Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2008 Feb 29;74(9):2908–2914. doi: 10.1128/AEM.02704-07

Enterohemorrhagic Escherichia coli Exploits EspA Filaments for Attachment to Salad Leaves▿

Robert K Shaw 1,†, Cedric N Berger 2,†, Bart Feys 3, Stuart Knutton 1, Mark J Pallen 1, Gad Frankel 2,*
PMCID: PMC2394865  PMID: 18310437

Abstract

Enterohemorrhagic Escherichia coli (EHEC) strains are important food-borne pathogens that use a filamentous type III secretion system (fT3SS) for colonization of the gut epithelium. In this study we have shown that EHEC O157 and O26 strains use the fT3SS apparatus for attachment to leaves. Leaf attachment was independent of effector protein translocation.


Current epidemiological studies indicate that strains of enterohemorrhagic Escherichia coli (EHEC) belonging to serotype O157:H7 are most commonly associated with severe human disease (29). Outbreaks caused by EHEC strains belonging to serogroups other than O157 (e.g., O26, O103, O111, and O145) have mainly been described in continental Europe, Australia, and Argentina (24, 26). Cattle contaminated with EHEC are the major reservoir for human infection (10).

The ability of EHEC to colonize human and animal intestinal mucosae and to cause disease is associated with a number of virulence factors, including expression of Shiga toxins (Stx) (22) and the capacity to induce attaching/effacing (A/E) lesions (23). A/E lesions are characterized by intimate bacterial attachment to the host cell membrane, and the destruction of microvilli at the site of bacterial adherence. Rearrangement and accumulation of signaling (18), adaptor (12), and cytoskeletal proteins, in particular filamentous actin (15), are frequently seen in the host cell abutting the adherent bacteria (reviewed in reference 11).

The ability of EHEC to trigger A/E lesions is encoded by the locus of enterocyte effacement (LEE) (19), which encodes transcriptional regulators, the adhesin intimin, a type III secretion system (T3SS), chaperones, translocators (EspA, EspD, EspB), and six effector proteins (reviewed in reference 11). T3SSs are complex multiprotein organelles that allow bacteria to transport proteins across the bacterial cell envelope directly into the cytosol of eukaryotic cells (reviewed in references 4 and 9). However, the LEE-encoded T3SS is unique in also possessing a long filamentous extension, the EspA filament (8, 16), producing a filamentous T3SS (fT3SS) that connects the secretion system with the EspB-EspD translocation pore within the plasma membrane of the host cell (reviewed in reference 11). EspA filaments play a dual role in infection of mammalian cells: they mediate bacterial attachment during the early stages of infection (8, 16) and subsequently, once a translocation pore has been established, act as a conduit for effector protein translocation (5), leading to subversion of host cell signaling, intimate bacterial adhesion, colonization, and disease (reviewed in reference 11).

Most outbreak and sporadic EHEC infections worldwide have been traced to consumption of contaminated bovine products (meat and dairy products) and to direct animal contact, with a minor role for person-to-person transmission (1). However, several severe EHEC outbreaks have been traced to consumption of contaminated raw vegetables. Analysis of food illness outbreaks in the United States between 1973 and 1997, conducted by the Centers for Disease Control and Prevention, revealed that fresh plant produce is an increasingly important source of infection. Indeed, while only 0.7% of food-borne outbreaks were linked to consumption of contaminated plant produce in the 1970s, the proportion rose to 6% in the 1990s (25).

A particularly large EHEC O157:H7 outbreak, which took place in 1996 in Sakai City, Osaka, Japan, was traced to consumption of white radish sprouts (20). Other outbreaks linked to contaminated fresh produce include those in Montana in 1995 (lettuce), Minnesota and Colorado in 2003 (alfalfa sprouts), and Sweden in 2005 (lettuce). A severe outbreak across the United States in 2006, in which 16% of affected individuals developed hemolytic-uremic syndrome, was traced to contamination of prepacked baby spinach (http://www.cdc.gov/ecoli/2006/september/updates/100606.htm). The occurrence of such an outbreak despite the thorough washing of prepacked spinach by the supplier led us to speculate that EHEC O157:H7 might employ a specific molecular mechanism for adherence to the plant phyllosphere (the leaves and above-ground plant surfaces), which is colonized by various epiphytes consisting mainly of bacteria but also yeasts, algae, and fungi (reviewed in reference 17).

In order to determine the mechanism used by EHEC O157:H7 to adhere to leaves, we sowed Eruca vesicaria (commonly known as rocket, or arugula), as a representative salad leaf, in sterile compost and grew the plants outdoors or under cool greenhouse conditions. Spinach seeds were grown under similar conditions, and lettuce was bought commercially. EHEC O157:H7 strains TUV 93-0, 85-170, and RIMD 0509952-Sakai (all Stx−, belonging to lineage I) (Table 1) were grown under conditions known to induce LEE gene expression: growth overnight at 37°C in Luria broth (LB) followed by 1:100 dilution into Dulbecco's modified Eagle's medium and subculturing for 3 h at 37°C under a 5% CO2 atmosphere (3) (optical density at 600 nm, 0.14). For comparison, strains were also grown under non-LEE-inducing conditions (overnight growth and 3 h of subculturing in LB at 37°C; optical density at 600 nm, 0.65).

TABLE 1.

List of strains and plasmids

Strain or plasmid Description Source or reference
Strains
    85-170 EHEC O157:H7 Stx− 27
    RIMD 0509952-Sakai EHEC O157:H7 Stx− 13
    TUV 93-0 EHEC O157:H7 strain EDL933 Stx− ATCC
    ICC187 TUV 93-0 ΔescN 12
    ICC288 TUV 93-0 ΔespA This study
    ICC286 TUV 93-0 ΔespB This study
    3801 EHEC O26:H11 Stx− Alan Phillips
    B3#44 EHEC O26:H11 Stx− Alan Phillips
    B3#42 EHEC O26:H11 Stx− Alan Phillips
    B3#38 EHEC O26:H− Stx− Alan Phillips
Plasmids
    pICC284 pBAD-EspA EHEC O157:H7 5
    pICC420 pACYC184-EspB EHEC O157:H7 This study

Freshly excised leaves with a width of 10 mm were trimmed in length to fit in the base of a 30-mm-diameter dish (average leaf weight, 0.5 g). Leaves affixed to the petri dish base were immersed in 3 ml of bacterial cultures and incubated statically at 20°C or 37°C for 1 h, allowing EHEC leaf attachment. Nonadherent bacteria were removed by washing with 3 ml of phosphate-buffered saline (PBS), pH 7.3, three times, for 5 min each time, at 80 rpm on an orbital shaker prior to fixation in 4% formalin in PBS for immunofluorescence (16) or 3% glutaraldehyde in 0.1 M phosphate buffer, pH 7.3, for scanning electron microscopy (SEM) (14).

For immunofluorescence, 5-mm2 portions were removed from the inoculated leaves and permeabilized for 10 min with 0.1% Triton in PBS. Leaves were stained with monoclonal antiserum JIM5 against pectin (Plant Probes), and EspA filaments were stained with a rabbit polyclonal antiserum against EspA, for 45 min; both antisera were diluted 1:100 in PBS containing 0.2% bovine serum albumin (PBS-BSA). Following three washes in PBS-BSA, the leaf samples were labeled for 45 min with an Alexa Fluor 594-conjugated goat anti-mouse antibody (Invitrogen) and with an Alexa 488-conjugated goat anti-rabbit antibody (Molecular Probes). Bacteria were stained with propidium iodide (Invitrogen) (16). EHEC lipopolysaccharide (LPS) was stained with a rabbit antiserum against O157:H7 LPS and an Alexa Fluor 488-conjugated goat anti-rabbit antibody. Leaf samples were mounted under 13-mm-diameter glass coverslips and examined on a Leica DMRE microscope equipped with SP2 spectral confocal and digital camera systems. The figures are representative of randomly selected fields.

For SEM, leaves were washed with 0.1 M phosphate buffer, pH 7.3, and postfixed in 1% osmium tetroxide in phosphate buffer for 20 min. Samples were processed using standard dehydration and critical point drying methods, sputter coated with platinum (14), and examined under a Philips XL30 field emission gun-environmental SEM (FEG-ESEM) equipped with secondary and back-scatter detection.

Diffusely adherent bacteria covering large areas of the E. vesicaria leaf surface were observed, but only when EHEC strains (TUV 93-0, 85-170, and RIMD 0509952-Sakai) were grown in Dulbecco's modified Eagle medium and an adhesion assay was performed at 37°C (Fig. 1A and B). In order to quantify adhesion levels, we counted adherent bacteria on five independent immunostained 5-mm2 leaf sections. This revealed an adhesion level equivalent to 2 × 105 TUV 93-0 bacteria/cm2 (Fig. 2). Markedly reduced adhesion was observed when TUV 93-0 was grown in LB (Fig. 1C) or when EHEC TUV 93-0 was primed and incubated with leaves at 20°C (Fig. 1D). In contrast, the phytopathogen Pseudomonas syringae strain DC3000 adhered to the leaf epidermis when an adhesion assay was carried out at 20°C (data not shown). These results suggest that expression of T3SS genes is needed for EHEC adherence to the phyllosphere. In addition, localized adhesion was observed on and around 96% (strain TUV 93-0) and 95% (strain 85-170) of 100 counted E. vesicaria stomatal guard cells (Fig. 1A, A inset, and B). Flagella were frequently seen on attached bacteria (Fig. 1B). No adherent bacteria were observed following inoculation of leaves with a primed T3SS-defective TUV 93-0 mutant (ΔescN), strain ICC187 (Fig. 1E and F; Fig. 2), that was nonetheless motile. These results suggest that adhesion of EHEC O157 to the phyllosphere is T3SS dependent and that flagella, intimin, pili, and other adhesins have a minor role, if any, in leaf adhesion.

FIG. 1.

FIG. 1.

EHEC O157:H7 cells were stained with propidium iodide (A, C, D, and F) or antiserum against O157 LPS (A inset). Wild-type primed EHEC O157 cells adhere diffusely to leaf epidermis (Eruca vesicaria) (A) and show strong tropism to the guard cells of the stomata (A inset and B). EspA-like filaments are seen linking bacteria to guard cells (B inset). Flagellated (arrows) and nonflagellated bacteria can be seen adhering to the surface of the leaf. No adhesion was observed when leaves were inoculated with LB-grown EHEC O157 at 37°C (C) or when leaves were incubated with primed bacteria at 20°C (D). Adhesion was T3SS dependent, as evidenced by the fact that primed EHEC TUV 93-0 ΔescN did not adhere to the leaf epidermis at 37°C (E and F). Bars, 10 μm for panels A to D and the inset in panel A; 0.25 μm for the inset in panel B.

FIG. 2.

FIG. 2.

Quantification of EHEC leaf adhesion. Although TUV 93-0 ΔespB showed no tropism toward the stomata, similar levels of diffuse adherent bacteria were observed following incubation of Eruca vesicaria with wild-type EHEC and TUV 93-0 ΔespB. TUV 93-0 ΔescN was nonadherent. Results are averages from five counts. Error bars, standard deviations.

EspA filaments have been implicated previously in the adhesion of EHEC O157:H7 to mammalian cells (2) and in the colonization of the mammalian gut mucosa (7). Since EspA filament-like structures were seen linking wild-type bacteria to the guard cells of the stomata in E. vesicaria (Fig. 1B inset), we decided to investigate whether EspA filaments play a role in bacterial adhesion to the leaf surface. To this end, we mutated espA in EHEC strain TUV 93-0 by using the lambda red system (6) and primers EspA-F and EspA-R (Table 2), which were used to amplify the kanamycin cassette in pKD4, generating strain ICC288 (Table 1). Control EspA-F1 and EspA-R1 primers (Table 2) were used to verify the deletion. The mutant was complemented with plasmid pICC284 (Table 1) expressing wild-type EHEC espA from the inducible arabinose promoter. The phenotypes of the mutant and complemented strains were confirmed using infection of HeLa cells (5).

TABLE 2.

Primer sequences

Primer name Sequence
EspA-F 5′-TGGATACATCAAATGCAACATCCGTTGTTAATGTGAGTGCGAGTTCTTCTGTGTAGGCTGGAGCTGCTTCG
EspA-R 5′-ATTTACCAAGGGATATTGCTGAAATAGTTCTATATTGTAGAGATTGCACATATGAATATCCTCCTTAG
EspA-F1 5′-GTGAGCAGAGAGAGAATGC
EspA-R1 5′-GTAAATCCAGCGATAAACCCG
EspB-F 5′-GAATTTTATTATGAATACTATTGATAATACTCAAGTAACGATGGTTAATGTGTAGGCTGGAGCTGCTTCG
EspB-R 5′-ATTAAACGTATCGACCATGATCAATTACCCAGCTAAGCGACCCGATTGCCATATGAATATCCTCCTTAG
EspB-F1 5′-GCGGTGCAAAACTTAACTCGACA
EspB-R1 5′-CCTGTTTGGTTACGTGCTTCAA
EspB-F2 5′-GAGCGGATCCAAGAAGGAGATATACCATGAATACTATTGATAATACTCAAG
EspB-R2 5′-CATCGGTCGACTTACCCAGCTAAGCGACC

No adhesion was observed following inoculation of E. vesicaria with TUV 93-0 ΔespA (strain ICC288) (Fig. 3A). trans-complementation of the mutant (pICC284), grown in the presence of 1 mM arabinose to induce gene expression, restored adhesion to the wild-type level, with strong tropism toward the stomatal guard cells (Fig. 3B). Immunofluorescence using anti-EspA antibodies showed that EspA filaments mediate EHEC O157:H7 attachment to the E. vesicaria leaf (Fig. 3B inset). EspA filaments also mediated the adhesion of EHEC O157 to spinach (Fig. 3D) and lettuce (Fig. 3E) leaves.

FIG. 3.

FIG. 3.

Adhesion of EHEC O157:H7 to leaf epidermis is mediated by EspA filaments. (A) TUV 93-0 ΔespA failed to adhere to the leaf epidermis. (B) trans-complementation restored the ability of TUV 93-0 ΔespA to adhere to the epidermis and the guard cells of the stomata. (B inset and C) Immunofluorescent staining and immunogold labeling, respectively, showing EspA filaments (arrows) mediating the adhesion of EHEC O157:H7 to Eruca vesicaria. (D and E) Adhesion of EHEC O157 to spinach and lettuce leaves, respectively, is also mediated by EspA filaments. Bars, 10 μm (A and B), 0.2 μm (C, D, E, and B inset), and 10 nm (C inset).

In order to confirm that the appendages seen by SEM are indeed EspA filaments, we employed SEM with immunogold labeling. E. vesicaria leaves were fixed in 0.1% glutaraldehyde in PBS-BSA for 10 min, washed, and incubated with a polyclonal antiserum against EspA, diluted 1:100, overnight at 4°C. Following three PBS-BSA washes, leaves were incubated with 1:50-diluted anti-rabbit antiserum conjugated with 10-nm-diameter colloidal gold particles for 2 h at room temperature, washed, fixed in 3% glutaraldehyde in phosphate buffer (pH 7.3), and processed and examined as described above. This procedure revealed specific EspA filaments linking EHEC O157:H7 to the epidermal surface (Fig. 3C) in a manner highly reminiscent of similar interactions with mammalian cells (2).

EspB is a T3SS translocator protein believed to be involved in the formation of the translocation pore required for effector protein translocation (30) but is not needed for EspA filament biogenesis (16). In order to determine if adhesion to the phyllosphere is dependent on protein translocation, we generated a TUV 93-0 ΔespB mutant (strain ICC286) using the lambda red system and primer pair EspB-F-EspB-R (Table 2). Control EspB-F1 and EspB-R1 primers (Table 2) were used to verify the deletion. In order to complement the mutation, espB was amplified using TUV 93-0 DNA as a template and primer pair EspB-F2-EspB-R2 (Table 2). The PCR product was cloned into BamHI/SalI-digested pACYC184, generating plasmid pICC420 (Table 2), resulting in constitutive expression of espB from the Tet promoter. The phenotypes of the mutant and complemented strains were confirmed using infection of HeLa cells (5).

Infection of E. vesicaria showed that TUV 93-0 ΔespB (ICC286) adhered only diffusely to the leaf surface (Fig. 4A), at a level equivalent to 1.5 × 105 cells/cm2, comparable to that of wild-type EHEC (Fig. 2). Of particular interest was the fact that the TUV 93-0 ΔespB strain lost its tropism toward stomata (Fig. 4A). Nonetheless, EspA filaments linking TUV 93-0 ΔespB to the E. vesicaria leaf surface were clearly visible (Fig. 4A inset). Complementation of the espB mutation restored stomatal tropism (Fig. 4B); the mechanism behind the stomatal tropism phenotype is not known. Taken together, these results show that EHEC O157:H7 adheres to the leaf epidermis via EspA filaments. The fact that protein translocation is not implicated in leaf adhesion is consistent with the physical properties of the plant cell wall, which is unlikely to be permissive for protein translocation via the EHEC O157:H7 T3SS. Moreover, the results suggest that EspB might recognize a specific stomatal receptor.

FIG. 4.

FIG. 4.

Adhesion of EHEC O157:H7 to leaf epidermis is independent of T3SS protein translocation. (A) An EHEC TUV 93-0 ΔespB mutant adhered to the leaf epidermis. TUV 93-0 ΔespB adhered in a diffuse pattern, with no evidence of tropism toward the guard cells of the stomata. (Inset) Adherence via EspA filaments. (B) Upon complementation, stomatal tropism was restored. Bars, 10 μm (A and B), 0.25 μm (A inset), and 5 μm (B inset).

EspA filaments are common to O157 and non-O157 EHEC strains (21). In order to determine if EspA filaments are involved in leaf adhesion of non-O157 EHEC strains, four EHEC O26 strains (Table 1) were used to inoculate E. vesicaria. The EHEC O26 strains were grown under LEE-inducing conditions as described above. Immunofluorescence and SEM examination revealed that all four O26 strains showed extensive diffuse bacterial adhesion, with no evidence of stomatal tropism (strains B3#42 and B3#44 are shown in Fig. 5A to D; strains 3801 and B3#38 are not shown). The reason why EHEC serogroups O157 and O26 show different stomatal tropisms is not known. Considering that EspAO157 antiserum does not cross-react with EspAO26 (21), we used an antiserum made against EspA of EPEC strain B171, which has broad specificity and is cross-reactive with EspAO26 (unpublished data). SEM (Fig. 5E) and immunofluorescence (Fig. 5F) staining of leaves inoculated with the four EHEC O26 strains have shown that the diffuse adherent bacteria are linked to the leaf surface via a large number of EspA filaments. These results show that O157 and non-O157 EHEC strains use a common mechanism to attach to the phyllosphere.

FIG. 5.

FIG. 5.

(A to D) EHEC O26:H11 adheres efficiently to the leaf epidermis. (E and F) Binding is mediated by EspA filaments. (A, B, and E) Strain B3#42; (C, D, and F) strain B3#44. Bars, 10 μm (A to D) and 0.25 μm (B, C, and E).

In conclusion, more than two dozen EHEC O157:H7 outbreaks have been traced to the consumption of contaminated vegetable products. Our findings, therefore, have public health implications: they will augment our understanding of how human pathogens interact with plants, which could be implemented in risk analysis evaluations. In this report we show that O157 and non-O157 EHEC strains adhere to the leaf epidermis of E. vesicaria, spinach, and lettuce via EspA filaments, which have been shown before to play a major role in the colonization of human and bovine hosts (2, 7). The results show that EHEC exploits the same molecular mechanism to colonize the mammalian intestine and to bind to a plant phyllosphere. Importantly, though, in contrast to the colonization of mammalian hosts, the adhesion of EHEC to leaves is independent of effector protein translocation. This is in sharp contrast to infection with the plant pathogen Pseudomonas syringae Pst DC3000, which employs an fT3SS comprising the HrpA poly-needle to translocate a battery of effector proteins involved in virulence (28). Indeed, EHEC does not cause plant disease once introduced into the intermesophyl cellular space (data not shown) but is rather an opportunistic epiphyte using leaves as a transmission vector.

Acknowledgments

We thank Alan Phillips for the O26 strains and Mona Singh for the EspAB171 antiserum.

This project was supported by the BBSRC (R.K.S., M.J.P., and B.F.), the MRC (C.N.B. and G.F.), and the Wellcome Trust (S.K. and G.F.).

Footnotes

▿

Published ahead of print on 29 February 2008.

REFERENCES

  • 1.Caprioli, A., S. Morabito, H. Brugère, and E. Oswald. 2005. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet. Res. 36:289-311. [DOI] [PubMed] [Google Scholar]
  • 2.Cleary, J., L. C. Lai, R. K. Shaw, A. Straatman-Iwanowska, M. S. Donnenberg, G. Frankel, and S. Knutton. 2004. Enteropathogenic Escherichia coli (EPEC) adhesion to intestinal epithelial cells: role of bundle-forming pili (BFP), EspA filaments and intimin. Microbiology 150:527-538. [DOI] [PubMed] [Google Scholar]
  • 3.Collington, G. K., I. W. Booth, and S. Knutton. 1998. Rapid modulation of electrolyte transport in Caco-2 cell monolayers by enteropathogenic Escherichia coli (EPEC) infection. Gut 42:200-207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Cornelis, G. R. 2006. The type III secretion injectisome. Nat. Rev. Microbiol. 4:811-825. [DOI] [PubMed] [Google Scholar]
  • 5.Crepin, V. F., R. Shaw, C. M. Abe, S. Knutton, and G. Frankel. 2005. Polarity of enteropathogenic Escherichia coli EspA filament assembly and protein secretion. J. Bacteriol. 187:2881-2889. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Dziva, F., I. Vlisidou, V. F. Crepin, T. S. Wallis, G. Frankel, and M. P. Stevens. 2007. Vaccination of calves with EspA, a key colonisation factor of Escherichia coli O157:H7, induces antigen-specific humoral responses but does not confer protection against intestinal colonisation. Vet. Microbiol. 123:254-261. [DOI] [PubMed] [Google Scholar]
  • 8.Ebel, F., T. Podzadel, M. Rohde, A. U. Kresse, S. Kramer, C. Deibel, C. A. Guzman, and T. Chakraborty. 1998. Initial binding of Shiga toxin-producing Escherichia coli to host cells and subsequent induction of actin rearrangements depend on filamentous EspA-containing surface appendages. Mol. Microbiol. 30:147-161. [DOI] [PubMed] [Google Scholar]
  • 9.Galán, J. E., and H. Wolf-Watz. 2006. Protein delivery into eukaryotic cells by type III secretion machines. Nature 444:567-573. [DOI] [PubMed] [Google Scholar]
  • 10.Gansheroff, L. J., and A. D. O'Brien. 2000. Escherichia coli O157:H7 in beef cattle presented for slaughter in the U.S.: higher prevalence rates than previously estimated. Proc. Natl. Acad. Sci. USA 97:2959-2961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Garmendia, J., G. Frankel, and V. F. Crepin. 2005. Enteropathogenic and enterohemorrhagic E. coli infections: translocation, translocation, translocation. Infect. Immun. 73:2573-2585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Garmendia, J., A. Phillips, Y. Chong, S. Schuller, O. Marches, S. Dahan, E. Oswald, R. K. Shaw, S. Knutton, and G. Frankel. 2004. TccP is an enterohaemorrhagic E. coli O157:H7 type III effector protein that couples Tir to the actin-cytoskeleton. Cell. Microbiol. 6:1167-1183. [DOI] [PubMed] [Google Scholar]
  • 13.Hayashi, T., K. Makino, M. Ohnishi, K. Kurokawa, K. Ishii, K. Yokoyama, C. G. Han, E. Ohtsubo, K. Nakayama, T. Murata, M. Tanaka, T. Tobe, T. Iida, H. Takami, T. Honda, C. Sasakawa, N. Ogasawara, T. Yasunaga, S. Kuhara, T. Shiba, M. Hattori, and H. Shinagawa. 2001. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 8:11-22. [DOI] [PubMed] [Google Scholar]
  • 14.Knutton, S. 1995. Electron microscopical methods in adhesion. Methods Enzymol. 253:145-158. [DOI] [PubMed] [Google Scholar]
  • 15.Knutton, S., T. Baldwin, P. H. Williams, and A. S. McNeish. 1989. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect. Immun. 57:1290-1298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Knutton, S., I. Rosenshine, M. J. Pallen, I. Nisan, B. C. Neves, C. Bain, C. Wolff, G. Dougan, and G. Frankel. 1998. A novel EspA-associated surface organelle of enteropathogenic Escherichia coli involved in protein translocation into epithelial cells. EMBO J. 17:2166-2176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lindow, S. E., and M. T. Brandl. 2003. Microbiology of the phyllosphere. Appl. Environ. Microbiol. 69:1875-1883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lommel, S., S. Benesch, K. Rottner, T. Franz, J. Wehland, and R. Kuhn. 2001. Actin pedestal formation by enteropathogenic Escherichia coli and intracellular motility of Shigella flexneri are abolished in N-WASP-defective cells. EMBO Rep. 2:850-857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. USA 92:1664-1668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Michino, H., K. Araki, S. Minami, S. Takaya, N. Sakai, M. Miyazaki, A. Ono, and H. Yanagawa. 1999. Massive outbreak of Escherichia coli O157:H7 infection in schoolchildren in Sakai City, Japan, associated with consumption of white radish sprouts. Am. J. Epidemiol. 150:787-796. [DOI] [PubMed] [Google Scholar]
  • 21.Neves, B. C., R. K. Shaw, G. Frankel, and S. Knutton. 2003. Polymorphisms within EspA filaments of enteropathogenic and enterohemorrhagic Escherichia coli. Infect. Immun. 71:2262-2265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.O'Brien, A. D., V. L. Tesh, A. Donohue-Rolfe, M. P. Jackson, S. Olsnes, K. Sandvig, A. A. Lindberg, and G. T. Keusch. 1992. Shiga toxin: biochemistry, genetics, mode of action, and role in pathogenesis. Curr. Top. Microbiol. Immunol. 180:65-94. [DOI] [PubMed] [Google Scholar]
  • 23.Phillips, A. D., S. Navabpor, S. Hicks, G. Dougan, T. Wallis, and G. Frankel. 2000. Enterohaemorrhagic Escherichia coli O157:H7 targets Peyer's patches in man and causes attaching-effacing lesions in both human and bovine intestine. Gut 47:377-381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Rivas, M., E. Miliwebsky, I. Chinen, C. D. Roldán, L. Balbi, B. García, G. Fiorilli, S. Sosa-Estani, J. Kincaid, J. Rangel, P. M. Griffin, and The Case-Control Study Group. 2006. Characterization and epidemiologic subtyping of Shiga toxin-producing Escherichia coli strains isolated from hemolytic uremic syndrome and diarrhea cases in Argentina. Foodborne Pathog. Dis. 3:88-96. [DOI] [PubMed] [Google Scholar]
  • 25.Sivapalasingam, S., C. R. Friedman, L. Cohen, and R. V. Tauxe. 2004. Fresh produce: a growing cause of outbreaks of foodborne illness in the United States, 1973 through 1997. J. Food Prot. 67:2342-2353. [DOI] [PubMed] [Google Scholar]
  • 26.Tozzi, A. E., A. Caprioli, F. Minelli, A. Gianviti, L. De Petris, A. Edefonti, G. Montini, A. Ferretti, T. De Palo, M. Gaido, and G. Rizzoni. 2003. Shiga toxin-producing Escherichia coli infections associated with hemolytic uremic syndrome, Italy, 1988-2000. Emerg. Infect. Dis. 9:106-108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Tzipori, S., H. Karch, K. I. Wachsmuth, R. M. Robins-Browne, A. D. O'Brien, H. Lior, M. L. Cohen, J. Smithers, and M. M. Levine. 1987. Role of a 60-megadalton plasmid and Shiga-like toxins in the pathogenesis of infection caused by enterohemorrhagic Escherichia coli O157:H7 in gnotobiotic piglets. Infect. Immun. 55:3117-3125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Underwood, W., S. Zhang, and S. Y. He. 2007. The Pseudomonas syringae type III effector tyrosine phosphatase HopAO1 suppresses innate immunity in Arabidopsis thaliana. Plant J. 52:658-672. [DOI] [PubMed] [Google Scholar]
  • 29.Willshaw, G. A., T. Cheasty, H. R. Smith, S. J. O'Brien, and G. K. Adak. 2001. Verocytotoxin-producing Escherichia coli (VTEC) O157 and other VTEC from human infections in England and Wales: 1995 to 1998. J. Med. Microbiol. 50:135-142. [DOI] [PubMed] [Google Scholar]
  • 30.Wolff, C., I. Nisan, E. Hanski, G. Frankel, and I. Rosenshine. 1998. Protein translocation into HeLa cells by infecting enteropathogenic Escherichia coli. Mol. Microbiol. 28:143-155. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES