Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2008 Mar 11;105(11):4459–4464. doi: 10.1073/pnas.0800958105

A brain-specific SGK1 splice isoform regulates expression of ASIC1 in neurons

Maria F Arteaga 1, Tatjana Coric 1, Christoph Straub 1, Cecilia M Canessa 1,*
PMCID: PMC2393749  PMID: 18334630

Abstract

Neurodegenerative diseases and noxious stimuli to the brain enhance transcription of serum- and glucocorticoid-induced kinase-1 (SGK1). Here, we report that the SGK1 gene encodes a brain-specific additional isoform, SGK1.1, which exhibits distinct regulation, properties, and functional effects. SGK1.1 decreases expression of the acid-sensing ion channel-1 (ASIC1); thereby, SGK1.1 may limit neuronal injury associated to activation of ASIC1 in ischemia. Given that neurons express at least two splice isoforms, SGK1 and SGK1.1, driven by distinct promoters, any changes in SGK1 transcript level must be examined to define the isoform induced by each stimulus or neurological disorder.

Keywords: alternative promoter, Proton-activated channel, serum- and glucocorticoid-induced kinase


SGK1 is a S/T protein kinase expressed in many mammalian tissues. It was originally identified as a glucocorticoid (1) and cell-volume-responsive gene (2). The most extensively studied target of SGK1 is the epithelial sodium channel, ENaC, which plays a crucial role in the regulation of body sodium (3). The phenotype of SGK1-null mice is a partial deficit in renal sodium reabsorption whereby the mice are prone to volume depletion when exposed to a low-salt diet (4). There is substantial evidence that SGK1 also works in the signaling pathways increasing cell survival and apoptosis in vertebrates (5) and in the nematode Caenorhabditis elegans (6).

The functional role of SGK1 in the mammalian nervous system has been explored by numerous studies that have reported increases in SGK1 transcript induced by diverse stimuli and conditions. High levels of SGK1 mRNA have been observed in ischemia (7), injury (8), in various animal models of Parkinson's disease (9, 10), amyotrophic lateral sclerosis (11), Rett syndrome (12, 13), Huntington's disease (14), and in the dorsal horn of the spinal cord after induction of inflammation in the corresponding innervated peripheral tissues (15).

Recent studies have started to probe the functional effects of elevated SGK1 expression in neurons of the central nervous system. The current evidence points to a role of SGK1 in activity-dependent facilitation of learning and memory formation (16, 17), consolidation of long-term memory (18), facilitation of expression of long-term potentiation in hippocampal neurons (19), and modulation of synaptic plasticity in the dorsal horn of the spinal cord (15).

The capacity of SGK1 to modulate expression of ion channels and transporters at the plasma membrane of many cell types (20) also provides a means to alter membrane excitability in neurons. This prompted us to further investigate SGK1 in the nervous system. Here, we report a splice isoform, SGK1.1, exclusively expressed in the nervous system. We describe the distinct features, transcriptional regulation, and functional effects of SGK1.1 in neurons.

Results

SGK1 Splice Isoforms and Distribution in Mouse Brain.

Hitherto, it was thought that the SGK1 gene spanned ≈6 kb, a segment of genomic DNA that contains the promoter and all of the exons of the reference sequence transcript of SGK1. However, the GenBank database (National Center for Biotechnology Information) reports two additional full-length human and mouse SGK1 cDNAs. These cDNAs differ from the canonical one at the 5′ end. The gene spans ≈118 kb, with the additional exons located far upstream of the initially identified 5′ end. These exons are differentially spliced to give rise to three different transcripts designated here as SGK1, SGK1.1, and SGK1.2. Fig. 1A shows a schematic representation of the exon–intron organization of the mouse SGK1 gene. The N termini of the three splice isoforms are encoded by different exons, whereas they share an identical catalytic domain and C-terminal hydrophobic motif (exons 6–16).

Fig. 1.

Fig. 1.

Schematic of the SGK1 gene, differential expression, and distribution of isoforms. (A) The SGK1 gene expands ≈100 kb. White and blank boxes indicate 5′ and 3′ untranslated regions and exons; line represents introns. Arrows and arrowheads indicate positions of qPCR primers and the in situ hybridization probe specific for the SGK1.1 isoform. The gene contains at least three isoforms with corresponding promoters located upstream of exon 1, intron 3, and intron 4 for transcription of SGK1.1, SGK1.2, and SGK1 (canonical isoform), respectively. The SGK1 promoter contains a GRE. (B) Amino acid sequence of the N termini of SGK1 isoforms; intron–exon boundaries are indicated with arrows. Polybasic motif (+) with large hydrophobic residues (Δ) in the N terminus of SGK1.1 is shown above the protein. (C) qRT-PCR of mouse tissues normalized to the value of SGK1.1 in brain ± SD. Comparison of SGK1 and SGK1.1 in mouse brain. (D) Expression of SGK1 and SGK1.1 transcripts examined by qRT-PCR of N1E-115 cells treated with dexamethasone or increasing external K+ concentration to 50 mM. Each bar is the mean of six experiments normalized to GAPDH ± SD. (E) In situ hybridization of mouse brain and cerebellum with SGK1.1-specific antisense and sense probes. e1 antisense and e2 sense probe on brain and e3 antisense and e4 sense probe on cerebellum are shown.

The region upstream of exon 1 contains signature sequences consistent with a TATA box ≈1 kb and 0.7 kb from the initiation site. A different promoter in intron 4 controls transcription of the canonical SGK1 isoform. This is the only promoter that has been characterized experimentally (21); it contains a TATA box near the start site of transcription and a glucocorticoid-responsive element (GRE), consistent with the observation that glucocorticoids increase mRNA abundance of the canonical isoform in most tissues. No GRE was identified in the 10 kb upstream of exons 1 or 4.

Tissue distribution and relative abundance of SGK1.1 isoform were examined by quantitative (q)RT-PCR of mouse tissues. SGK1.1 mRNA was detected exclusively in brain; in all other tissues examined expression was negligible (Fig. 1C Left). Similar experiments conducted with SGK1.2 primers showed very low expression in all tissues; therefore, we did not pursue further studies with this isoform. In brain, expression of SGK1.1 transcript was ≈1/10 of the level of SGK1 (Fig. 1C Right).

Transcriptional regulation of the SGK1.1 isoform was examined by qRT-PCR in differentiated neuronal mouse B1E-115 cells exposed to dexamethasone or to depolarization (by increasing the concentration of K+), a method that simulates neuronal activity. Depolarization increased SGK1.1 transcript, whereas dexamethasone did not induce a significant change in mRNA levels of any isoform (Fig. 1D).

Distribution of SGK1.1 in brain structures was analyzed by in situ hybridization using a probe specific for the SGK1.1 splice isoform. Low magnification of a brain section shows staining of all regions of hippocampus, dentate gyrus, and cerebral cortex layers. A cerebellum section shows staining of Purkinje cells and granular layer (Fig. 1E). Comparison of the SGK1.1 isoform with the distribution of SGK1 by in situ hybridization published online by the Allen Institute for Brain Science (www.brain-map.org) indicates overlap of expression of SGK1.1 and SGK1 in most areas of the mouse central nervous system.

SGK1.1 Is the Most Abundant Protein Isoform in Brain.

The relative abundance of SGK1 and SGK1.1 proteins was determined by quantitative Western blot analysis of mouse tissues. In previous work, we demonstrated that the abundance of SGK1 protein is lower than expected from the level of its own transcript. This disparity is due to rapid degradation by the ubiquitin/proteasomal system (22). We used a transgenic mouse strain with insertion of a bacterial artificial chromosome (BAC) containing the whole-mouse SGK1 gene (≈200 kb) modified by the addition of three HA epitopes at the C terminus of the coding region (23). In tissue homogenates of brain, heart, and lung, we identified SGK1 (49/45 kDa) and SGK1.1 (60 kDa) only in brain (Fig. 2A).

Fig. 2.

Fig. 2.

Expression of SGK1.1 in mouse tissues and calculation of protein half-life. (A) Relative abundance of SGK1 and SGK1.1 proteins in tissues of an SGK1-BAC transgenic mouse (TG) and wild-type littermates (WT). All isoforms of SGK1 were first immunoprecipitated (IP) with a polyclonal antibody directed to the C-terminal 3× HA tag of the protein, followed by immunoblotting (WB) with anti-HA monoclonal Ab. Asterisks indicate the expected molecular mass of SGK1.1 (*) and SGK1 (**). (B) Half-life of SGK1.1 and SGK1 calculated by pulse–chase with [35S]methionine. The graph represents the mean of densitometric values from three independent experiments ± SD.

The relative high protein abundance of SGK1.1 in brain when compared with its low mRNA level suggests that it might be more stable than the canonical SGK1. We confirmed by pulse–chase experiments that the half-life of SGK1.1 is longer (t1/2 > 180 min) than the one previously determined for SGK1 (t1/2 of 28 min) (Fig. 2B). The high stability of SGK1.1 protein is due to the absence of the proteasomal degradation signal in the N terminus of SGK1.

SGK1.1 Resides at the Plasma Membrane by Binding to PtdIns(4,5)P2.

Cellular localization of SGK1.1 was examined by immunofluorescence of CHO cells cotransfected with SGK1.1-V5 and PH-GFP, a fusion of GFP and the pleckstrin-homology domain of phospholipase Cδ, which selectively binds PtdIns(4,5)P2. Fig. 3A shows colocalization of the two proteins at the plasma membrane. Hydrolysis of PtdIns(4,5)P2 by activation of phospholipase C produced rapid and almost complete translocation of both PH-GFP and SGK1.1 to the cytosol (Fig. 3B). These results suggest that SGK1.1 binds PtdIns(4,5)P2. To define this interaction more specifically, we cotransfected SGK1.1-RFP (fusion of DsRed-monomeric fluorescent protein to the carboxyl terminus of SGK1.1), Lyn11-FRB (a membrane anchored domain of mTOR that binds rapamycin, FRB), and CF-Inp (a fusion of cyan fluorescent protein, the domain of FK506 that binds rapamycin (FKBP), and the yeast inositol polyphosphate 5-phosphatase that cleaves the phosphate at the 5 position of PtdIns(4,5)P2) (24). Upon addition of rapamycin, the protein domains FKBP and FRB dimerize, resulting in selective depletion of PtdIns(4,5)P2 without the production of diacylglycerol (DAG), inositol 1,4,5-triphosphate (IP3), or Ca2+ release. Fig. 3C shows that rapamycin induces translocation of CF-Inp to the plasma membrane and SGK1.1-RFP to the cytosol/nucleus, demonstrating that release of SGK1.1 from the plasma membrane parallels depletion of PtdIns(4,5)P2 and is not the consequence of other signaling pathways activated by PLC or increase in intracellular Ca2+.

