PubMed] [Google Scholar]
  • 22.Lee SJ, Gralla JD. Sigma38 (rpoS) RNA polymerase promoter engagement via -10 region nucleotides. J Biol Chem. 2001;276:30064–71. doi: 10.1074/jbc.M102886200. [DOI] [PubMed] [Google Scholar]
  • 23.Typas A, Hengge R. Role of the spacer between the -35 and -10 regions in sigmas promoter selectivity in Escherichia coli. Mol Microbiol. 2006;59:1037–51. doi: 10.1111/j.1365-2958.2005.04998.x. [DOI] [PubMed] [Google Scholar]
  • 24.Wade JT, Struhl K, Busby SJ, Grainger DC. Genomic analysis of protein-DNA interactions in bacteria: insights into transcription and chromosome organization. Mol Microbiol. 2007;65:21–6. doi: 10.1111/j.1365-2958.2007.05781.x. [DOI] [PubMed] [Google Scholar]
  • 25.Raffaelle M, Kanin EI, Vogt J, Burgess RR, Ansari AZ. Holoenzyme switching and stochastic release of sigma factors from RNA polymerase in vivo. Mol Cell. 2005;20:357–66. doi: 10.1016/j.molcel.2005.10.011. [DOI] [PubMed] [Google Scholar]
  • 26.Wang G, Balamotis MA, Stevens JL, Yamaguchi Y, Handa H, Berk AJ. Mediator requirement for both recruitment and postrecruitment steps in transcription initiation. Mol Cell. 2005;17:683–94. doi: 10.1016/j.molcel.2005.02.010. [DOI] [PubMed] [Google Scholar]
  • 27.Checroun C, Bordes P, Leroy O, Kolb A, Gutierrez C. Interactions between the 2.4 and 4.2 regions of sigmaS, the stress-specific sigma factor of Escherichia coli, and the -10 and -35 promoter elements. Nucleic Acids Res. 2004;32:45–53. doi: 10.1093/nar/gkh155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Muffler A, Traulsen DD, Lange R, Hengge-Aronis R. Posttranscriptional osmotic regulation of the sigma(s) subunit of RNA polymerase in Escherichia coli. J Bacteriol. 1996;178:1607–13. doi: 10.1128/jb.178.6.1607-1613.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Cunning C, Brown L, Elliott T. Promoter substitution and deletion analysis of upstream region required for rpoS translational regulation. J Bacteriol. 1998;180:4564–70. doi: 10.1128/jb.180.17.4564-4570.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Gowrishankar J, Yamamoto K, Subbarayan PR, Ishihama A. In vitro properties of RpoS (sigma(S)) mutants of Escherichia coli with postulated N-terminal subregion 1.1 or C-terminal region 4 deleted. J Bacteriol. 2003;185:2673–9. doi: 10.1128/JB.185.8.2673-2679.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Bhende PM, Egan SM. Genetic evidence that transcription activation by RhaS involves specific amino acid contacts with sigma 70. J Bacteriol. 2000;182:4959–69. doi: 10.1128/jb.182.17.4959-4969.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Hochschild A, Dove SL. Protein-protein contacts that activate and repress prokaryotic transcription. Cell. 1998;92:597–600. doi: 10.1016/s0092-8674(00)81126-5. [DOI] [PubMed] [Google Scholar]
  • 33.Jishage M, Ishihama A. A stationary phase protein in Escherichia coli with binding activity to the major sigma subunit of RNA polymerase. Proc Natl Acad Sci U S A. 1998;95:4953–8. doi: 10.1073/pnas.95.9.4953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Leirmo S, Harrison C, Cayley DS, Burgess RR, Record MT., Jr Replacement of potassium chloride by potassium glutamate dramatically enhances protein-DNA interactions in vitro. Biochemistry. 1987;26:2095–101. doi: 10.1021/bi00382a006. [DOI] [PubMed] [Google Scholar]
  • 35.Sharp MM, Chan CL, Lu CZ, Marr MT, Nechaev S, Merritt EW, Severinov K, Roberts JW, Gross CA. The interface of sigma with core RNA polymerase is extensive, conserved, and functionally specialized. Genes Dev. 1999;13:3015–26. doi: 10.1101/gad.13.22.3015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Colland F, Fujita N, Ishihama A, Kolb A. The interaction between sigmaS, the stationary phase sigma factor, and the core enzyme of Escherichia coli RNA polymerase. Genes Cells. 2002;7:233–47. doi: 10.1046/j.1365-2443.2002.00517.x. [DOI] [PubMed] [Google Scholar]
  • 37.Dove SL, Darst SA, Hochschild A. Region 4 of sigma as a target for transcription regulation. Mol Microbiol. 2003;48:863–74. doi: 10.1046/j.1365-2958.2003.03467.x. [DOI] [PubMed] [Google Scholar]
  • 38.Pande S, Makela A, Dove SL, Nickels BE, Hochschild A, Hinton DM. The bacteriophage T4 transcription activator MotA interacts with the far-C-terminal region of the sigma70 subunit of Escherichia coli RNA polymerase. J Bacteriol. 2002;184:3957–64. doi: 10.1128/JB.184.14.3957-3964.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wade JT, Roa DC, Grainger DC, Hurd D, Busby SJ, Struhl K, Nudler E. Extensive functional overlap between sigma factors in Escherichia coli. Nat Struct Mol Biol. 2006;13:806–14. doi: 10.1038/nsmb1130. [DOI] [PubMed] [Google Scholar]
  • 40.Maeda H, Fujita N, Ishihama A. Competition among seven Escherichia coli sigma subunits: relative binding affinities to the core RNA polymerase. Nucleic Acids Res. 2000;28:3497–503. doi: 10.1093/nar/28.18.3497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Kuznedelov K, Minakhin L, Niedziela-Majka A, Dove SL, Rogulja D, Nickels BE, Hochschild A, Heyduk T, Severinov K. A role for interaction of the RNA polymerase flap domain with the sigma subunit in promoter recognition. Science. 2002;295:855–7. doi: 10.1126/science.1066303. [DOI] [PubMed] [Google Scholar]
  • 42.Geszvain K, Gruber TM, Mooney RA, Gross CA, Landick R. A hydrophobic patch on the flap-tip helix of E. coli RNA polymerase mediates sigma(70) region 4 function. J Mol Biol. 2004;343:569–87. doi: 10.1016/j.jmb.2004.08.063. [DOI] [PubMed] [Google Scholar]
  • 43.Murakami KS, Darst SA. Bacterial RNA polymerases: the wholo story. Curr Opin Struct Biol. 2003;13:31–9. doi: 10.1016/s0959-440x(02)00005-2. [DOI] [PubMed] [Google Scholar]
  • 44.Lange R, Barth M, Hengge-Aronis R. Complex transcriptional control of the sigma s-dependent stationary-phase-induced and osmotically regulated osmY (csi-5) gene suggests novel roles for Lrp, cyclic AMP (cAMP) receptor protein-cAMP complex, and integration host factor in the stationary-phase response of Escherichia coli. J Bacteriol. 1993;175:7910–7. doi: 10.1128/jb.175.24.7910-7917.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Gralla JD. Bacterial gene regulation from distant DNA sites. Cell. 1989;57:193–5. doi: 10.1016/0092-8674(89)90955-0. [DOI] [PubMed] [Google Scholar]
  • 46.Buck M, Gallegos MT, Studholme DJ, Guo Y, Gralla JD. The bacterial enhancer-dependent sigma(54) (sigma(N)) transcription factor. J Bacteriol. 2000;182:4129–36. doi: 10.1128/jb.182.15.4129-4136.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Monsalve M, Mencia M, Rojo F, Salas M. Activation and repression of transcription at two different phage phi29 promoters are mediated by interaction of the same residues of regulatory protein p4 with RNA polymerase. Embo J. 1996;15:383–91. [PMC free article] [PubMed] [Google Scholar]
  • 48.Carpousis AJ, Gralla JD. Interaction of RNA polymerase with lacUV5 promoter DNA during mRNA initiation and elongation. Footprinting, methylation, and rifampicin-sensitivity changes accompanying transcription initiation. J Mol Biol. 1985;183:165–77. doi: 10.1016/0022-2836(85)90210-4. [DOI] [PubMed] [Google Scholar]
  • 49.Sasse-Dwight S, Gralla JD. KMnO4 as a probe for lac promoter DNA melting and mechanism in vivo. J Biol Chem. 1989;264:8074–81. [PubMed] [Google Scholar]
  • 50.Ellinger T, Behnke D, Knaus R, Bujard H, Gralla JD. Context-dependent effects of upstream A-tracts. Stimulation or inhibition of Escherichia coli promoter function. J Mol Biol. 1994;239:466–75. doi: 10.1006/jmbi.1994.1389. [DOI] [PubMed] [Google Scholar]
  • 51.Fenton MS, Lee SJ, Gralla JD. Escherichia coli promoter opening and -10 recognition: mutational analysis of sigma70. Embo J. 2000;19:1130–7. doi: 10.1093/emboj/19.5.1130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Tanaka K, Takayanagi Y, Fujita N, Ishihama A, Takahashi H. Heterogeneity of the principal sigma factor in Escherichia coli: the rpoS gene product, sigma 38, is a second principal sigma factor of RNA polymerase in stationary-phase Escherichia coli. Proc Natl Acad Sci U S A. 1993;90:3511–5. doi: 10.1073/pnas.90.8.3511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Xu J, Johnson RC. aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp. J Bacteriol. 1995;177:3166–75. doi: 10.1128/jb.177.11.3166-3175.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES