Intracellular Actions of Group IIA Secreted Phospholipase A₂ and Group IVA Cytosolic Phospholipase A₂ Contribute to Arachidonic Acid Release and Prostaglandin Production in Rat Gastric Mucosal Cells and Transfected Human Embryonic Kidney Cells

Abstract

Gastric epithelial cells liberate prostaglandin E₂ in response to cytokines as part of the process of healing of gastric lesions. Treatment of the rat gastric epithelial cell line RGM1 with transforming growth factor-α and interleukin-1β leads to synergistic release of arachidonate and production of prostaglandin E₂. Results with highly specific and potent phospholipase A₂ inhibitors and with small interfering RNA show that cytosolic phospholipase A₂-α and group IIA secreted phospholipase A₂ contribute to arachidonate release from cytokine-stimulated RGM1 cells. In the late phase of arachidonate release, group IIA secreted phospholipase A₂ is induced (detected at the mRNA and protein levels), and the action of cytosolic phospholipase A₂-α is required for this induction. Results with RGM1 cells and group IIA secreted phospholipase A₂-transfected HEK293 cells show that the group IIA phospholipase acts prior to externalization from the cells. RGM1 cells also express group XIIA secreted phospholipase A₂, but this enzyme is not regulated by cytokines nor does it contribute to arachidonate release. The other eight secreted phospholipases A₂ were not detected in RGM1 cells at the mRNA level. These results clearly show that cytosolic and group IIA secreted phospholipases A₂ work together to liberate arachidonate from RGM1 cell phospholipids in response to cytokines.

There is current interest in phospholipases A₂ (PLA₂)² because of their involvement in the liberation of arachidonic acid from membrane phospholipids for the biosynthesis of the eicosanoids (prostaglandins, leukotrienes, and others). There is general consensus that cytosolic PLA₂ (cPLA₂-α, also known as group IVA PLA₂) plays a critical role in arachidonic acid release in mammalian cells (1, 2). For example, studies in mice have shown that disruption of the gene coding for cPLA₂-α eliminates or greatly reduces arachidonic acid release in a number of cells, including agonist-stimulated macrophages and neutrophils (3–6).

The mouse and human genomes also contain genes encoding 10 distinct secreted PLA₂s (sPLA₂s) (7, 8) suggesting multiple physiological functions for sPLA₂s. The role of these enzymes in promoting arachidonic acid release in mammalian cells is much less clear than for cPLA₂-α and is under active investigation. In mouse blood platelets, disruption of the cPLA₂-α gene leads to a significant reduction in the amount of thromboxane release when collagen is the agonist but not when cells are triggered with ATP, suggesting that another PLA₂ could be involved in arachidonate release (9). In mouse peritoneal macrophages, it has been shown recently that disruption of the group V sPLA₂ gene leads to an ~ 50% reduction in zymosan-stimulated leukotriene C₄ and prostaglandin E₂ (PGE₂) production (10), yet in the same cell/agonist system disruption of the cPLA₂-α gene nearly completely abrogates eicosanoid generation (5). This demonstrates that there is coordinate action between sPLA₂ and cPLA₂-α in mammalian cells. This has also been observed in mouse mesangial cells and human embryonic kidney cells (HEK293) transfected with various sPLA₂s (11, 12) and in human neutrophils treated with exogenously added group V sPLA₂ (13). The molecular basis for this sPLA₂-cPLA₂-α coordinate action is unknown.

In our recent studies of arachidonate release in transfected HEK293 cells, we found that forcible overexpression of group IIA sPLA₂ led to arachidonate release, that the sPLA₂ was acting prior to externalization from the cell, and that highly specific cPLA₂-α inhibitors significantly reduced arachidonate release showing that this latter enzyme was also involved (12). Key observations were that exogenously added human group IIA sPLA₂ was inefficient at liberating arachidonate and that the cell-impermeable and potent group IIA sPLA₂ inhibitor Me-indoxam (Fig. 1) was not able to reduce arachidonate release. The results of this recent study (12) are inconsistent with the earlier model proposed for the action of group IIA sPLA₂ in transfected HEK293 cells in which the enzyme is first secreted into the extracellular medium where it binds to cell surface proteoglycan and finally is internalized into caveolae-like compartments where it acts on membrane phospholipid to liberate arachidonate (14). We also showed that Me-indoxam fails to block arachidonate release in zymosan-stimulated mouse peritoneal macrophages and in agonist-stimulated p388D₁ macrophage-like cells (12) despite convincing evidence that group V sPLA₂, a Me-indoxam-sensitive enzyme, augments arachidonate release in mouse macrophages (10). This again suggests that the sPLA₂ acts prior to release from these cells (12).

FIGURE 1.

cPLA₂-α and sPLA₂ inhibitor structures.

Based on our findings with Me-indoxam described above, we were intrigued by the report of Akiba et al. (15) that the sPLA₂ inhibitor indoxam, which is structurally similar to Me-indoxam (Fig. 1), blocks PGE₂ generation in a rat gastric mucosa cell line (RGM1) stimulated with TGF-α and IL-1β. As pointed out by Akiba et al. (15) RGM1 cells produce PGE₂ via cyclooxygenase-2 when stimulated by TGF-α. The latter is known to induce the proliferation of gastric epithelial cells as part of the gastric lesion wound healing process (16). Also, PGE₂ generated in gastric cells, including epithelial cells and fibroblasts, promotes healing of gastric mucosal lesions and the maintenance of gastric mucosal integrity as shown by several studies (for example see Ref. 17). More recent studies by Akiba et al. (15) showed that IL-1β synergizes with TGF-α to elicit PGE₂ production from RGM1 cells and that this cytokine may also be involved in healing of gastric lesions through generation of PGE₂.

We now report additional studies on the production of arachidonate and PGE₂ from RGM1 cells, with particular focus on the use of cell-permeable and cell-impermeable sPLA₂ inhibitors. In addition, we studied the coordinate action between sPLA₂ and cPLA₂-α in these cells. Finally, we have carried out additional studies with group IIA sPLA₂-transfected HEK293 cells that provide further evidence that the sPLA₂ acts prior to release from the cells. Similarities were found for the coordinate action of group IIA sPLA₂ and cPLA₂-α in transfected HEK293 cells and in nontransfected RGM1 cells.

EXPERIMENTAL PROCEDURES

Materials

[³H]Arachidonic acid is from PerkinElmer Life Sciences. Fatty acid free bovine serum albumin is from Sigma (catalog number A6003). Recombinant human IL-1β and TGF-α are from R & D Systems (catalog numbers 201-LB-005 and 239-A-100). IL-1β and TGF-α stock solutions were made according to the manufacturer’s recommendation. Sterile phosphate-buffered saline containing 0.1% bovine serum albumin was used to prepare a stock solution of 10 ng/μl of IL-1β, and 10 mM acetic acid containing 0.1% bovine serum albumin was used to prepare a stock solution of 50 ng/μl of TGF-α. Recombinant rat group IIA sPLA₂ was obtained as a gift from M. Janssen (University of Utrecht, The Netherlands) (18). RGM1 cells were obtained from the Riken Cell Bank (cell number RCB0876) with permission from Dr. Hirofumi Matsui (University of Tsukuba). The preparation of anti-mouse group IIA sPLA₂ antiserum will be described elsewhere. Wyeth-1 was prepared as described (19), and its structure and purify were confirmed by reverse-phase high pressure liquid chromatography, ¹H NMR, and electrospray ionization mass spectrometry (not shown). Pyrrolidine-2 (also known as pyrrophenone), Me-indoxam, and indoxam were prepared as described (12, 20, 21) and characterized as for Wyeth-1.

Cell Culture

RGM1 cells were maintained in DMEM/F-12 medium (catalog number 11320–033, Invitrogen) containing 20% heat-inactivated, fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin (22) in plastic dishes in a humidified atmosphere of 5% CO₂ at 37 °C. Cells were routinely split with trypsin/EDTA.

Arachidonate Release and PGE₂ Production

Cells were plated at 2 × 10⁵ cells/well in 24-well plates in DMEM/F-12 containing 20% FBS and were allowed to adhere for 5–7 h. The medium was replaced with serum-free DMEM/F-12 containing 0.01% fatty acid-free bovine serum albumin and 0.1 μCi/ml [³H]arachidonic acid and incubated for 20–24 h. The labeled cells were covered with 1 ml of DMEM/F-12 containing 0.01% fatty acid-free bovine serum albumin. After about 10 min, the medium was removed. For time course experiments, the labeled cells were covered with 0.5 or 1 ml of DMEM/F-12 medium containing 5 ng/ml IL-1β, 100 ng/ml TGF-α, or their combination for the desired time period (0, 12, and 24 h). For the experiment to check cPLA₂-α and sPLA₂ inhibitors, recombinant rat group IIA sPLA₂ or heparin, the labeled cells were covered with 0.5 or 1 ml of DMEM/F-12 medium containing the combination of 5 ng/ml IL-1β and 100 ng/ml TGF-α in the absence or presence of various concentrations of cPLA₂-α and sPLA₂ inhibitors or heparin for 24 h. In studies with exogenously added recombinant rat group IIA sPLA₂, cytokines were omitted in some studies. As noted under “Results,” cPLA₂-α and sPLA₂ inhibitors were added either at the time of cytokine addition or added 12 h after the addition of cytokines. In both cases, arachidonate release was measured 24 h after the addition of cytokines.

The medium was removed and centrifuged for 7 min at 3,000 rpm to pellet any dislodged cells. A 0.25- or 0.5-ml aliquot of the supernatant was submitted to scintillation counting. Trypsin/EDTA (0.5 ml) was added to the cell pellet in the well, and the plate was placed in the incubator for about 30 min. The cells were resuspended by pumping the solution up and down several times with a pipette, and all of the liquid was submitted to scintillation counting to give the cell-associated counts/min. The percentage of [³H]arachidonate release to the medium was calculated as 100 × (dpm in medium)/(dpm in medium + cell-associated dpm) (12).

For PGE₂ production measurements, cells were plated at 1 × 10⁶ cells/well in 6-well plates in DMEM/F-12 containing 20% FBS, and allowed to adhere for 5–7 h. The medium was replaced with serum-free DMEM/F-12 containing 0.01% fatty acid-free bovine serum albumin and 1 μCi/ml [³H]arachidonic acid and incubated for 20–24 h. The labeled cells were washed two times with DMEM/F-12 containing 0.01% fatty acid-free bovine serum albumin and a further time with DMEM/F-12. The labeled cells were covered with 1 ml of DMEM/F-12 medium containing 5 ng/ml IL-1β and 100 ng/ml TGF-α in the absence or presence of various cPLA₂-α or sPLA₂ inhibitors for 24 h. For PGE₂ analysis, 1 ml of culture medium was centrifuged to pellet any dislodged cells, and 0.8 ml of supernatant was mixed with 0.2 ml of 2 mM aqueous EDTA (adjusted to pH 3.0 with HCl). Lipids were extracted twice with 2 ml of ethyl acetate, and ethyl acetate was evaporated under a nitrogen stream. Samples were spotted onto a aluminum-back silica gel plate (20 × 20 cm) with small amounts of ethyl acetate and separated by thin layer chromatography using the upper phase of ethyl acetate/isooctane/acetic acid/H₂O (9:5:2:10, v/v) (15, 28). Authentic PGE₂ was added to each sample before spotting, and the plate was placed in a glass tank containing I₂ to visualize the PGE₂-containing plate region. The appropriate regions of the plate were removed with scissors, and the slices were added to scintillation fluid in a vial for liquid scintillation counting.

Quantification of sPLA₂ Activity

Cells were plated at 1 × 10⁶ cells/well in 6-well plates in DMEM/F-12 containing 20% FBS and allowed to adhere for 5–7 h. The medium was replaced with serum-free DMEM/F-12 containing 0.01% fatty acid-free bovine serum albumin, and cells were incubated for 20–24 h. For time course experiments, the cells were covered with 1 ml of DMEM/F-12 medium containing 5 ng/ml IL-1β and 100 ng/ml TGF-α for 0, 12, or 24 h. For 24 h inhibition experiments, the cells were covered with 1 ml of serum-free DMEM/F-12 containing 5 ng/ml of IL-1β and 100 ng/ml of TGF-α in the presence or absence of various concentrations of sPLA₂ or cPLA₂-α inhibitors for 24 h. The sPLA₂ activity was measured using the fluorometric assay using 50 μl of culture medium as described previously (12). The assay was calibrated with a standard amount of recombinant rat group IIA sPLA₂ (23). In some studies we also measured the sPLA₂ activity in cells after lysis with the same lysis buffer used for Western blotting (see below).

Immunoprecipitation and Western Blotting

Protein A-Sepharose slurry (50 μl; catalog number 17-0780-01, Amersham Biosciences) was incubated with 10 μl of antiserum against mouse group IIA sPLA₂ or preimmune serum in phosphate-buffered saline for 2 h with gentle shaking on ice. The gel was pelleted and washed six times with phosphate-buffered saline. Culture medium (100 μl) was incubated with 5 μl of washed protein A-Sepharose (containing either preimmune, immune serum, or nothing), and the solution was gently shaken for 4 h on ice. The sample was centrifuged, and 50 μl of supernatant was subjected to the fluorometric sPLA₂ assay.

For detection of cPLA₂-α by Western blotting, RGM1 cells were treated with cytokines as above and then washed three times with ice-cold phosphate-buffered saline and scraped into ice-cold buffer (50 mM Hepes, 150 mM NaCl, 1 mM EGTA, 1 mM EDTA, 10% glycerol, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, 10 μg/ml leupeptin). The lysate was centrifuged at 16,000 rpm at 4 °C for 15 min, and the supernatant was used for Western blot analysis. Each lane of the 10% SDS-polyacrylamide gel was loaded with 40 μg of cell protein (Bio-Rad Bradford assay). Proteins in the gel were electrotransfered to a nitrocellulose membrane, and the membrane was blocked overnight at 4 °C with 5% (w/v) milk protein in buffer (per liter, 3 g of Tris, 8 g of NaCl, 0.2 g of KCl, 1 ml of Tween 20, pH 7.4). The membrane was probed with anti-cPLA₂-α polyclonal IgG (1:5,000 dilution; catalog number Sc-438, Santa Cruz Biotechnology), and detection was carried out with ECL (Amersham Biosciences).

RNA Purification and Quantitative PCR

Cells were plated at 1 × 10⁶ cells/well in 6-well plates and were stimulated with TGF-α and IL-1β in the absence or presence of various concentrations of cPLA₂-α or sPLA₂ inhibitors for 24 h (see above for stimulation and inhibition procedures). Total RNA was extracted using an SV total RNA isolation kit (catalog number Z3100, Promega) according to the manufacturer’s instructions. Total RNA (1 μg, based on the absorbance at 260 nm) was reverse-transcribed with the first-strand cDNA synthesis system for quantitative RT-PCR kit (catalog number 11801-025, Marligen Biosciences) following the manufacturer’s protocol. Real time PCR was carried out on a DNA Engine Opticon 2 real time PCR detection system (MJ Research, Inc.) using a DyNAmo SYBR Green qPCR kit (catalog number F-400L, Finnzymes) following the manufacturer’s instructions.

PCR primers are as follows (numbers in parentheses are the expected length in base pairs for the PCR product): group IB (139), TGCTACAATCAGGCCAAGAAGCTG and TGCAGATGAAGCTCTCACAGTCGT; group IIA (117), CTATGGCTTCTACGGTTGCCATTGTG and CATCCACGTTTCTCCAGACGGTTGTA; group IIC (133), ATTCCTGCCCTGGAATCAGACCAT and TCTTGCCTCCACCTCTCAAATGCT; group IID (104), TGGCCTTGATGATGTCCTCTTGGT and AGGCCCAGAAAGACCAGAGTTTGA; group IIE (130), ATTCCTCTCCTGCAAACCCATCCT and TTAGGGTCTTGTGAGCGCTGTTGA; group IIF (127), AGGGTTCAGGAAGAAGGTGTTGGT and CAGGACTGCGATGGCGAAGAATTT; group III (147), CGTGTGGAACCCGACTCAATACAA and AGCCCAGGAAGCTGATGTAGACAA; group V (124), TCTGGAACCCAACTGCCATTACCA and TGGTGTTCTTCTCGCCTCGTGAAT; group X (137), TGCCATTGACTGGTGCTGCTACTA and ATTTGTTCTCTGCCGGTCCACACA; group XIIA (133), GCTGCGTGTTGGTGTCGTTATGAA and AAACCAAGGCAGCTTTAGGCTGTG; and GAPDH (141), TGACTCTACCCACGGCAAGTTCAA and ACGACATACTCAGCACCAGCATCA.

For each target gene, different primer concentrations and annealing temperatures were tested to optimize PCR amplification and to reduce the possible formation of primer-dimers. In all cases the optimal primer concentration was 200 nM. Thermal cycling parameters were as follows: 10 min at 95 °C for initial denaturation followed by 36 cycles (94 °C for 10 s, 64 °C for 20 s, 72 °C for 10 s, temperature ramp to 79 °C over 1 s followed by fluorescence data collection at 79 °C). After the last cycle, the sample was heated at 72 °C for 7 min for final extension and then submitted to a melting curve analysis to check for the formation of primer-dimers and nonspecific products. The temperature of 79 °C for data collection is below the T_m of products and above the T_m of possible primer-dimers; this helps to eliminate detection of primer-dimers. Each measurement was run in duplicate. PCR efficiencies for target and reference genes (GAPDH) were determined by generating a standard curve using serial dilutions of cDNA. Real time PCR data were analyzed using a relative quantification method as described previously (24). Briefly, the relative expression ratio of a target gene is calculated based on PCR efficiency and threshold cycle deviation of an unknown sample versus a calibrator (12 h of cells without stimulation), which was normalized to the reference gene (GAPDH). After quantitative PCR analysis, a portion of the amplification products was separated by electrophoresis on a 3% ultra-agarose gel (catalog number 15510-019, Invitrogen).

Caco-2 Permeability Studies

Permeability of Me-indoxam and indoxam across tight monolayers of Caco-2 cells was measured as described previously (12).

RNA Interference Studies

Stealth small interfering RNA (siRNA) duplex against cPLA2-α (sense, 5′-AUCCGAUGGACCCAACUUGCUUGGU-3′; antisense, 5′-ACCAAGCAAGUUGGGUCCAUCGGAU-3′) and rat group IIA sPLA₂ (sense, 5′-GCCUUCUGGAGUUUGGGCAAAUGAU-3′; antisense, AUCAUUUGCCCAAACUCCAGAAGGC) were synthesized by Invitrogen. Validated Stealth negative control RNAi duplex with medium GC content (catalog number 12935-300, Invitrogen,) was used as control. The transfection efficiency was monitored using fluorescent RNA duplex (catalog number 13750070, Invitrogen). Eighty nM of Stealth siRNA was transfected into cells using Lipofectamine 2000 reagent (catalog number 13750070, Invitrogen) according to the manufacturer’s instructions. For arachidonate release experiments, 1 × 10⁵ cells were plated into 24-well plates, and cells were incubated in DMEM/F-12 medium containing 20% FBS for 24 h. The medium was replaced with serum-free DMEM/F-12 medium containing siRNA-Lipofectamine complex. After 6 h post-transfection, the medium was replaced with serum-free DMEM/F-12 containing 0.01% fatty acid-free bovine serum albumin and 0.1 μCi/ml [³H]arachidonic acid, and cells were incubated for 20–24 h. For sPLA₂ activity assays or preparation of cell lysates for Western blot, 3 × 10⁵ cells were plated into 6-well plates, and cells were incubated in DMEM/F-12 medium containing 20% FBS for 24 h. The medium was replaced with DMEM/F-12 medium containing siRNA-Lipofectamine complex. After 6h post-transfection, the medium was replaced with DMEM/F-12 containing 20% FBS for another 20–24 h. The cells were made quiescent using serum-free DMEM/F-12 containing 0.01% fatty acid-free bovine serum albumin for 16–20 h followed by TGF-α/IL-1β treatment.

Studies with HEK293 Cells

HEK293 cells stably transfected with human group IIA sPLA₂ were cultured and labeled with [³H]arachidonic acid as described previously (12). After labeling the cells with 0.1 μCi of [³H]arachidonic acid per well for 18–24 h, the medium was removed, and the cells were covered with complete medium containing 15 μg/ml brefeldin A or Me₂SO vehicle. The cells were incubated at 37 °C with 5% CO₂ for 1 h and then the medium was removed, and the cells were covered with complete medium containing 1 mg/ml heparin (catalog number H3149, Sigma) with brefeldin A or with vehicle. After incubation as above for 30 min, the medium was removed, and cells were washed twice with complete medium without heparin and with brefeldin A or vehicle and then covered with complete medium with brefeldin A or vehicle. Finally, the cells were covered with complete medium containing 2 ng/ml IL-1β (added from a 0.1 ng/μl stock in phosphate-buffered saline, 0.2% bovine serum albumin (catalog number A6003, Sigma)) and with brefeldin A or vehicle. After incubation as above for 4 h, the medium was removed and centrifuged at 3,000 rpm in a table top centrifuge for 7 min. A 500-μl aliquot of the supernatant was submitted to scintillation counting. 0.5 ml of trypsin/EDTA was added to the remaining cell layer, and the cells were incubated 30 min as above, and the cell suspension was submitted to scintillation counting. The percent [³H]arachidonate release is obtained as 100 times the total tritium in the culture medium divided by total tritium (culture medium + cell-associated). In some studies, cells were washed with high salt-containing medium to remove extracellular sPLA₂ prior to brefeldin A treatment. In this case, the above procedure was used except that heparin was replaced with 1 M NaCl.

To measure secretion of human group IIA sPLA₂, cells were cultured, pretreated with brefeldin A or vehicle, and pretreated with heparin (or 1 M NaCl) in complete medium as for the arachidonate release studies. After removing the heparin-containing medium, cells were covered with complete medium containing 2 ng/ml IL-1β and with 15 μg/ml brefeldin A or vehicle. After incubation for 4 h, a 200-μl aliquot of the cultured medium was withdrawn and centrifuged as above, and the supernatant was submitted to the fluorometric sPLA₂ assay (12). The remaining medium was removed, and the cells were covered with complete medium containing 1 mg/heparin (or 1 M NaCl) with brefeldin A or with vehicle. After incubation for 30 min, a 200-μl aliquot of medium was removed, centrifuged, and submitted to the fluorometric sPLA₂ assay.

RESULTS

Studies with RGM1 Cells

Sato and co-workers (15) have shown previously that stimulation of RGM1 cells with IL-1β and TGF-α leads to a synergistic generation of PGE₂. Fig. 2 shows [³H]arachidonate release measured in the present study. Release of [³H]arachidonate in the culture medium of RGM1 cells in the absence of cytokine stimulation increases linearly over 24 h. In the presence of TGF-α and IL-1β, [³H]arachidonate release increases beyond the nonstimulated value, with the increase being most significant during the 12–24-h period post-cytokine addition. TGF-α alone caused an intermediate increase in [³H]arachidonate release, and fatty acid release with IL-1β alone was similar to that seen without cytokine stimulation (Fig. 2). The data show that TGF-α and IL-1β act synergistically to promote arachidonate release.

FIGURE 2.

Release of [³H]arachidonate into the culture medium from RGM1 cells. Cytokine stimulation was carried out as described under “Experimental Procedures.” Each point is the average and standard deviation of three independent experiments.

As shown in Fig. 3A, cytokine stimulation of RGM1 cells leads to a marked increase in the amount of sPLA₂ enzymatic activity measured in the culture medium. The increase occurs mainly during the 12–24 period. sPLA₂ enzymatic activity was detected with a real time, fluorometric assay using a pyrene-labeled phosphatidylglycerol analog. We also measured the amount of sPLA₂ activity in the washed cells 24 h after cytokine stimulation. We found that 25% of the total sPLA₂ activity is in the cell lysis, whereas 75% is in the culture medium. No activity was measured in the presence of 1 mM EGTA (not shown), consistent with a Ca²⁺-dependent sPLA₂ being responsible for the hydrolysis of the fluorometric phospholipid. Phosphatidylglycerol is the most preferred substrate for all mammalian sPLA₂s (25). If it is assumed that all of the released sPLA₂ is the group IIA enzyme (see below), it can be deduced that 10⁶ RGM1 cells release 3.8 ng of sPLA₂ into the culture medium after stimulation with cytokines for 24 h (based on the measured specific activity of recombinant rat group IIA sPLA₂ of 42.3 pmol/(min × ng)).

FIGURE 3.

A, sPLA₂ enzymatic activity in the culture medium of RGM1 cells. Cytokine stimulation (TGF-α × IL-1β) and sPLA₂ activity analysis were carried out as described under “Experimental Procedures.” B, cells were stimulated with the indicated cytokines, and sPLA₂ activity was measured after 24 h. Each point is the average and standard deviation of two independent experiments.

As shown in Fig. 3B, after 24 h of stimulation, TGF-α alone led to less than a 2-fold increase in sPLA₂ activity in the culture medium; IL-1β alone led to a 4-fold increase in sPLA₂ activity, and both cytokines together led to a 29-fold increase in sPLA₂ activity. Thus, as for arachidonate release, there is a synergistic action between TGF-α and IL-1β in promotion of sPLA₂ enzymatic activity secreted into the culture medium.

Fig. 4 shows that the lipolytic enzymatic activity released into the culture medium from cytokine-stimulated RGM1 cells is highly sensitive to Me-indoxam and indoxam. Both compounds display virtually identical dose-response curves with a concentration required for 50% inhibition (IC₅₀) of 3 nM. Previous studies have shown that Me-indoxam is a potent inhibitor of human and mouse groups IIA, IIC, IIE, and V sPLA₂s with IC₅₀ values in the 5–60 nM range (25). Thus, the results in Fig. 4 are consistent with the enzymatic activity being detected with the fluorometric phospholipid substrate arising from an sPLA₂. The results in Fig. 5 show that essentially all of the sPLA₂ enzymatic activity secreted from cytokine-stimulated RGM1 cells is due to the group IIA enzyme. In this experiment, the culture medium from cytokine-stimulated RGM1 cells was treated with anti-mouse group IIA sPLA₂ antiserum bound to protein A-Sepharose. Virtually all of the sPLA₂ enzymatic activity was removed, whereas half of the activity remained in the medium when protein A-Sepharose alone was used or when protein A-Sepharose loaded with preimmune serum was used. Previous studies have shown that the anti-mouse group IIA sPLA₂ antiserum detects this protein at the 0.1–1 ng level in Western blots but does not give a signal for 50 ng of each of the other mouse sPLA₂s.³ All together, the results clearly show that virtually all of the sPLA₂ activity released during the 12–24-h period post-stimulation of RGM1 with cytokines is due to the rat group IIA sPLA₂. This is also supported by quantitative PCR studies described below.

FIGURE 4.

Culture medium from RGM1 cells stimulated with TGF-α and IL-1β for 24 h was submitted to the fluorometric sPLA₂ assay in the presence of the indicated concentration of Me-indoxam or indoxam added to the assay cuvette.

FIGURE 5. Immunodepletion of sPLA₂ from the medium of RGM1 cells stimulated with TGF-α and IL-1β for 24 h.

Culture medium was treated with nothing, with protein A-Sepharose (Prot A-Seph) alone, with protein A-Sepharose loaded with pre-immune serum, or with protein A-Sepharose loaded with anti-mouse group IIA sPLA₂ immune serum as described under “Experimental Procedures.” The sPLA₂ enzymatic activity in the supernatant above the Sepharose pellet was assayed using the fluorometric assay.

In order to explore the contribution of group IIA sPLA₂ and cPLA₂-α to arachidonate release and PGE₂ production in cytokine-stimulated RGM1 cells, studies with highly selective, and potent inhibitors were carried out. As shown in Fig. 6A, 1, 10, and 20 μM indoxam dose-dependently inhibited arachidonate release; 20 μM caused 75% inhibition of the cytokine-dependent arachidonate released. Remarkably, 1, 10, and20μM Me-indoxam had almost no effect (18%inhibition of cytokine-dependent arachidonate release with 20 μM Me-indoxam). Both cPLA₂-α inhibitors caused significant dose-dependent inhibition of arachidonate release; pyrrolidine-2 inhibited cytokine-dependent arachidonate release by 68% at 2 μM and Wyeth-1 by 100% at 6 μM. When 10 μM indoxam was added 12 h after cytokine addition, cytokine-dependent arachidonate released was reduced by 16 ± 1% (three independent experiments; data not shown) compared with 43% inhibition seen when the inhibitor was added along with cytokines 24 h before arachidonate release was measured (Fig. 6A).

FIGURE 6.

A, effect of PLA₂ inhibitors on arachidonate release from cytokine-stimulated RGM1 cells. PLA₂ inhibitors were added at the indicated concentrations at the time of addition of TGF-α and IL-1β, and arachidonate release to the medium, expressed as a percent of total cellular arachidonate, was measured after 24 h (additional details are given under “Experimental Procedures”). The average and standard deviations from four independent experiments are shown. The vehicle used to add inhibitors was Me₂SO in all cases, and vehicle alone had no effect on arachidonate release (not shown). B, same as for Fig. 6A except PGE₂ release from 1 × 10⁶ RGM1 cells was measured. Pyrr-2, pyrrolidine-2.

Indoxam also inhibited cytokine-dependent PGE₂ production (Fig. 6B). When 10 μM indoxam was added to the culture medium together with cytokines, cytokine-dependent PGE₂ production measured after 24 h was inhibited by 35%, whereas 10 μM Me-indoxam had no effect. Pyrrolidine-2 at 2 μM reduced cytokine-dependent PGE₂ production by 87% and 6 μM Wyeth-1 by 81%.

To address whether Me-indoxam was being destroyed by cultured RGM1 cells, we added 1 μM Me-indoxam to the culture medium of RGM1 cells along with cytokines. After 24 h, a 50-μl aliquot of culture medium was added to the fluorometric sPLA₂ assay. The amount of enzymatic activity was 7% of that measured in an aliquot of medium from cells that were not treated with Me-indoxam (not shown). In this experiment, the concentration of Me-indoxam in the fluorometric sPLA₂ assay would be 50 nM if it was not destroyed upon incubation with cytokine-stimulated RGM1 cells. This experiment shows that most, if not all, of the Me-indoxam remains after a 24-h incubation with RGM1 cells. The same was found with indoxam (not shown).

We also measured the permeability of Me-indoxam and indoxam across tight monolayers of Caco-2 cells as a way to estimate the ability of these compounds to cross the plasma membrane of mammalian cells. As found in our earlier study (12), Me-indoxam displayed a very low permeability across these cells of P_app = 0.1 × 10⁻⁶ cm/s. In contrast indoxam displays increased permeability compared with Me-indoxam, with P_app value of 0.3 × 10⁻⁶ cm/s.

Arachidonate release induced by TGF-α alone was also inhibited by pyrrolidine-2 (65% inhibition at 2 μM), by Wyeth-1 (100% inhibition at 6μM), and by indoxam (78% inhibition at 20 μM) (not shown).

Consistent with the reduction in arachidonate release caused by addition of cPLA₂-α inhibitors, Western blot analysis showed the presence of cPLA₂-α in RGM1 cells (Fig. 7). In the absence of cytokine stimulation, most of the cPLA₂-α migrated as the faster, nonphosphorylated form. After 12 or 24 h of culture in the absence of cytokines or in the presence of IL-1β alone, cPLA₂-α remained mostly in the nonphosphorylated form. In contrast, after 12 or 24 h of stimulation with TGF-α with or without IL-1β, cPLA₂-α mostly shifted to the phosphorylated form (Fig. 7).

FIGURE 7. Western blot analysis of cPLA₂-α in RGM1 cells.

Lane 1, 0 h treatment; lane 2, 12 h without cytokine treatment; lane 3, 12 h with IL-1β; lane 4, 12 h with TGF-α; lane 5, 12 h with both cytokines; lane 6, 24 h without cytokine treatment; lane 7, 24 h with IL-1β; lane 8, 24 h with TGF-α; lane 9, 24 h with both cytokines. cPLA₂-αruns with the 100-kDa marker. The identities of the cross-reacting bands at ~ 80 and ~ 120 kDa are unknown.

Group IIA sPLA₂s are highly basic proteins and are known to bind tightly to anionic polymers, including heparin (26). Addition of extra-cellular heparin to the culture medium of cells has been used to reduce the amount of extracellular group IIA sPLA₂ that is bound to cell surface proteoglycans (12, 27). As shown in Fig. 8, addition of heparin to the culture medium of cytokine-stimulated RGM1 cells had little, if any, effect on arachidonate release. The highest dose of heparin used (1 mg/ml) has been more than sufficient to remove most of the group IIA sPLA₂ bound to the cell surface of various mammalian cells (12, 27).

FIGURE 8. Arachidonate release from cytokine-stimulated RGM1 cells in the absence and presence of the indicated amount of heparin added to the culture medium at the time of cytokine addition (24 h prior to measurement of released arachidonate.

). Shown are the average values and standard deviations from three independent experiments.

We also tested if exogenously added recombinant rat group IIA sPLA₂ could elicit arachidonate release from RGM1 cells. As shown in Fig. 9, addition of up to 1000 ng of this enzyme to the culture medium in the absence or presence of cytokine stimulation failed to elicit arachidonate release. High amounts of recombinant group IIA sPLA₂ caused some reduction in the cytokine-dependent arachidonate release for reasons that are not known. Based on the amount of endogenous group IIA sPLA₂ produced by these cells (~ 4 ng, see above), it can be concluded that exogenously added enzyme is at least 3 orders of magnitude less efficient than endogenously produced enzyme at eliciting arachidonate release.

FIGURE 9. Arachidonate released from RGM1 cells with and without cytokine stimulation by the indicated amounts of exogenously added recombinant rat group IIA sPLA₂.

Enzyme and cytokines were added 24 h prior to measurement of arachidonate release Shown are the average values and standard deviations from two independent experiments.

The effect of the cPLA₂-α inhibitors on the appearance of group IIA sPLA₂ in the extracellular medium following cytokine stimulation was studied. Pyrrolidine-2 or Wyeth-1 added at the time of cytokine addition caused significant reduction in the amount of sPLA₂ enzymatic activity measured in the culture medium taken at 24 h (Fig. 10). Near-complete inhibition was seen with 6 μM pyrrolidine-2, whereas 6 μM Wyeth-1 was less effective at reducing the amount of sPLA₂ secreted to the medium (Fig. 10). These cPLA₂-α inhibitors do not directly inhibit sPLA₂ enzymatic activity; when they were added to the fluorometric assay of recombinant rat group IIA sPLA₂ at twice the concentration present in the cell culture studies, no inhibition was observed. The dose-response data for the ability of pyrrolidine-2 and Wyeth-1 to reduce the amount of group IIA sPLA₂ released from cytokine-stimulated RGM1 cells (Fig. 10) corresponds to the dose response for the effect of these compounds on arachidonate release (Fig. 6A). We also found that treatment with 6 μM pyrrolidine-2 or Wyeth-1 leads to an 85 and 70% decrease, respectively, in the amount of sPLA₂ enzymatic activity in washed cells (in the cell lysate) (not shown). Thus, inhibition of the amount of sPLA₂ in the culture medium and in the cells by the cPLA₂-α inhibitors are approximately the same.

FIGURE 10. Appearance of sPLA₂ enzymatic activity in the culture medium of RGM1 cells in the presence and absence of cPLA₂-α inhibitors.

Inhibitors were added at time 0 along with cytokines, and sPLA₂ enzymatic activity was measured after 24 h. Shown are the average values and standard deviations from two independent experiments.

We examined the expression of group IIA sPLA₂ in RGM1 cells at the mRNA level by using quantitative PCR. As shown in Fig. 11A, stimulation of RGM1 cells with TGF-α and IL-1β led to a dramatic increase in the amount of group IIA sPLA₂ mRNA (6-fold in the first 12 h and then 460-fold after 24 h; all data are given as mRNA level relative to the minus cytokine/12-h mRNA level). Thus, group IIA sPLA₂ mRNA levels track with the amount of sPLA₂ enzymatic activity seen in the RGM1 culture medium (Fig. 3). Both pyrrolidine-2 and Wyeth-1 dose-dependently reduced group IIA sPLA₂ mRNA levels (Fig. 11B). Pyrrolidine-2 was more potent than Wyeth-1; 6 μM leads to an ~ 100-fold reduction, whereas 6 μM Wyeth-1 reduces the mRNA level by 3-fold. This is consistent with pyrrolidine-2 being more potent than Wyeth-1 at reducing arachidonate release and group IIA sPLA₂ enzymatic activity in the culture medium (Figs. 6 and 10). Indoxam at 20 μM had no effect on the group IIA sPLA₂ mRNA level (Fig. 11B).

FIGURE 11.

A, detection of sPLA₂ mRNAs by RT-PCR. After quantitative RT-PCR analysis, a portion of the reaction mixture was examined by gel electrophoresis (top panel). RGM1 cells were stimulated with TGF-α and IL-1β (+Cyt) or without cytokines (−Cyt) for 24 h. NTC is the no-template control (bottom panel). B, cDNA from a mixture or rat tissue was used as a positive control for PCR. B, the level of mRNA for either group IIA or XIIA sPLA₂ is plotted relative to the signal obtained after culturing the cells for 12 h in the absence of cytokines. In some experiments, pyrrolidine-2 (Pyr-2), Wyeth-1 (Wy-1), or indoxam (Indox) was present during the 24-h cytokine stimulation period. The reduction seen with 6 μM Wyeth-1 is 3-fold, and the error bar is so small that it does not display well. Data shown are the averages and standard deviations of two independent experiments.

We also carried out quantitative RT-PCR for all known rat sPLA₂s (groups IB, IIC, IID, IIE, IIF, III, V, X, and XIIA). As shown in Fig. 11A (top panel), group XIIA sPLA₂ mRNA was detected along with IIA sPLA₂ mRNA, but its level was much lower than the level of IIA at 24 h, and its level was not influenced by cytokines or the presence of cPLA₂ inhibitors. For both group IIA and XIIA sPLA₂, gel analysis of the PCR mixtures showed the expected size DNA band, and no other reaction products were observed. The PCR efficiencies for GAPDH and groups IIA and XIIA sPLA₂s were measured to be 1.71, 1.84, and 1.81, respectively. mRNA for all of the other rat sPLA₂s was not observed in RGM1 cells either before or after 24 h of cytokine stimulation (not shown). However, as shown in Fig. 11 (bottom panel), the correct size PCR bands were observed for all of these sPLA₂s when cDNA from a mixture of rat tissues was used as a target.

We also used RNA interference to knockdown the level of rat group IIA sPLA₂ and cPLA₂-α in RGM1 cells followed by arachidonate release studies. As shown in Fig. 12A, group IIA sPLA₂ RNAi led to an ~ 3-fold decrease in the amount of sPLA₂ enzymatic activity secreted into the culture medium after cytokine treatment. Western blot analysis shows a significant reduction in cPLA₂-α protein after transfection of cells with the cPLA₂-α RNAi (Fig. 12B). As shown in Fig. 12C, knockdown of cPLA₂-α led to a small but statistically significant reduction in the amount of group IIA sPLA₂ secreted into the culture medium. Fig. 12C shows that RNAi knockdown of cPLA₂-α or group IIA sPLA₂ led to a reduction in the amount of cytokine-stimulated arachidonate release. These results are consistent with the studies with PLA₂ inhibitors described above but are less dramatic, presumably because a higher level of PLA₂ inhibition was achieved with inhibitors compared with the level of knockdown achieved with RNAi.

FIGURE 12. RNA interference of group IIA sPLA₂ and cPLA₂-α.

A, amount of group IIA sPLA₂ in 50 μl of RGM1 culture medium (measured with the fluorometric PLA₂ assay) after treatment of cells with the indicated siRNA. Shown are the averages and standard deviations from three independent experiments. B, Western blot analysis for cPLA₂-α. Lane 1, mock-transfected; lane 2, negative control-transfected; lane 3, cPLA₂-α siRNA-transfected; lane 4, group IIA sPLA₂ siRNA-transfected. The identity of the cross-reactive band at ~ 130 kDa is not known. C, arachidonate release from RGM1 cells after treatment with the indicated siRNA in the presence and absence of TGF-α/IL-1β. Arachidonate release was measured 24 h after cytokine addition. Shown are the averages and standard deviations from three independent experiments.

Studies with Transfected HEK293 Cells

Arachidonate release from both cytokine-stimulated RGM1 and sPLA₂-transfected HEK293 cells share the common phenomenon of insensitivity to the potent sPLA₂ inhibitor Me-indoxam (Fig. 6A) (12). Based on this and a large body of additional data, we suggested that group IIA sPLA₂ contributes to arachidonate release prior to externalization from HEK293 cells. In this study, we have used brefeldin A to block cellular secretion and to study the consequence of this on cytokine-stimulated arachidonate release. Prior to blocking secretion of group IIA sPLA₂ with brefeldin A, we wanted to remove enzyme that was already externalized, which is mainly bound to the cell surface by electrostatic interaction with anionic cellular components including, but not limited to, proteoglycan (12, 27). Two independently obtained HEK293 cell clones that overexpress human group IIA sPLA₂ were used in parallel. Cells were labeled with [³H]arachidonic acid and then washed with complete medium containing soluble heparin to remove cell surface-bound sPLA₂ (12, 27). Cells were then treated with cytokines with and without brefeldin A. Heparin was omitted from this brefeldin A treatment period because we have shown that heparin causes inhibition of arachidonate release by a unknown and nonspecific mechanism (12).

When cells were first cleared of their extracellular human group IIA sPLA₂ by heparin treatment, the amount of sPLA₂ enzymatic activity secreted into the culture medium taken after the 4-h cytokine stimulation period and in the presence of brefeldin A was 20 ± 5% that measured in the absence of brefeldin A (triplicate analysis). For this measurement, cells were treated with heparin-containing medium for a 30-min period after the 4-h cytokine treatment period so that total extracellular enzyme (free and cell surface-associated) was measured. As expected, these results show that brefeldin A treatment inhibits the secretion of most of the human group IIA sPLA₂ from HEK293 cells. Despite this inhibition of enzyme release, [³H]arachidonate release was not affected by brefeldin A treatment, being 4.35 ± 0.34% release without brefeldin A and 4.92 ± 0.13% with 15 μg/ml brefeldin A (triplicate analysis).

Medium containing 1 M NaCl has also been used to remove cell surface-bound sPLA₂ (27). When cells were cultured in complete medium with IL-1β with or without brefeldin A for 4 h and then washed with complete medium containing 1 M NaCl, the amount of sPLA₂ enzymatic activity measured with or without brefeldin A was not statistically different, and the activity was 5–6-fold higher than that measured when heparin was used to wash the cells. These results show that 1 M NaCl is causing disruption of cells leading to the release of extracellular and intracellular pools of sPLA₂. Thus, studies with 1 M NaCl cannot be interpreted.

DISCUSSION

A key feature of this study is that we study arachidonate release in a cell line that has not been treated exogenously with sPLA₂s or transfected with sPLA₂s. Fig. 13 shows a summary of the pathway of arachidonate release and PGE₂ production in cytokine-stimulated RGM1 cells. TGF-α and IL-1β act synergistically to promote PGE₂ production, as first reported by Akiba et al. (15, 28), and we also report that these two cytokines lead to a synergistic release of arachidonate. A delayed phase of arachidonate release (12–24 h) occurs concomitantly with a large increase in the amount of mRNA for group IIA sPLA₂ and the appearance of group IIA sPLA₂ protein in the culture medium. Group XIIA sPLA₂ is also present in these cells, but its level does not change with cytokine treatment. The other eight known mammalian sPLA₂s are not expressed in RGM1 cells, at least based on mRNA analysis. Group XIIA sPLA₂ probably does not contribute to arachidonate release because recombinant mouse and human group XIIA sPLA₂s are not inhibited by Me-indoxam (25), and the structurally related compound indoxam substantially inhibits arachidonate release from RGM1 cells (Fig. 6A).

FIGURE 13. Arachidonate release and PGE₂ production in TGF-α- and IL-1β-stimulated RGM1 cells.

See text for discussion.

It is generally thought that cPLA₂-α is responsible for arachidonate release in agonist-stimulated mammalian cells. However, the results with highly specific and potent inhibitors show that both cPLA₂-α and group IIA sPLA₂ contribute to arachidonate release and PGE₂ production in cytokine-stimulated RGM1 cells. Because both of these enzymes can liberate arachidonate from the sn-2 position of cellular phospholipids, it is not possible to know from the present results what fraction of the total liberated arachidonate is contributed by each enzyme (i.e. factor α in Fig. 13).

Treatment with TGF-α, but not IL-1β, leads to cPLA₂-α phosphorylation and presumably its activation. However, cPLA₂-α cannot act alone in RGM1 cells because arachidonate release and PGE₂ production is substantially blocked by the sPLA₂ inhibitor indoxam. The fact that both the early and late phases of arachidonate release are blocked by indoxam shows that group IIA sPLA₂ is involved in both phases of lipid mediator production. The failure to observe significant amounts of group IIA sPLA₂ in the culture medium after 12 h of cytokine stimulation could be due to binding of this highly basic protein to anionic proteoglycans on the external face of the plasma membrane (12). Perhaps only after sPLA₂ protein accumulates to a higher level during the late phase does it accumulate in the culture medium. The data also show that group IIA sPLA₂ does not act alone to liberate arachidonate release because two structurally distinct and potent cPLA₂-α inhibitors substantially block arachidonate release. TGF-α or IL-1β did not lead to an alteration in the amount of cPLA₂-α protein. Finally, IL-1β synergizes with TGF-α to cause maximal induction of group IIA sPLA₂ mRNA and protein by an unknown mechanism even though IL-1β does not lead to cPLA₂-α phosphorylation or induction of cPLA₂-α expression.

Studies with the cPLA₂-α inhibitors also show that blocking cPLA₂-α action substantially prevents the induction of group IIA sPLA₂ mRNA and protein. Previous studies using less specific and less potent cPLA₂-α inhibitors have shown a similar requirement for cPLA₂-α in the induction of sPLA₂s (29, 30). The mechanism behind this cPLA₂-α-dependent alteration of sPLA₂ mRNA level remains to be determined.

Referring to Fig. 13, if α is 0 (arachidonate release is solely due to the direct action of cPLA₂-α on phospholipids), the role of group IIA sPLA₂ is to somehow augment the action of cPLA₂-α. On the other hand, if α is 100 (arachidonate release is solely due to the direct of group IIA sPLA₂ on phospholipids), the role of cPLA₂-α is to augment the action of sPLA₂. It is also possible that both lipases are directly responsible for arachidonate release.

A remarkable finding in this study is the fact that group IIA sPLA₂ acts in cytokine-stimulated RGM1 cells prior to its release into the culture medium. The results with the structurally very similar compounds Me-indoxam and indoxam clearly show that not all sPLA₂ inhibitors block the action of these enzymes in cells despite the fact that both compounds bind to rat group IIA sPLA₂ with affinities that are indistinguishable experimentally. Furthermore, addition of recombinant rat group IIA sPLA₂ to RGM1 cells in the presence and absence of TGF-α and IL-1β did not lead to a detectable increase in arachidonate release above that measured in the absence of added enzyme, even though the amount added was 2–3 orders of magnitude more than the amount of group IIA sPLA₂ produced by these cells. Finally, trapping of secreted group IIA sPLA₂ with extracellular heparin did not reduce the amount of arachidonate released. The only reasonable hypothesis is that group IIA sPLA₂ is acting prior to externalization from cells and that indoxam permeates RGM1 cells more than Me-indoxam does.

Although we did not directly measure the ability of indoxam and Me-indoxam to cross membranes of RGM1 cells, we did compare the ability of these two compounds to cross the tight-junction monolayer of Caco-2 cells. This permeability assay is commonly used to predict the passage of drug candidates across the intestinal epithelial cell layer. The Caco-2 cell data indicated that both Me-indoxam and indoxam display low permeability, with indoxam being about 3-fold more permeable than Me-indoxam. In the case of Me-indoxam, we prepared this compound in the ¹⁴C-labeled form and showed by direct cell uptake studies that it did not penetrate into HEK293 cells (12). Such studies were not carried out with indoxam because of the difficulty in preparing radiolabeled compound. It appears that indoxam does not rapidly cross the membranes of RGM1 cells based on the fact that less inhibition of arachidonate release was seen when the compound was added at 12 h rather than at 0 h. This suggests that the compound requires several hours for cell uptake, which is consistent with the low permeability seen with the Caco-2 cell assay. We also found that indoxam did not block arachidonate release from HEK293 cells transfected with human group IIA sPLA₂ regardless of whether the compound was preincubated with cells or not (data not shown). This shows that indoxam is not permeable to all mammalian cell types. It further underscores the need to discover a highly cell permeable sPLA₂ inhibitor that can be used as a more reliable tool to probe the role of sPLA₂s in cellular functions such as arachidonate release. We are currently trying to develop such compounds.

Although we did not examine whether externalized rat group IIA sPLA₂ is taken up into RGM1 cells, we must conclude that arachidonate and PGE₂ production are not the result of an sPLA₂ re-uptake mechanism. If the sPLA₂ passes through the culture medium prior to action, it will become exposed to cell-permeable and cell-impermeable inhibitors (i.e. Me-indoxam) and become inhibited. Thus, the lack of inhibition seen with Me-indoxam rules out sPLA₂ action after possible cell re-uptake.

Although we provided a vast amount of data in our earlier paper showing that arachidonate release when cells are transfected with human group IIA sPLA₂ requires the action of the enzyme prior to externalization from the cells (12), it occurred to us that the use of brefeldin A provides additional insight into the location of sPLA₂ action. In the present study, we found that treatment of transfected HEK293 cells with brefeldin A blocked most of the release of the human group IIA sPLA₂ in the culture medium and yet did not result in a reduction in the amount of arachidonate release. This provides additional strong evidence that the sPLA₂ acts in these cells prior to externalization. Studies with RGM1 cells and brefeldin A were not carried out simply for historical reasons.

It seems that workers in the sPLA₂ field assumed for many years that arachidonate release by these enzymes would be the result of extracellular action of sPLA₂. In fact all of the studies prior to ours on the assessment of indole-type sPLA₂ inhibitors such as indoxam by workers at Lilly and others reported the blockade of arachidonate release when inhibitor was added to cells that were treated with exogenously added group IIA sPLA₂ (for example see Ref. 31). In these studies, relatively large amounts of group IIA sPLA₂ were used, typically > 1–2 μg of enzyme per 1 ml of culture medium. Such concentrations of group IIA sPLA₂ are found in synovial fluid during inflammation and in serum during pancreatitis, for example (32). Indeed, in our hands, Me-indoxam fully blocked arachidonate release from HEK293 cells treated with the large amount of recombinant human group IIA sPLA₂ needed to elicit release from the cells by exogenous enzyme (12). However, these sPLA₂ concentrations are much higher than those that accumulate in cultured RGM1 and HEK293 cells stimulated with cytokines for example. It must be noted that the concentration of sPLA₂ that accumulates in the culture medium of cultured cells depends on the volume of culture medium used; thus, the concentrations may not be physiologically relevant. However, the present studies show that relatively small amounts of intracellularly acting rat group IIA sPLA₂ can cause increased arachidonate and PGE₂ production in cultured RGM1 cells. The findings are very significant as they suggest that inhibitors of sPLA₂ that are cell-permeable should be used to best test the role of these enzymes in inflammation. The recent clinical trial failure of compounds structurally similar to indoxam to produce beneficial results in rheumatoid arthritic and sepsis patients (33, 34) may in part be due to issues of poor cell permeability.

The cross-talk between cPLA₂-α and sPLA₂ seen in RGM1 cells has also been observed in other mammalian cell types. Studies with sPLA₂-transfected HEK293 cells and PLA₂ inhibitors as well as with mesangial cells from wild type and cPLA₂-α-deficient mice clearly show that the sPLA₂ can act together with cPLA₂-α to maximize arachidonate release (11, 12). Also, treatment of human neutrophils with exogenous group V sPLA₂ leads to cPLA₂-α-dependent leukotriene production as shown by studies with cPLA₂-α-deficient mouse neutrophils (35). A final study showing clear coordinate action of these PLA2s is the recent work of Arm and co-workers (10) showing that arachidonate release in zymosan-stimulated mouse peritoneal macrophages is reduced about 50% in cells from group V sPLA₂-deficient mice, and yet arachidonate release is fully blocked in the same cell/agonist system when cells are isolated from cPLA₂-α-deficient mice (5). We have shown that Me-indoxam does not modify arachidonate release levels in zymosan-stimulated mouse peritoneal macrophages.⁴ So it seems that the intracellular action of group V sPLA₂ works together with cPLA₂-α leading to maximal arachidonate release in these cells.