Fig. 3.

Fig. 3.

Subcellular localization of SGK1.1. (A) CHO cells cotransfected with SGK1.1 and PH-GFP show colocalization of the two proteins at the plasma membrane. A fraction of SGK1.1 is also seen in the nucleus. (B) Activation PH-PLC with m-3M3FBS translocates SGK1.1 and PH-GFP to the cytosol. (C) Cells transfected with Ds-RedSGK1.1, CF-Ins, and LRD. Upon addition of rapamycin (5 μM), CF-Ins moves from the cytosol to the plasma membrane, whereas Ds-RedSGK1.1 moves from the plasma membrane to the cytosol. Images in A and B were obtained with a Zeiss IE-24 LSM Meta laser confocal microscope and in C with a two-photon microscope IE-25LSM510NLO.

The N terminus of SGK1.1 contains a cluster of positively charged residues intercalated with bulky hydrophobic residues (Fig. 1B) reminiscent of protein motifs that bind plasma membrane phospholipids (24). Mutations of three consecutive positive charges (K21K22R23) for neutral residues eliminated SGK1.1 from the plasma membrane and relocated the protein to the cytosol (Fig. 4A). In contrast, substitution of the hydrophobic residues F19F20 or W27 for alanine targeted the protein mainly to the nucleus (Fig. 4B). This indicates that the cluster of positively charged residues together with hydrophobic residues in the N terminus of SGK1.1 encode a motif that binds PtdIns(4,5)P2. Elimination of the cationic or hydrophobic element markedly diminishes the affinity of the motif for PtdIns(4,5)P2. Because enrichment in positively charged residues can also serve as a nuclear localization signal, SGK1.1 migrates to the cytosol and is partially sequestered in the nucleus upon hydrolysis of PtdIns(4,5)P2 either by activation of phospholipase C or inositol phosphatases.

Fig. 4.

Fig. 4.

A polybasic motif in the N terminus of SGK1.1 tethers the protein to the plasma membrane. (A) Removal of three positive residues from the polybasic motif in the N terminus of SGK1.1 changes its localization from the plasma membrane to the cytosol. (B) Mutations of large hydrophobic residues in the polybasic motif, F19F20, or W27 change distribution of SGK1.1 from plasma membrane to predominantly nuclei.

Furthermore, preferential binding to PtdIns(4,5)P2 over PtdIn(3,4,5)P3 was demonstrated by depletion of cellular PtdIn(3,4,5)P3 by treatment of cells with inhibitors of phosphatidylinositol 3-kinase (PI3K), LY294002, and wortmannin. These were compared with cells treated with insulin and IGF, both activators of PI3K. Confocal analysis of SGK1.1 distribution did not reveal a significant change in the subcellular localization (data not shown).

Functional Effects of SGK1.1.

The canonical SGK1 isoform increases activity of ENaC in the kidney and also modulates other channels and transporters in various tissues (20). We first examined whether SGK1.1 regulates ENaC in Xenopus oocytes. Whole-cell amiloride-sensitive currents in oocytes coinjected with or without SGK1.1 were similar (Fig. 5A). By contrast, activation of the closely related neuronal specific channel ASIC1 was decreased in the presence of SGK1.1 (Fig. 5B). The decrease depended on kinase activity because the constitutively active form (SGK1.1S515D) (25) induced the greatest decrease, whereas a mutant that cannot be activated (SGK1.1S515A) did not show an effect. To investigate dependence of SGK1.1 subcellular localization on ASIC1 activity, we injected oocytes with SGK1.1 mutants that displace the protein to the cytosol and nucleus. Fig. 5C shows no effect of SGK1.1RRK and SGK1.1FF, whereas a small but statistically significant decrease, 30% and 20%, was observed with the constitutively active double mutants SGK1.1RRK/S515D and SGK1.1FF/S515D. This indicates that membrane localization of SGK1.1 is important for the modulation of ASIC1, although expression of a constitutively active mutant can partially compensate for localization.

Fig. 5.

Fig. 5.

Effect of SGK1.1 on ENaC and ASIC1 currents in oocytes. (A) Oocytes expressing ENaC alone or with SGK1.1 cRNA. Data represent the amiloride-sensitive current normalized to control oocytes (ENaC alone) measured with the TEVC at a holding membrane potential of −60 mV. (B) Oocytes expressing ASIC1 alone or with wild-type SGK1.1, constitutively active (SGK1.1S515D), or nonactivatable (SGK1.1S515A) cRNAs. (C) ASIC and mutants of SGK1.1 that change subcellular localization (RRK and FF) and same mutants with addition of the activation residue S515D. Data are peak currents induced by changing extracellular pH from 7.4 to 6.0. N = number of independent experiments; n = number of oocytes; error bars, SEMs; *, P ≤ 0.01.

N1B-115 cells, which express endogenous ASIC1 transcript as demonstrated by RT-PCR (Fig. 6A), were transfected with SGK1.1-GFP. Fluorescence distributed over the plasma membrane of the soma and neurites as expected for colocalization with PdtIns(4,5)P2 (Fig. 6B). When the cells were examined for the presence of proton-activated currents, we observed transient inward currents characteristic of ASIC1 (Fig. 6C). The average ASIC current in cells transfected with GFP alone was 418.18 ± 78.62 pA, whereas, in cells transfected with SGK1.1S515D-GFP, the average current was 66.73 ± 13.03 pA, an 84% reduction from the control (Fig. 6D). Transfection with the inactive form, SGK1.1S515A-GFP, did not change the magnitude of proton-activated currents. The effect on ASIC1 was specific because measurements of endogenous voltage-activated sodium currents in the same neurons did not differ in cells expressing GFP or SGK1.1S515D-GFP (Fig. 6E).

Fig. 6.

Fig. 6.

Functional effects of SGK1.1 on neuronal cells. (A) Products of RT-PCR from N1B-115 cells with (+) and (−) serum amplified with specific primers from mouse ASIC1, -2, -3, and VR1 receptor. (B) Confocal image of N1B-115 cells transfected with SGK1.1-GFP and maintained in serum-free medium for 2 days. (C) Representative examples of endogenous ASIC1 whole-cell currents in differentiated N1B-115 cells elicited by changing external pH from 7.4 to 5.0 in cells transfected with GFP or SGK1.1S422D-GFP. (D) Average proton-activated currents of N1B-115 cells transfected with GFP or SGK1.1S515D-GFP, n = 13, P = 0.00018. (E) Endogenous TTX-sensitive voltage-activated Na+ currents in neurons transfected with GFP or SGK1.1S515D, n = 12. (F) CHO cells stably expressing ASIC1-FLAG transiently transfected with SGK1.1 or SGK1.1FF. Representative gel of surface biotinylated proteins probed with anti-FLAG monoclonal and densitometric analysis of three independent experiments normalized to controls.

As the rates of activation (6.5 ± 2.9 s−1) and desensitization (0.77 ± 0.13 s−1) of ASIC1 were not affected by SGK1.1, it is unlikely that these processes are targets of SGK1.1 modulation but rather reduction in number of channels at the cell surface. Transient transfection of SGK1.1 in a stable CHO cell clone expressing ASIC1-FLAG showed a decrease in the level of channels expressed at the plasma membrane examined by biotinylation of surface proteins (Fig. 6F), whereas transfection with the SGK1.1FF mutant did not induced a significant change of ASIC1 surface expression.

We also examined whether SGK1.1S515D phosphorylates ASIC1. An ASIC-FLAG clone was transfected with SGK1.1S515D and analyzed for incorporation of 32[P] into immunoprecipitated ASIC1. These experiments did not show a significant change when compared with cells not transfect with SGK1.1S515D, suggesting that phosphorylation of the channel is not the mechanism whereby channel expression at the cell surface is attenuated [supporting information (SI) Fig. 8].

Discussion

We report a brain-specific SGK1.1 isoform that down-regulates the activity of the neuronal ASIC1 channel, at least in part, by decreasing its expression at the cell surface. Activation of SGK1.1 by phosphorylation of the C-terminal hydrophobic motif (S515) enhanced the effect on ASIC1, indicating that catalytic activity is important to induce the signaling pathway that diminishes expression of ASIC1 at the plasma membrane. Although an active kinase is necessary, SGK1.1 does not phosphorylate the channel protein, consistent with the absence of a SGK1.1's consensus phosphorylation motif (RXRXXS/T) in both the N and C termini of the ASIC1. Thus, the effect on surface expression must be indirect, as is the case for the regulation of ENaC expression by the canonical SGK1. In the latter instance, SGK1 phosphorylates the ubiquitin ligase Nedd4–2, decreasing its ability to bind to the C terminus of the channel subunits, thereby changing the rate of ENaC endocytosis (reviewed in ref. 26). It is unlikely, however, that ASIC1 follows such a mechanism because the C terminus of this channel does not have the proline-rich motif for binding of Nedd4–2. At this stage, we can only speculate that SGK1.1 modifies the traffic of ASIC1 in or out of the membrane by targeting an as-yet-unidentified substrate.

Localization of SGK1.1 to the plasma membrane was also required because disruption of the PtdIns(4,5)P2-binding motif abrogated the effect on ASIC1. In a similar manner, removal of the N terminus of the canonical SGK1 eliminates regulation of ENaC (27). Therefore, this result confirms and extends our previous conclusion that correct subcellular localization is key for achieving functional specificity of the SGK1 isoforms (23). Regulation by compartmentation is partly overcome by rendering the cytosolic SGK1.1 mutants constitutively active because, owing to their distribution over the whole cell, they have access to substrates that cannot be reached under normal conditions. Because SGK1.1 is released from the plasma membrane toward the cytosol and nucleus when the level of PtdIns(4,5)P2 is transiently diminished, it is possible that SGK1.1 may also play a role in transcriptional regulation of genes.

The presence of several promoters in the SGK1 gene allows induction by a large and diverse set of conditions in a tissue-specific manner. For instance, glucocorticoids are among the main stimuli promoting transcription of the canonical SGK1 in peripheral tissues, whereas the SGK1.1 isoform is not regulated by glucocorticoids in brain. By contrast, in neurons, we observed increased expression of SGK1.1 by depolarization of the plasma membrane. It is known that activity-dependent neuronal membrane depolarization induces transcription of genes, thereby establishing structural and functional changes characteristic of neuronal plasticity (28).

It is relevant to notice that all microarray and qPCR studies thus far conducted to examine changes in SGK1 mRNA expression by various conditions and diseases have used probes that recognize cDNA regions common to all SGK1 isoforms; therefore, those studies did not identify the isoform induced by the specific stimulus. The distinction is important owing to the functional differences of the isoforms. Moreover, the relative low basal level of SGK1.1 mRNA indicates that even a small change in total mRNA, if due exclusively to increases in SGK1.1, represents a major change in expression of the latter isoform. At the protein level, the transcriptional effect is further amplified because of the much higher stability of SGK1.1 compared with SGK1.

It has become apparent that a recurrent theme among the SGK proteins is tethering to membranes of organelles by means of specific motifs localized in the N terminus of these proteins. The canonical SGK1 contains an amphipathic α-helix that targets the protein to the cytosolic surface of the endoplasmic reticulum (22, 29); SGK3 contains a PX domain that binds to PtdIns(3)P, thereby targeting the protein to early endosomes (30); SGK1.1 uses a cluster of cationic and large hydrophobic residues to bind PtdIns(4,5)P2 and tether the protein to the plasma membrane. Such motifs have been described and shown to be necessary for targeting small guanosine triphosphatases (GTPases) from the Ras, Rho, Arf, and Rab subfamilies to the plasma membrane (24). Because PtdIns(4,5)P2 are the most abundant phosphoinositides in the plasma membrane, in resting conditions, SGK1.1 resides in this compartment unless levels decrease transiently upon activation of PLC or inositol phosphatases. Under this condition, SGK1.1 moves to the cytosol and accumulates in the nucleus using the same polybasic cluster, which also serves as a nuclear localization signal. In nuclei, SGK1.1 may have specific targets implicated in transcription regulation that need to be identified.

The existence of multiple SGK1 promoters and transcripts allows SGK1 expression to be regulated at multiple levels including transcription, stability, subcellular localization, and translatability. The fact that SGK1 expression is regulated at several levels is relevant to SGK1's multiple functions as a modulator of neuronal plasticity and a mediator of neuronal survival.

Methods

Cell Culture, Transfection, and Treatments.

CHO cells and N1E-115 cells seeded on coverslips or six-well Petri dishes were transfected with Lipofectamine-2000 (Invitrogen). One day after transfection, the medium of N1E-115 cells was changed to serum-free to induce cell differentiation. Experiments were carried out 2–3 days after induction of differentiation. For RNA extraction, N1E-115 cells were kept 3 days on serum-free medium, followed by treatment with 1 μM dexamethasone for 3 h or medium modified to contain 50 mM K+ maintaining 290 mOsm for 90 min.

Cloning of SGK1 Spliced Isoforms and Mutagenesis.

Mouse brain total RNA was isolated with TRIzol (Invitrogen). Single-strand cDNA was synthesized with SuperScript III reverse transcriptase and primed with oligo(dT). Forward (GGAAGATGGTAAACAAAGACATGAATGG and CTCGGTCCGCAGCTATGGGCGAGATG) and reverse (GAGGAAGGAATCCACAGGAGGTGC) primers were used to amplify the coding region of spliced SGK1 isoforms by using high-fidelity Taq polymerase (Roche). Products were ligated to pCDNA3.1/V5-His TOPO vector (Invitrogen). Mutations were inserted with a QuikChange mutagenesis kit (Stratagene). All final constructs were sequenced.

qRT-PCR.

Total RNA from mouse tissues (four control and four dexamethasone-treated mice (0.5-mg i.p. injection for 18 h) was treated with RNase-free DNase (New England BioLabs). A similar procedure was used for N1E-115 cells. Reverse transcription of 3 μg of total RNA was performed by using SuperScript RTIII (Invitrogen) and oligo(dT) primer. The primers used for qPCR were CGTCAAAGCCGAGGCTGCTCGAAGC (SGK1 sense), GAAGGCGGATCGGGATACAGATGCAGTAA (SGK1.1 sense), and GGTTTGGCGTGAGGGTTGGAGGAC (antisense for both amplicons). PCRs were prepared with iQ SYBR green SuperMix (Bio-Rad) with 3 mM MgCl2, and 0.5 μl of cDNA template. All samples were run in triplicate on iCycler (Bio-Rad). qPCR conditions were 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 68°C for 45 s. Melting curve analysis was added after the final PCR cycle. Control reactions were run with no cDNA template or with non-reverse-transcribed RNA. Starting mRNA quantities were calculated from the standard curves generated by using serial dilutions of plasmid DNA containing SGK1.1 or SGK1 and respective qPCR primers. Calculated mRNA expression levels were normalized to the expression levels of GAPDH in the same cDNA sample. qPCR for GAPDH was performed as described above for SGK1.1, by using the following primers: GATGGTGAAGGTCGGTGTGAACGGAT (sense), and CCTTGGAGGCCATGTAGGCCATGA (antisense).

Metabolic Labeling and Pulse–Chase Experiments.

Transfected cells were washed with methionine- and cysteine-free medium, followed by incubation with 150 μCi/ml of Express Cell Labeling Mix (PerkinElmer Life Sciences) for 20 min. Cells were chased with medium containing a 10-fold molar excess of both methionine/cysteine and 0.1 mg/ml cycloheximide for the indicated time periods. Cells were lysed and prepared for immunoprecipitation with anti-SGK1 antibody as described (22). Gels were exposed to x-ray film and analyzed by densitometry using Bio-Rad G800 and QuantityOne software.

Membrane Protein Biotinylation.

Cell lines constitutively expressing ASIC1-FLAG were biotinylated with Sulfo-NHS-SS-Biotin (Pierce). Protein concentration was measured with the BCA kit (Pierce), and equal amounts of total protein were processed. Biotinylated proteins were recovered with Streptavidin-agarose beads (Pierce). The amount of added beads was adjusted to ensure complete recovery of biotinylated proteins from lysates. Biotinylated proteins were eluted from the beads by heating to 90°C in SDS/PAGE sample buffer.

Immunoblot Analysis.

Samples were separated by electrophoresis in 10% SDS/PAGE and transferred to Immobilon-P membrane (Millipore). After blocking with 5% dry milk, the membranes were probed with primary antibody, anti-FLAG-HRP (Sigma). Signals were developed with ECL+ (Amersham), and blots were exposed to BioMax MR Film (Eastman Kodak).

Immnunofluorescence Microscopy.

Cells were fixed with 4% paraformaldehyde, permeabilized with 1% Triton X-100 in PBS, and blocked with 1% goat serum. V5 monoclonal Ab was incubated for 1–2 h, washed with PBS five times, and secondary anti-mouse IgG goat secondary Ab conjugated with Alexa Fluor 594 was added for 1 h. Cells were examined with a Zeiss IE-24 LSM Meta laser confocal microscope or a two-photon microscope IE-25LSM510NLO.

In Situ Hybridization.

In situ hybridization was performed on 30-μm-thick free-floating sections of paraformaldehyde-fixed mouse brain. The antisense probe was specific for SGK1.1, +354 to −456 of the coding sequence (GenBank BC070401). Riboprobes were labeled with DIG-dUTP, DIG-RNA-labeling kit SP6/T7 (Roche). Sections were treated with proteinase K (Roche; 15 μg/ml in TBS with 2 mM CaCl2) for 20 min at 37°C, washed in cold TBS [50 mM Tris (pH 7.5) and 150 mM NaCl], followed by a 10-min incubation in 0.5% acetic anhydride in 0.1 M Tris (pH 8.0), washed in TBS, and incubated in hybridization buffer (50% formamide, 10% dextrane sulfate, 4× SSC, 2.5× Denhardt's solution, 0.25 mg/ml ss DNA, 0.6 mg of yeast tRNA, and 0.025% SDS) at 55°C for 1 h. Denatured riboprobes (final concentration 0.5 μg/ml) added to hybridization buffer were incubated at 55°C for 16 h. Posthybridization washes: three for 10 min in 2× SSC at 23°C, three for 20 min in 50% formamide/1× SSC at 55°C, one for 10 min in 1× SSC, and one for 10 min in TBS, incubated in blocking solution (1% DIG blocking reagent, Roche, 10% sheep serum, and 2% mouse serum) for 1 h at 23°C. Anti-DIG-AP (Roche) was applied overnight at 4°C, diluted 1:4,000 in blocking solution. Detection: NBT/BCIP substrate (Roche) with 240 μg/ml levamisole in 100 mM Tris (pH 9.5), 100 mM NaCl, and 50 mM MgCl2 in the dark for color development. Sections were mounted in 0.1 M phosphate buffer (pH 7.0), 7.5% gelatin, and 50% glycerol.

Xenopus laevis Oocyte Injection and Two-Electrode Voltage Clamp (TEVC).

Stage V and VI Xenopus laevis oocytes were injected with 5–50 ng of cRNA and incubated 24 h for ENaC and 72 h for ASIC1 at 16°C, supplemented with amiloride for oocytes injected with ENaC. cRNA from rASIC1, rENaC (α, β, and γ), and mSGK1.1 were transcribed with T7 mMessagemMachine (Ambion). Channel and SGK1.1 cRNAs were injected in a 1:2 ratio in a volume of 50 nanoliters per oocyte. TEVC experiments were performed as in ref. 31. The composition of bath solution was 150 mM NaCl, 1 mM CaCl2, 1 mM KCl, 10 mM Hepes (pH 7.5). The holding membrane potential was −60 mV. ASIC1 was activated by a rapid change of the external pH to 6.0, and peak currents were computed for analysis. The ENaC current was measured by adding 20 μM amiloride to the bath.

Patch-Clamp of N1E-115 Cells.

Fluorescent cells were selected under the microscope for whole-cell patch-clamp measurements with an Axopatch 200B amplifier (Axon Instruments). Neither cell capacity nor series resistance (≈8 MΩ) was compensated. For voltage-clamp experiments, the membrane potential was held at −60 mV. ASIC was activated by changing the bath solution from pH 7.4 to pH 5.0 by using a modified mechanical switching perfusion system (SF-77B, Perfusion Fast-Step; Warner Instrument) (34). Voltage-dependent Na channels were activated by depolarizing voltage steps with 20 mV increasing amplitude starting from holding potential to +80 mV. To minimize voltage-errors, cell capacity and series-resistance compensation were used at 60%. Leakage currents were subtracted online by a P/6 program with hyperpolarizing pulses from the holding potential of −80 mV. For selective analysis of voltage-dependent Na currents, inward peak values after depolarization were determined before and after a 1-min perfusion with 2 μM TTX, and differences were plotted against voltage. The bath solution contained 150 mM NaCl, 5 mM KCl, 2 mM MgCl2, 2 mM CaCl2, and 10 mM glucose, and the pH was adjusted to 7.45 (Hepes 10) or 5 (Mes 10). The pipette solution was made of 140 mM KCl, 5 mM NaCl, 2 mM MgCl2, 5 mM EGTA, 2 mM MgATP, and 10 mM Hepes, and the pH was 7.35. Membrane currents were low-pass filtered at 1 kHz, digitized with 16 bits, and stored on a computer for analysis. AISC currents were determined as the peak value of change in current after switching to pH 5.

Data Analysis.

For every experiment, equal numbers of cells were measured for experimental and control conditions (n = 8–15 oocytes per experiment). Results were normalized to the mean value of the control and computed as the mean ± SEM of control and experimental conditions. Experiments were repeated with 7–12 independent batches of oocytes (N). Statistical significance was proved by Student's t test for overall experiments (n).

Supplementary Material

Supporting Figure

Acknowledgments.

We thank Drs. T. Inoue and T. Meyer for the constructs LDR and CF-Inp, and P. De Camilli for PH-GFP plasmid. This work was supported by National Institutes of Health Grant DK054062.06A1 and American Heart Association Grant 0555777 (to C.M.C.). T.C. is the recipient of an American Physiological Society training grant.

Footnotes

The authors declare no conflict of interest.

This article contains supporting information online at www.pnas.org/cgi/content/full/0800958105/DC1.

References

  • 1.Webster MK, Goya L, Ge Y, Maiyar AC, Firestone GL. Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol. 1993;13:2031–2040. doi: 10.1128/mcb.13.4.2031-2040.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Waldegger S, Barth P, Raber G, Lang F. Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci USA. 1997;94:4440–4445. doi: 10.1073/pnas.94.9.4440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Chen SY, et al. Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci USA. 1999;96:2514–2595. doi: 10.1073/pnas.96.5.2514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Wulff P, et al. Impaired renal Na+ retention in the sgk1-knockout mouse. J Clin Invest. 2002;110:1263–1268. doi: 10.1172/JCI15696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Brunet A, et al. Protein kinase SGK mediates survival signals by phosphorylating the forkhead transcription factor FKHRL1 (FOXO3a). Mol Cell Biol. 2001;21:952–965. doi: 10.1128/MCB.21.3.952-965.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Hertweck M, Gobel C, Baumeister R. C. elegans SGK-1 is the critical component in the Akt/PKB kinase complex to control stress response and life span. Dev Cell. 2004;6:577–588. doi: 10.1016/s1534-5807(04)00095-4. [DOI] [PubMed] [Google Scholar]
  • 7.Nishida Y, et al. Alteration of serum/glucocorticoid regulated kinase-1 (sgk-1) gene expression in rat hippocampus after transient global ischemia. Brain Res Mol Brain Res. 2004;123:121–125. doi: 10.1016/j.molbrainres.2004.01.008. [DOI] [PubMed] [Google Scholar]
  • 8.Imaizumi K, Tsuda M, Wanaka A, Tohyama M, Takagi T. Differential expression of sgk mRNA, a member of the Ser/Thr protein kinase gene family, in rat brain after CNS injury. Brain Res Mol Brain Res. 1994;26:189–196. doi: 10.1016/0169-328x(94)90090-6. [DOI] [PubMed] [Google Scholar]
  • 9.Iwata S, Nomoto M, Morioka H, Miyata A. Gene expression profiling in the midbrain of striatal 6-hydroxydopamine-injected mice. Synapse. 2004;51:279–286. doi: 10.1002/syn.10307. [DOI] [PubMed] [Google Scholar]
  • 10.Stichel CC, et al. sgk1, a member of an RNA cluster associated with cell death in a model of Parkinson's disease. Eur J Neurosci. 2005;21:301–316. doi: 10.1111/j.1460-9568.2005.03859.x. [DOI] [PubMed] [Google Scholar]
  • 11.Schoenebeck B, Bader V, Zhu XR, Schmitz B, Lubbert H. Sgk1, a cell survival response in neurodegenerative diseases. Mol Cell Neurosci. 2005;30:249–264. doi: 10.1016/j.mcn.2005.07.017. [DOI] [PubMed] [Google Scholar]
  • 12.Tudor M, Akbarian S, Chen RZ, Jaenisch R. Transcriptional profiling of a mouse model for Rett syndrome reveals subtle transcriptional changes in the brain. Proc Natl Acad Sci USA. 2002;99:15536–15541. doi: 10.1073/pnas.242566899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Nuber UA, et al. Up-regulation of glucocorticoid-regulated genes in a mouse model of Rett syndrome. Hum Mol Genet. 2005;14:2247–2256. doi: 10.1093/hmg/ddi229. [DOI] [PubMed] [Google Scholar]
  • 14.Rangone H, et al. The serum- and glucocorticoid-induced kinase SGK inhibits mutant huntingtin-induced toxicity by phosphorylating serine 421 of huntingtin. Eur J Neurosci. 2004;19:273–279. doi: 10.1111/j.0953-816x.2003.03131.x. [DOI] [PubMed] [Google Scholar]
  • 15.Géranton SM, Morenilla-Palao C, Hunt SP. A role for transcriptional repressor methyl-CpG-binding protein 2 and plasticity-related gene serum- and glucocorticoid-inducible kinase 1 in the induction of inflammatory pain states. J Neurosci. 2007;27:6163–6173. doi: 10.1523/JNEUROSCI.1306-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Tsai KJ, Chen SK, Ma YL, Hsu WL, Lee EH. sgk, a primary glucocorticoid-induced gene, facilitates memory consolidation of spatial learning in rats. Proc Natl Acad Sci USA. 2002;99:3990–3995. doi: 10.1073/pnas.062405399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Chao CC, Ma YM, Lee EH. Protein kinase CK2 impairs spatial memory formation through differential cross talk with PI-3 kinase signaling: activation of Akt and inactivation of SGK1. J Neurosci. 2007;27:6243–6248. doi: 10.1523/JNEUROSCI.1531-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Von Hertzen LS, Giese K. Memory reconsolidation engages only a subset of immediate-early genes induced during consolidation. J Neurosci. 2006;25:1935–1942. doi: 10.1523/JNEUROSCI.4707-04.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ma YL, Tsai MC, Hsu WL, Lee EH. SGK protein kinase facilitates the expression of long-term potentiation in hippocampal neurons. Learn Mem. 2006;13:114–118. doi: 10.1101/lm.179206. [DOI] [PubMed] [Google Scholar]
  • 20.Lang F, et al. (Patho)physiological significance of the serum- and glucocorticoid-inducible kinase isoforms. Physiol Rev. 2006;86:1151–1178. doi: 10.1152/physrev.00050.2005. [DOI] [PubMed] [Google Scholar]
  • 21.Firestone GL, Giampaolo JR, O'Keeffe BA. Stimulus-dependent regulation of serum and glucocorticoid inducible protein kinase (SGK) transcription, subcellular localization and enzymatic activity. Cell Physiol Biochem. 2003;13:1–12. doi: 10.1159/000070244. [DOI] [PubMed] [Google Scholar]
  • 22.Arteaga MF, Wang L, Ravid T, Hochstrasser M, Canessa CM. An amphipathic helix targets serum and glucocorticoid-induced kinase 1 to the endoplasmic reticulum-associated ubiquitin-conjugation machinery. Proc Natl Acad Sci USA. 2006;103:11178–11183. doi: 10.1073/pnas.0604816103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Arteaga MF, Alvarez de la Rosa D, Alvarez JA, Canessa CM. Multiple translational isoforms give functional specificity to serum- and glucocorticoid-induced kinase 1. Mol Biol Cell. 2007;18:2072–2078. doi: 10.1091/mbc.E06-10-0968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Heo WD, et al. PI(3,4,5)P3 and PI(4,5)P2 lipids target proteins with polybasic clusters to the plasma membrane. Science. 2006;314:1458–1460. doi: 10.1126/science.1134389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kobayashi T, Cohen P. Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem J. 1999;339:319–328. [PMC free article] [PubMed] [Google Scholar]
  • 26.Kamynina E, Staub O. Concerted action of ENaC, Nedd4–2, and Sgk1 in transepithelial Na+ transport. Am J Physiol Renal Physiol. 2002;283:F377–F387. doi: 10.1152/ajprenal.00143.2002. [DOI] [PubMed] [Google Scholar]
  • 27.Náray-Fejes-Tóth A, Helms MN, Stokes JB, Fejes-Tóth G. Regulation of sodium transport in mammalian collecting duct cells by aldosterone-induced kinase, SGK1: Structure/function studies. Mol Cell Endocrinol. 2004;217:197–202. doi: 10.1016/j.mce.2003.10.043. [DOI] [PubMed] [Google Scholar]
  • 28.West AE, et al. Calcium regulation of neuronal gene expression. Proc Natl Acad Sci USA. 2001;98:11024–11031. doi: 10.1073/pnas.191352298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bogusz AM, Brickley DR, Pew T, Conzen SD. A novel N-terminal hydrophobic motif mediates constitutive degradation of serum- and glucocorticoid-induced kinase-1 by the ubiquitin-proteasome pathway. FEBS J. 2006;273:2913–2928. doi: 10.1111/j.1742-4658.2006.05304.x. [DOI] [PubMed] [Google Scholar]
  • 30.Xu J, Liu D, Gill G, Songyang Z. Regulation of cytokine-independent survival kinase (CISK) by the Phox homology domain and phosphoinositid. J Cell Biol. 2001;154:699–705. doi: 10.1083/jcb.200105089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Coric T, Zhang P, Todorovic N, Canessa CM. The extracellular domain determines the kinetics of desensitization in acid-sensitive ion channel 1. J Biol Chem. 2003;278:45240–45247. doi: 10.1074/jbc.M304441200. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Figure
pnas_0800958105_1.pdf (157.3KB, pdf)

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES