Skip to main content
NCBI home page
Journal of Anatomy logoLink to Journal of Anatomy
. 2008 May;212(5):654–663. doi: 10.1111/j.1469-7580.2008.00892.x

The expression of E-selectin and chemokines in the cultured human lymphatic endothelium with lipopolysaccharides

Yoshihiko Sawa 1, Eichi Tsuruga 1
PMCID: PMC2409092  PMID: 18410313

Abstract

This study investigated the expression of selectins and chemokines in cultured human lymphatic endothelial cells stimulated with lipopolysaccharides. In microarray, vascular cell adhesion molecule-1 and intercellular adhesion molecule-1 gene expressions in the lymphatic endothelium with lipopolysaccharides did not change at 0.5 h but increased two- to three-fold at 12 h, whereas E-selectin increased 10-fold at 0.5 h and 68-fold at 12 h compared with untreated cells. The E-selectin mRNA and protein increased in the lymphatic endothelial cells with lipopolysaccharides at more than two-fold levels compared with human umbilical vein endothelial cells. Induction of Cys-Cys chemokine ligand 2, 3, 5, 7, 8 and 20 mRNAs in the lymphatic endothelial cells with lipopolysaccharides was detected in microarray and real-time PCR. The Cys-Cys chemokine ligand 2, 5 and 20 mRNA amounts in cells with high concentration lipopolysaccharides were larger in the lymphatic endothelial cells than in human umbilical vein endothelial cells. The Cys-Cys chemokine ligand 3 and 8 mRNAs were not detected in human umbilical vein endothelial cells. Induction of Cys-X-Cys chemokine ligand 1, 3, 5, 6 and 8 mRNAs was detected in the lymphatic endothelial cells with lipopolysaccharides. The Cys-X-Cys chemokine ligand 3, 5 and 8 mRNA amounts in cells with high concentration lipopolysaccharides were larger in the lymphatic endothelial cells than in human umbilical vein endothelial cells. In conclusion, it was demonstrated that the cultured human lymphatic endothelial cells express E-selectin and phagocyte-attractive chemokine genes.

Keywords: CCL, CXCL, E-selectin, lymphatic endothelium

Introduction

We have previously reported that human lymphatic endothelium expresses not only platelet–endothelial adhesion molecule-1 (PECAM-1) but also the intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) in the human small intestine and tongue, and that lymphatic endothelium increases the expression of VCAM-1 and ICAM-1 with TNF-α (Sawa et al. 1999, 2007). It has been established that the induction of VCAM-1 and ICAM-1 needs a signaling pathway that involves activation of transcription factors nuclear factor-kappaB (NF-κB) and activator protein 1 (AP-1) in the blood endothelium (Ahmad et al. 1998; Ishizuka et al. 1998; Oertli et al. 1998; Kobuchi et al. 1999; Lawson et al. 1999; Roebuck 1999). It is thought that lymphatic endothelium also has the NF-κB and AP-1 signal transduction pathways to induce leukocyte adhesion molecule expressions through receptors for inflammatory cytokines.

The toll-like receptor (TLR) initiates innate immune mechanisms against microorganism infections by sensing pathogen-associated molecular patterns like lipopolysaccharides (LPS). The LPS stimulate leukocyte and blood endothelium through LPS recognition systems with TLR4 signal transductions, resulting in the production of downstream chemokines and leukocyte adhesion molecules by the activation of NF-κB- and AP-1-dependent transcriptional pathways (Aderem & Ulevitch, 2000; Faure et al. 2000; Ozinsky et al. 2000; Hijiya et al. 2002; Kaisho & Akira, 2002; Lien & Ingalls, 2002; Dauphinee & Karsan, 2006; Uematsu & Akira; 2006). We have recently demonstrated that the cultured human lymphatic endothelium increases the expression of interleukin (IL)-6, IL-8, VCAM-1, and ICAM-1 by the recognition of LPS through TLR4 (Sawa et al. 2008). The study here was designed to investigate the LPS-induced selectin and chemokine expression in the cultured human lymphatic endothelium.

Materials and methods

Cell culture

Podoplanin is a novel marker for the lymphatic endothelium. The production of podoplanin is regulated by the lymphatic-specific homeobox gene Prox1, which is a lymphatic endothelial cell proliferation inducer. Podoplanin and Prox1 are critical molecules for lymphovasculogenesis because podoplanin−/– or Prox1−/– mice have defects in lymphatic, but not in blood vessel pattern formation (Wigle & Oliver, 1999; Schacht et al. 2003). In this study we used the human neonatal dermal lymphatic endothelial cells (LEC) (AngioBio Co., Del Mar, CA) which had been confirmed for the expression of lymphatic endothelial marker podoplanin and Prox1 (Sawa et al. 2007,2008). The LEC and human umbilical vein endothelial cells (VEC) (CC-2505; Cambrex Bio Science Walkersville, Inc., Walkersville, MD) were cultured in endothelial cell medium kit, EGM-2-MV Bulletkit (Cambrex) at 37 °C in an atmosphere containing 5% CO2.

Microarray analysis

The 100% confluent LEC monolayers in 100-mm culture dishes (1 × 107 cells) were cultured in a 10-mL volume of 5% serum medium with 0, 102, and 104 ng mL−1 Escherichia coli 0111:B4-LPS (InvivoGen) for 0.5, 12, and 24 h, and the gene expression changes of E-, L-, and P-selectin, and of Cys-Cys chemokine ligand (CCL), and Cys-X-Cys chemokine ligand (CXCL) were tested by microarray analysis. Total RNA was prepared using the Qiagen RNeasy protocol and reagents (Qiagen, Inc., Tokyo, Japan), and submitted to the GeneChip Mapping Array in Dragon Genomics Center (Takara Bio Inc., Yokkaichi, Japan). The image analysis was carried out according to standard Affymetrix protocols (Affymetrix, Santa Clara, CA). The 54 675 probe sets of Human Genome U133 Plus 2.0 Array (Affymetrix) were used for all hybridizations. Data were analysed with genechip Operating Software ver. 1.4 including the GeneChip Scanner 3000 7G (Affymetrix; probe pair threshold = 8, control = antisense). Genes with a detection P-value < 0.04 determined by the statistical program were considered to be present call, those with 0.04 < P < 0.06 were considered to be marginal call, and those with P > 0.06 were considered to be absent call. The genes were considered to be significant when expression changed at least two-fold and the changed gene expression included at least one ‘present absolute call’.

Immunostaining

The effect of LPS on the expression of E-selectin in lymphatic vessels was tested with an in vivo model, using 8-week-old wild-type mice (C57BL6/J) purchased from the Jackson Laboratory (Bar Harbor, ME). A 10-µL volume of 100 ng mL−1 LPS diluted in the saline or 10 µL saline was injected into the buccal mucosa, frozen 10-µm sections were cut in a cryostat after 24 h, and the sections were fixed in 30% acetone-phosphate-buffered saline (PBS) for 10 min at 4 °C. The sections were treated with a cocktail of antibodies: 0.5 µg mL−1 of rat anti-mouse E-selectin (R&D Systems Inc., Minneapolis, MN) and 0.5 µg mL−1 of hamster anti-mouse podoplanin (AngioBio) for 8 h at 4 °C. After reacting with the first antibodies, the sections were exposed to a cocktail of antibodies: 0.1 µg mL−1 of Alexa Fluor 568-conjugated goat anti-rat IgG and Alexa Fluor 488-conjugated goat anti-hamster IgG (Invitrogen) for 1 h at 20 °C, and examined by laser-scanning confocal microscopy (Axiovert 135 M, Carl Zeiss, Jena, Germany) with a ×40 oil planapochromatic objective lens (numerical aperture × 1.3).

A 100% confluent LEC monolayer (5 × 105 cells well−1) in a 6-well plate was cultured in a 2-mL volume of 5% serum medium with the human recombinant 100 ng mL−1 LPS (InvivoGen) for 24 h and tested on the expression of E-selectin by immunostaining. Confluent monolayers on poly-l-lysine (Sigma diagnostics Inc., St. Louis, MO) coated coverslips in a 6-well plate were air-dried, fixed in 30% acetone-10 mm PBS (pH 7.2), and treated with 1 µg mL−1 of rhodamine-conjugated concanavalin A (Con A; Invitrogen, Eugene, OR) diluted in PBS to visualize the cell membrane. The cells were immunostained with 1 µg mL−1 of a monoclonal antibody to human E-selectin (R&D Systems). Cells were further treated with an Alexa Fluor 488-conjugated goat anti-mouse IgG (Invitrogen), and examined by laser-scanning microscopy as described above.

The LPS concentration was determined based on the results of the gene expression in the microarray, and real-time polymerase chain reaction (PCR) analysis, which indicate that the LPS-induced gene expression occurred in LEC with 100 ng mL−1 LPS at least.

Reverse transcription (RT)-PCR and real-time PCR

The 100% confluent LEC and VEC monolayers (5 × 105 cells well−1) in 6-well plates were cultured in a 2-mL volume of 5% serum medium with 0–10 µg mL−1 LPS (InvivoGen) for 12 h, and were analysed on the E-selectin and chemokine gene expression. The total RNA extraction was achieved with a QIAshredder column and RNeasy kit (Qiagen). Contaminating genomic DNA was removed using DNAfree (Ambion, Huntingdon, UK), and the RT was performed on 30 ng of total RNA, followed by 25–30 cycles of PCR for amplification with 50 pm of primer sets using the Ex Taq hot start version (Takara Bio Inc., Otsu, Japan). We used primer sets of β-actin, E-selectin, CCL, and CXCL, where the specificities had been confirmed by the manufacturer (Sigma-Genosys Ltd, Cambridge, UK) (Table 1). The PCR products were separated on 2% agarose gel (NuSieve; FMC, Rockland, ME) and visualized using Syber Green (Takara). The correct size of the amplified PCR products was confirmed by gel electrophoresis and amplification of accurate targets was confirmed by sequence analysis.

Table 1.

Sequence of primers

Protein bp upper (5′−3′) lower (5′−3′)
CCL2 241 CCGAGAGGCTGAGACTAAC CTTGCTGCTGGTGATTCTTC
CCL3 428 GAGCCCACATTCCGTCAC AACAACCAGTCCATAGAAGAGG
CCL5 207 CCTCGCTGTCATCCTCATTG GGGTTGGCACACACTTGG
CCL7 228 AGAAGGACCACCAGTAGCC AGAACCACTCTGAGAAAGGAC
CCL8 246 CGAGGAGCAGAGAGGTTGAG GATGTTGGTGATTCTTGTGTAGC
CCL20 218 TTTGCTCCTGGCTGCTTTGATGT GTTTTGGATTTGCGCACACAGAC
CXCL1 294 CTGCGAGTGGCACTGCTG CCTCCTCCCTTCTGGTCAGG
CXCL3 203 ATCCAAAGTGTGAATGTAAGGTC GCAGGAAGTGTCAATGATACG
CXCL5 274 CCGCTGCTGTGTTGAGAG TCTGCTGAAGACTGGGAAAC
CXCL6 234 GCTGAGAGTAAACCCCAAAAC AACTGCTCCGCTGAAGAC
CXCL8 229 TCTGCAGCTCTGTGTGAAGG ACTTCTCCACAACCCTCTGC
E-selectin 244 GGCAGTGGACACAGCAAATC TGGACAGCATCGCATCTCA
β-actin 489 ATGTTTGAGACCTTCAACAC CACGTCACACTTCATGATGG
Open in a new tab

To quantify E-selectin and chemokine mRNA generation, cDNA samples were analysed by real-time quantitative PCR. A total of 1 mL of cDNA was amplified in 25 µL using PowerSYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) in a 7500 Real-time PCR System (Applied Biosystems), and fluorescence was monitored at each cycle. Cycle parameters were 95 °C for 15 min to activate Taq, followed by 40 cycles of 95 °C for 15 s, 58 °C for 1 min, and 72 °C for 1 min. For real-time analysis, a standard curve was constructed from amplicons for β-actin in three serial four-fold dilutions of cDNA stock from LEC untreated with LPS. The β-actin cDNA levels in each sample were quantified against a standard curve by allowing the software to determine the sample β-actin units accurately. The adhesion molecule cDNA levels in each sample were quantified against a standard curve as the sample adhesion molecule units and were normalized to the sample β-actin units. Thus, relative adhesion molecule production units were expressed as arbitrary units, calculated according to the following formula: relative adhesion molecule production units = sample adhesion molecule units/sample β-actin units.

Enzyme-linked immunosorbent assay (ELISA) for E-selectin production

The 100% confluent monolayers (5 × 105 cells/well) in 6-well plate were cultured in a 2-mL volume of 5% serum medium with 0–10 µg mL−1 LPS (InvivoGen) for 12, 24, and 48 h, and were analysed on the E-selectin expression on the cell membrane. The cells were incubated with 100 ng mL−1 of a mouse monoclonal antibody for human E-selectin (R&D Systems) for 1 h, and exposed to 10 ng mL−1 of a peroxidase-conjugated goat anti-mouse IgG (Amersham Biosciences, Buckinghamshire, UK) for 30 min. All procedures were performed under the culture condition. After the treatment, cells were incubated with 2 mL of peroxidase substrate (KPL) in 6-well plates at 37 °C. The 0.1-mL aliquots from reaction products were transferred into a 96-well plate after 5 and 15 min, and absorbance changes at 405 nm were measured by a microplate reader. Cells treated with only a second antibody served as blanks. The E-selectin amount expressed on the cell membrane was estimated by the binding activity of anti-E-selectin to living cells in the wells under the culture condition, expressed as the mean absorbance of peroxidase metabolizing substrate of five wells.

Statistics

All experiments were carried out five times repeatedly and data are expressed as mean + se. The statistical significance of differences (P < 0.001) was determined by the unpaired two-tailed Student's t-test with statview 4.51 software (Abacus concepts, Calabasas, CA).

Results

Microarray analysis on the leukocyte adhesion molecule and chemokine genes

The LEC expressed VCAM-1, ICAM-1, ICAM-2, ICAM-3, PECAM-1, and E-selectin but no L- and P-selectin genes. The gene expression of ICAM-2, ICAM-3, and PECAM-1 did not change with 100 ng mL−1 LPS at 0.5, 12, and 24 h, or with 10 µg mL−1 LPS at 24 h. The gene expression of VCAM-1, and ICAM-1 did not change at 0.5 h but increased two- to three-fold with 100 ng mL−1 LPS at 12 and 24 h, and increased 11- and 18-fold with 10 µg mL−1 LPS at 24 h compared with untreated cells (Table 2). The gene expression of E-selectin increased 10-fold at 0.5 h, 68-fold at 12 h, and 26-fold at 24 h with 100 ng mL−1 LPS, and increased 337-fold with 10 µg mL−1 LPS at 24 h compared with untreated cells (Table 2).

Table 2.

Expression of leukocyte adhesion molecule and C-C motif chemokine genes in LEC with LPS. Genes with a detection P ≤ 0.04 were considered to be present (P), those with 0.04 < P < 0.06 were considered to be marginal (M), and those with P ≥ 0.06 were considered to be absent (A) when compared with 8 antisense control probe pairs. The genes were considered to be significantly increased when expression changed at least 2-fold and the changed gene expression included at least one ‘present absolute call’, expressed as the relative (-fold) change (mean of 8 probe pairs). NS, not significant compared with control

Gene name Absolute call for control Mean 100 ng mL−1 LPS vs. control at 0.5 h Mean 100 ng mL−1 LPSvs. control at 12 h Mean 100 ng mL−1 LPS vs. control at 24 h Mean 10 000 ng mL−1 LPS vs. control at 24 h
Leukocyte adhesion molecules
VCAM-1 P NS 3.03 2.64 18.38
ICAM-1 P NS 2.83 2.64 11.31
E-selectin P 10.56 68.59 25.99 337.79
L-selectin A A A A A
P-selectin A A A A A
C-C motif chemokine ligands
CCL1 A A A A A
CCL2 P NS NS NS 3.25
CCL3 A A A A P
CCL4 A A A A A
CCL5 P NS 2.64 2.3 12.13
CCL7 A A P A P
CCL8 P A 2 A 137.19
Open in a new tab

In the C-C motif chemokines, the gene expression of CCL2, CCL3, CCL5, CCL7, CCL8, CCL20, and CCL28 significantly increased with LPS at 12 or 24 h (Table 2). The gene expression of CCL5, CCL8, and CCL20 significantly increased 12-, 137-, and 27-fold with 10 µg mL−1 LPS at 24 h compared with untreated cells.

In the C-X-C motif chemokines, the gene expression of CXCL1, CXCL5, CXCL6, CXCL8, and CXCL11 significantly increased 10-, 22-, 22-, 14-, and 5-fold with 100 ng mL−1 LPS at 12 h, and 34-, 147-, 256-, 17-, and 9-fold with 10 µg mL−1 LPS at 24 h compared with untreated cells (Table 3). The gene expression of CXCL3, and CXCL10 was induced with 100 ng mL−1 LPS at 12 or 24 h.

Table 3.

Expression of C-X-C motif chemokine genes in LEC with LPS. Genes with a detection P ≤ 0.04 were considered to be present (P), and those with P ≥ 0.06 were considered to be absent (A) when compared with eight antisense control probe pairs. The genes were considered to be significantly increased when expression changed at least two-fold and the changed gene expression included at least one ‘present absolute call’, expressed as the relative (-fold) change (mean of eight probe pairs). NS, not significant compared with control

Gene name Absolute call for control Mean 100 ng mL−1 LPS vs. control at 0.5 h Mean 100 ng mL−1 LPS vs. control at 12 h Mean 100 ng mL−1 LPSvs. control at 24 h Mean 10 000 ng mL−1 LPS vs. control at 24 h
C-X-C motif chemokine ligands
CXCL1 P NS 10.56 6.06 34.30
CXCL2 A A A A A
CXCL3 A A P P P
CXCL4 A A A A A
CXCL5 P NS 22.63 6.06 147.03
CXCL6 P A 22.63 17.15 256.00
CXCL7 A A A A A
CXCL8 P NS 14.93 4.00 17.15
Open in a new tab

Immunohistochemical investigation on the expression of E-selectin

The effect of LPS on the expression of E-selectin was tested with an in vivo model of mouse. In the mouse buccal mucosa tissue injected with saline, E-selectin was not expressed at a detectable level in either lymphatic or blood vessels. In the tissue injected with LPS, there were lymphatic and blood vessels expressing E-selectin (Fig. 1A). In the cultured cells, the E-selectin expression was not observed in monolayers of LEC nor VEC but there were cells strongly expressing E-selectin in both LEC and VEC cultures with LPS (Fig. 1B).

Fig. 1.

Fig. 1

Open in a new tab

Immunohistochemical analysis of the expression of E-selectin in lymphatic endothelium with LPS. (A) In vivo analysis using mouse buccal mucosa. The reaction products with anti-mouse podoplanin and anti-mouse E-selectin are visualized in green, and in red in the adjacent section of hematoxylin and eosin staining (H–E). The merged images demonstrate that the reaction products with anti-mouse podoplanin are only visualized on lymphatic vessels (arrows), and that the expression of E-selectin is observed in neither lymphatic vessels nor blood vessels (arrowheads) of the buccal mucosa tissue with PBS injection but are observed in both lymphatic and blood vessels with 100 ng mL−1 LPS. (B) In vitro analysis using cultured human lymphatic endothelium (LEC) and blood endothelium (VEC). Cell membrane and cytoplasm are visualized with rhodamine-conjugated Con A (Con A) in red, and the reaction products with anti-human E-selectin are visualized in green. Merged images indicate that the expression of E-selectin is usually observed in neither cultured lymphatic nor blood endothelium but is observed in the cells with 100 ng mL−1 LPS. Bar, 100 µm.

Analysis for E-selectin gene and protein production

In the RT-PCR analysis E-selectin mRNA was not detected in LEC and VEC but it was detected in the cells cultured with 100 ng mL−1 LPS for 12 h, and increased in a dose-dependent manner (Fig. 2A). Real-time quantitative PCR analysis showed that the amounts of E-selectin mRNA increased in a dose-dependent manner in LEC, as well as VEC, with LPS for 12 h (Fig. 2B). The LEC with 102–104 ng mL−1 LPS showed two- to four-fold increases of E-selectin mRNA compared with VEC.

Fig. 2.

Fig. 2

Open in a new tab

Gene analysis for E-selectin production in cultured human lymphatic endothelium with LPS. (A) RT-PCR analysis. RT-PCR products for E-selectin mRNA were not detected in LEC and VEC but were detected in the cells cultured with 100 ng mL−1 LPS for 12 h, and increased in a dose-dependent manner. MW, molecular weight marker. (B) Real-time quantitative PCR analysis. Values for LEC and VEC are expressed as solid lines and dotted lines, respectively. The amounts of E-selectin mRNA were statistically significantly larger in LEC, as well as VEC, treated with LPS (102, 103, 104 ng mL−1) than in cells treated with 0 and 10 ng mL−1 LPS (n = 5, P < 0.0001). E-selectin mRNA increased in a dose-dependent manner in LEC and VEC cultured with LPS for 12 h. LEC with 102 ng mL−1 and 104 ng mL−1 LPS showed 2.57-fold (0.21 vs. 0.54) and 2.88-fold (1.02 vs. 2.94) increases of E-selectin mRNA compared with VEC.

The expression of E-selectin protein on the cell membrane was not detected in either LEC or VEC without LPS, but it was found in the cells with 100 ng mL−1 LPS and it increased in a dose-dependent manner (Fig. 3A). The amount of E-selectin in LEC with 100 ng mL−1 LPS was more than two-fold compared with VEC. The amount of E-selectin was larger in LEC, as well as VEC, with 100 ng mL−1 LPS for 12 h than in the untreated cells (Fig. 3B). Increase in E-selectin reached a plateau within 48 h in both LEC and VEC.

Fig. 3.

Fig. 3

Open in a new tab

Relationships of LPS concentration and reaction time for E-selectin expression. Values for LEC and VEC are expressed as solid lines and dotted lines, respectively. (A) LPS concentration and E-selectin amounts on the cell membrane. E-selectin was not detected in either LEC or VEC cultured with 0 or 10 ng mL−1 LPS for 24 h, but was detected in the cells with 100 ng mL−1 LPS and increased in a dose-dependent manner. The amounts of E-selectin were statistically significantly larger in LEC, as well as VEC, with LPS (102, 103, 104 ng mL−1) than in cells with 0 and 10 ng mL−1 LPS (n = 5, P < 0.0001). LEC with 102 ng mL−1 and 104 ng mL−1 LPS showed 2.6-fold (0.3 vs. 0.78) and 2.15-fold (0.8 vs. 1.72) increases of E-selectin compared with VEC. (B) Reaction time and E-selectin amounts on the cell membrane. Expression change on the cell membrane. The amounts of E-selectin were statistically significantly larger in LEC, as well as VEC, treated with 102 ng mL−1 LPS for 12, 24, and 48 h than in the untreated cells (n = 5, P < 0.0001). The increase in the amount of E-selectin reached a plateau within 24–48 h in both LEC and VEC.

Analysis for CCL mRNA production

In the RT-PCR analysis, CCL2, CCL5, CCL7, and CCL20 mRNAs were detected in both LEC and VEC with LPS, whereas in cells with 104 ng mL−1 LPS, CCL3, and CCL8 mRNAs were detected in LEC but not in VEC (Fig. 4A). The real-time PCR analysis showed that gene expression amounts of CCL2, CCL5, CCL7, CCL8, and CCL20 drastically increased with LPS in LEC (Fig. 5A). In cells with 103 and 104 ng mL−1 LPS, the mRNA amounts in LEC were large in the order CCL2, CCL20, CCL5, whereas CCL3, CCL7, and CCL8 genes were expressed to a lesser extent than CCL5. The mRNA amounts of CCL2, CCL5, and CCL20 were statistically significantly larger in LEC than in VEC. The CCL3, and CCL8 mRNAs were detected in LEC but not in VEC.

Fig. 4.

Fig. 4

Open in a new tab

RT-PCR for chemokine mRNAs in cultured human lymphatic endothelium with LPS. (A) C-C motif chemokine ligands. The level of RT-PCR products for CCL2, CCL5, CCL7, and CCL20 mRNAs increased with 102–104 ng mL−1 LPS in both LEC and VEC. RT-PCR products for CCL3, and CCL8 mRNAs were detected in LEC with 104 ng mL−1 LPS but not in VEC. (B) C-X-C motif chemokine ligands. RT-PCR products for CXCL1, CXCL3, CXCL5, CXCL6, and CXCL8 mRNAs increased with 102–104 ng mL−1 LPS. MW, molecular weight marker (arrowheads, 267 bp; arrows, 489 bp).

Fig. 5.

Fig. 5

Open in a new tab

Real-time quantitative PCR analysis for chemokine production in cultured human lymphatic endothelium with LPS. Values for LEC and VEC are expressed as solid lines and dotted lines, respectively. (A) C-C motif chemokine ligands. CCL2, CCL5, CCL7, CCL8, and CCL20 gene expression drastically increased in LEC with 103 and 104 ng mL−1 LPS. CCL3 gene expression was detected in LEC with 104 ng mL−1 LPS. The gene expression of CCL3, and CCL8 was not detected in VEC. In cells with 103 and 104 ng mL−1 LPS, the gene expression in LEC was strong in the order CCL2, CCL20, CCL5, whereas CCL3, CCL7, and CCL8 genes were expressed to a lesser extent than CCL5. The amounts of CCL2, CCL5, and CCL20 mRNA were statistically significantly larger in LEC than in VEC (n = 5, P < 0.0001). (B) C-X-C motif chemokine ligands. CXCL1, CXCL3, CXCL5, CXCL6, and CXCL8 gene expression drastically increased in both LEC and VEC with 103 and 104 ng mL−1 LPS. In cells with 103 and 104 ng mL−1 LPS, the gene expression in LEC was strong in the order CXCL8, CXCL5, CXCL6, CXCL3, and CXCL1. The mRNA amount of CXCL1 was significantly smaller in LEC than in VEC, whereas the mRNA amounts of CXCL3, CXCL5, and CXCL8 were statistically significantly larger in LEC than in VEC (n = 5, P < 0.0001).

Analysis for CXCL mRNA production

In the RT-PCR analysis, CXCL1, CXCL3, CXCL5, CXCL6, and CXCL8 mRNAs were detected in both LEC and VEC (Fig. 4B). The real-time PCR analysis showed that gene expression amounts of these chemokines drastically increased in both LEC and VEC with LPS (Fig. 5B). In cells with 103 and 104 ng mL−1 LPS, the mRNA amounts in LEC were large in the order CXCL8, CXCL5, CXCL6, CXCL3, and CXCL1. The amount of CXCL1 mRNA was significantly smaller in LEC than in VEC, whereas the amounts of CXCL3, CXCL5, and CXCL8 mRNA were statistically significantly larger in LEC than in VEC.

Discussion

E-selectin expression in the human lymphatic endothelium

The E-selectin-carbohydrate interactions mediate the attachment or tethering of flowing leukocytes to the vessel wall through labile binding to sialylated carbohydrates on the endothelium that permit leukocytes, importantly neutrophils and monocytes, to roll in the direction of flow. The E-selectin is induced on activated blood endothelium by not only cytokines such as IL-1 and also LPS, which is the major component of the outer surface of Gram-negative bacteria (Rosen & Bertozzi, 1994; Varki, 1994; Hiraoka et al. 1999; Evans et al. 2001; Galustian et al. 2002; Ridger et al. 2005).

Microarray analysis showed the gene expression of E-selectin, VCAM-1, and ICAM-1 increased in LEC with LPS. The gene expression of E-selectin occurred much earlier and to a greater extent than VCAM-1 and ICAM-1 (Table 2). It was immunohistochemically observed that lymphatic endothelium with LPS expressed E-selectin as well as blood endothelium in vivo and in vitro (Fig. 1). The E-selectin mRNA amount increased in a dose-dependent manner in LEC, as well as VEC, with LPS (Fig. 2). The E-selectin protein on the cell membrane was not detected in either LEC or VEC without LPS, but it was detected in the cells with LPS in a dose-dependent manner (Fig. 3). The E-selectin induction with LPS occurred to a greater extent than VEC at both gene and protein levels. These findings suggest that the E-selectin induction with LPS is a common property of both human lymphatic and blood endothelium. It is thought that the lymphatic endothelium has the LPS recognition system, which induces E-selectin expression earlier than the expression of VCAM-1 and ICAM-1. The lymphatic endothelium may have the LPS-induced E-selectin expression ability higher than the blood endothelium.

The CCL gene expression in the human lymphatic endothelium

This study showed that the genes of CCL2, CCL3, CCL5, CCL7, CCL8, and CCL20, which are chemokines specific for monocytes and the immature dendritic cells (DCs), drastically increased in LEC with LPS (Table 2, Figs 4A, 5A). It has been established that monocytes express CC-chemokine receptors (CCR)1, CCR2 and CCR5. The CCR1 binds CCL3, CCL5, CCL7, and CCL8, whereas CCR2 binds monocyte chemotactic proteins (MCP)-1 (CCL2), MCP-2 (CCL8), MCP-3 (CCL7), and MCP-4 (CCL13). The CCR5 binds macrophage inflammatory protein (MIP)-1α (CCL3), MIP-1β (CCL4), and regulated upon activation, normally T-expressed, and presumably secreted (RANTES, CCL5) (Combadiere et al. 1996; Gong et al. 1997; Polentarutti et al. 1997; Govaerts et al. 2001; Corbin et al. 2006; Crown et al. 2006; O’Boyle et al. 2007). It has also been established that the immature DCs express CCR1, which binds CCL3, CCL5, CCL7, and CCL8, and express CCR6, which is the only receptor of the macrophage inflammatory protein (MIP)-3α (CCL20). The CCR6 expression decreases progressively as DCs mature, whereas the expression of CCR7, which is the receptor of MIP-3β (CCL19) and CCL21, is upregulated upon maturation of DCs (Liao et al. 1999; Schutyser et al. 2000; Page et al. 2002). In this study it was suggested that human lymphatic endothelium with LPS stimulation expresses at least five of seven genes in the monocyte-attractive CCLs, and expresses all genes of immature DC-attractive CCLs. The LPS-stimulated LEC significantly increased the expression of genes of CCL2, CCL20, and CCL5 to a higher extent than the other CCLs specific for monocytes and immature DCs (Table 2, Figs 4A, 5A). It has been reported that MCPs are most effective for monocyte chemotaxis and CCL2 induces the highest chemotactic effect. The chemotaxis induction of CCR5 ligands is high in the order CCL5, CCL3, and CCL4 (Uguccioni et al. 1995). This may suggest that the lymphatic endothelium has the ability to allow monocytes and immature DCs to migrate around the vessels collected LPS. On the other hand, the gene expression of CCL3 and CCL8 was not detected in VEC with LPS, and the gene expression of CCL2, CCL5, and CCL20 was statistically significantly larger in LEC than in VEC with LPS at high concentrations (Figs 4A, 5A). It may be suggested that the ability to allow monocytes and immature DCs to migrate around vessels is higher in the lymphatic endothelium than in the blood endothelium.

The CXCL gene expression in the human lymphatic endothelium

The neutrophil recruitment is mediated by CXC chemokine receptors (CXCR) 1 and CXCR2. The IL-8 family chemokines, of which IL-8 is the prototype and termed as CXCL8, conserve the Glu-Leu-Arg motif and include the growth-related oncogene (GRO)-α (CXCL1), GRO-β (CXCL2), GRO-γ, (CXCL3), epithelial cell-derived neutrophil-activating peptide-78 (ENA-78, CXCL5), and granulocyte chemotactic protein 2 (GCP-2, CXCL6). The CXCR1 and CXCR2 share CXCL6 and CXCL8, whereas CXCL1, CXCL2, CXCL3, and CXCL5 are specific for CXCR2 (Jones et al. 1997; Van Damme et al. 1997; White et al. 1998; Wolf et al. 1998; Wuyts et al. 1998; Doroshenko et al. 2002; Rajagopalan & Rajarathnam, 2004).

This study showed that the genes of CXCL1, CXCL3, CXCL5, CXCL6, and CXCL8 drastically increased in LEC with LPS (Table 2, Figs 4B, 5B). The gene expression amount of CXCL1 was smaller in LEC than in VEC, whereas the amounts of CXCL3, CXCL5, and CXCL8 were statistically significantly larger in LEC than in VEC with LPS at high concentrations. It was suggested that human lymphatic endothelium with LPS expresses all neutrophil-attractive chemokine genes except for CXCL2. It may be suggested that the ability to allow neutrophils to migrate around vessels is higher in the lymphatic endothelium than in the blood endothelium.

In conclusion, it was demonstrated that the cultured human lymphatic endothelium expresses E-selectin and phagocyte-attractive chemokine genes. The lymphatic vessels may behave as an active vasculature collecting phagocytes at the severely infected tissue.

References

  1. Aderem A, Ulevitch RJ. Toll-like receptors in the induction of the innate immune response. Nature. 2000;406:782–787. doi: 10.1038/35021228. [DOI] [PubMed] [Google Scholar]
  2. Ahmad M, Theofanidis P, Medford RM. Role of activating protein-1 in the regulation of the vascular cell adhesion molecule-1 gene expression by tumor necrosis factor-alpha. J Biol Chem. 1998;273:4616–4621. doi: 10.1074/jbc.273.8.4616. [DOI] [PubMed] [Google Scholar]
  3. Combadiere C, Ahuja SK, Tiffany HL, Murphy PM. Cloning and functional expression of CC CKR5, a human monocyte CC chemokine receptor selective for MIP-1(alpha), MIP-1(beta), and RANTES. J Leukoc Biol. 1996;60:147–152. doi: 10.1002/jlb.60.1.147. [DOI] [PubMed] [Google Scholar]
  4. Corbin ME, Pourciau S, Morgan TW, Boudreaux M, Peterson KE. Ligand up-regulation does not correlate with a role for CCR1 in pathogenesis in a mouse model of non-lymphocyte-mediated neurological disease. J Neurovirol. 2006;12:241–250. doi: 10.1080/13550280600851393. [DOI] [PubMed] [Google Scholar]
  5. Crown SE, Yu Y, Sweeney MD, Leary JA, Handel TM. Heterodimerization of CCR2 chemokines and regulation by glycosaminoglycan binding. J Biol Chem. 2006;281:25438–25446. doi: 10.1074/jbc.M601518200. [DOI] [PubMed] [Google Scholar]
  6. Dauphinee SM, Karsan A. Lipopolysaccharide signaling in endothelial cells. Lab Invest. 2006;86:9–22. doi: 10.1038/labinvest.3700366. Review. [DOI] [PubMed] [Google Scholar]
  7. Doroshenko T, Chaly Y, Savitskiy V, et al. Phagocytosing neutrophils down-regulate the expression of chemokine receptors CXCR1 and CXCR2. Blood. 2002;100:2668–2671. doi: 10.1182/blood.100.7.2668. [DOI] [PubMed] [Google Scholar]
  8. Evans E, Leung A, Hammer D, Simon S. Chemically distinct transition states govern rapid dissociation of single L-selectin bonds under force. Proc Natl Acad Sci USA. 2001;98:3784–3789. doi: 10.1073/pnas.061324998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Faure E, Equils O, Sieling PA, et al. Bacterial lipopolysaccharide activates NF-kappaB through toll-like receptor 4 (TLR-4) in cultured human dermal endothelial cells. J Biol Chem. 2000;275:11058–11063. doi: 10.1074/jbc.275.15.11058. [DOI] [PubMed] [Google Scholar]
  10. Galustian C, Childs RA, Stoll M, Ishida H, Kiso M, Feizi T. Synergistic interactions of the two classes of ligand, sialyl-Lewis(a/x) fuco-oligosaccharides and short sulpho-motifs, with the P- and L-selectins: implications for therapeutic inhibitor designs. Immunology. 2002;105:350–359. doi: 10.1046/j.1365-2567.2002.01369.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gong X, Gong W, Kuhns DB, Ben-Baruch A, Howard OM, Wang JM. Monocyte chemotactic protein-2 (MCP-2) uses CCR1 and CCR2B as its functional receptors. J Biol Chem. 1997;272:11682–11685. doi: 10.1074/jbc.272.18.11682. [DOI] [PubMed] [Google Scholar]
  12. Govaerts C, Blanpain C, Deupi X, et al. The TXP motif in the second transmembrane helix of CCR5. A structural determinant of chemokine-inducedactivation. J Biol Chem. 2001;276:13217–13225. doi: 10.1074/jbc.M011670200. [DOI] [PubMed] [Google Scholar]
  13. Hijiya N, Miyake K, Akashi S, Matsuura K, Higuchi Y, Yamamoto S. Possible involvement of toll-like receptor 4 in endothelial cell activation of larger vessels in response to lipopolysaccharide. Pathobiology. 2002;70:18–25. doi: 10.1159/000066000. [DOI] [PubMed] [Google Scholar]
  14. Hiraoka N, Petryniak B, Nakayama J, et al. A novel, high endothelial venule-specific sulfotransferase expresses 6-sulfo sialyl Lewis(x), an L-selectin ligand displayed by CD34. Immunity. 1999;11:79–89. doi: 10.1016/s1074-7613(00)80083-7. [DOI] [PubMed] [Google Scholar]
  15. Ishizuka T, Kawakami M, Hidaka T, et al. Stimulation with thromboxane A2 (TXA2) receptor agonist enhances ICAM-1, VCAM-1 or ELAM-1 expression by human vascular endothelial cells. Clin Exp Immunol. 1998;112:464–470. doi: 10.1046/j.1365-2249.1998.00614.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jones SA, Dewald B, Clark-Lewis I, Baggiolini M. Chemokine antagonists that discriminate between interleukin-8 receptors. Selective blockers of CXCR2. J Biol Chem. 1997;272:16166–16169. doi: 10.1074/jbc.272.26.16166. [DOI] [PubMed] [Google Scholar]
  17. Kaisho T, Akira S. Toll-like receptors as adjuvant receptors. Biochim Biophys Acta. 2002;1589:1–13. doi: 10.1016/s0167-4889(01)00182-3. [DOI] [PubMed] [Google Scholar]
  18. Kobuchi H, Roy S, Sen CK, Nguyen HG, Packer L. Quercetin inhibits inducible ICAM-1 expression in human endothelial cells through the JNK pathway. Am J Physiol. 1999;277(3 Pt 1):C403–411. doi: 10.1152/ajpcell.1999.277.3.C403. [DOI] [PubMed] [Google Scholar]
  19. Lawson C, Ainsworth M, Yacoub M, Rose M. Ligation of ICAM-1 on endothelial cells leads to expression of VCAM-1 via a nuclear factor-kappaB-independent mechanism. J Immunol. 1999;162:2990–2996. [PubMed] [Google Scholar]
  20. Liao F, Rabin RL, Smith CS, Sharma G, Nutman TB, Farber JM. CC-chemokine receptor 6 is expressed on diverse memory subsets of T cells and determines responsiveness to macrophage inflammatory protein 3 alpha. J Immunol. 1999;162:186–194. [PubMed] [Google Scholar]
  21. Lien E, Ingalls RR. Toll-like receptors. Crit Care Med. 2002;30:S1–S11. [PubMed] [Google Scholar]
  22. O’Boyle G, Brain JG, Kirby JA, Ali S. Chemokine-mediated inflammation: Identification of a possible regulatory role for CCR2. Mol Immunol. 2007;44:1944–1953. doi: 10.1016/j.molimm.2006.09.033. [DOI] [PubMed] [Google Scholar]
  23. Oertli B, Beck-Schimmer B, Fan X, Wuthrich RP. Mechanisms of hyaluronan-induced up-regulation of ICAM-1 and VCAM-1 expression by murine kidney tubular epithelial cells: hyaluronan triggers cell adhesion molecule expression through a mechanism involving activation of nuclear factor-kappa B and activating protein-1. J Immunol. 1998;161:3431–3437. [PubMed] [Google Scholar]
  24. Ozinsky A, Underhill DM, Fontenot JD, et al. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between toll-like receptors. Proc Natl Acad Sci USA. 2000;97:13766–13771. doi: 10.1073/pnas.250476497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Page G, Lebecque S, Miossec P. Anatomic localization of immature and mature dendritic cells in an ectopic lymphoid organ: correlation with selective chemokine expression in rheumatoid synovium. J Immunol. 2002;168:5333–5341. doi: 10.4049/jimmunol.168.10.5333. [DOI] [PubMed] [Google Scholar]
  26. Polentarutti N, Introna M, Sozzani S, Mancinelli R, Mantovani G, Mantovani A. Expression of monocyte chemotactic protein-3 in human monocytes and endothelial cells. Eur Cytokine Netw. 1997;8:271–274. [PubMed] [Google Scholar]
  27. Rajagopalan L, Rajarathnam K. Ligand selectivity and affinity of chemokine receptor CXCR1. Role of N-terminal domain. J Biol Chem. 2004;279:30000–30008. doi: 10.1074/jbc.M313883200. [DOI] [PubMed] [Google Scholar]
  28. Ridger VC, Hellewell PG, Norman KE. L- and P-selectins collaborate to support leukocyte rolling in vivo when high-affinity P-selectin-P-selectin glycoprotein ligand-1 interaction is inhibited. Am J Pathol. 2005;166:945–952. doi: 10.1016/S0002-9440(10)62314-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Roebuck KA. Oxidant stress regulation of IL-8 and ICAM-1 gene expression: differential activation and binding of the transcription factors AP-1 and NF-kappaB. Int J Mol Med. 1999;4:223–230. doi: 10.3892/ijmm.4.3.223. Review. [DOI] [PubMed] [Google Scholar]
  30. Rosen SD, Bertozzi CR. The selectins and their ligands. Curr Opin Cell Biol. 1994;6:663–673. doi: 10.1016/0955-0674(94)90092-2. Review. [DOI] [PubMed] [Google Scholar]
  31. Sawa Y, Shibata K, Braithwaite MW, Suzuki M, Yoshida S. Expression of immunoglobulin superfamily members on the lymphatic endothelium of inflamed human small intestine. Microvasc Res. 1999;57:100–106. doi: 10.1006/mvre.1998.2132. [DOI] [PubMed] [Google Scholar]
  32. Sawa Y, Sugimoto Y, Ueki T, et al. Effects of TNF-alpha on leukocyte adhesion molecule expressions in cultured human lymphatic endothelium. J Histochem Cytochem. 2007;55:721–733. doi: 10.1369/jhc.6A7171.2007. [DOI] [PubMed] [Google Scholar]
  33. Sawa Y, Ueki T, Hata M, et al. LPS-induced IL-6, IL-8, VCAM-1, and ICAM-1 expression in human lymphatic endothelium. J Histochem Cytochem. 2008;56:97–109. doi: 10.1369/jhc.7A7299.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Schacht V, Ramirez MI, Hong YK, et al. T1alpha/podoplanin deficiency disrupts normal lymphatic vasculature formation and causes lymphedema. EMBO J. 2003;22:3546–3556. doi: 10.1093/emboj/cdg342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Schutyser E, Struyf S, Menten P, et al. Regulated production and molecular diversity of human liver and activation-regulated chemokine/macrophage inflammatory protein-3 alpha from normal and transformed cells. J Immunol. 2000;165:4470–4477. doi: 10.4049/jimmunol.165.8.4470. [DOI] [PubMed] [Google Scholar]
  36. Uematsu S, Akira S. Toll-like receptors and innate immunity. J Mol Med. 2006;84:712–725. doi: 10.1007/s00109-006-0084-y. Review. [DOI] [PubMed] [Google Scholar]
  37. Uguccioni M, D’Apuzzo M, Loetscher M, Dewald B, Baggiolini M. Actions of the chemotactic cytokines MCP-1, MCP-2, MCP-3, RANTES, MIP-1 alpha and MIP-1 beta on human monocytes. Eur J Immunol. 1995;25:64–68. doi: 10.1002/eji.1830250113. [DOI] [PubMed] [Google Scholar]
  38. Van Damme J, Wuyts A, Froyen G, et al. Granulocyte chemotactic protein-2 and related CXC chemokines: from gene regulation to receptor usage. J Leukoc Biol. 1997;62:563–569. doi: 10.1002/jlb.62.5.563. [DOI] [PubMed] [Google Scholar]
  39. Varki A. Selectin ligands. Proc Natl Acad Sci USA. 1994;91:7390–7397. doi: 10.1073/pnas.91.16.7390. Review. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. White JR, Lee JM, Young PR, et al. Identification of a potent, selective non-peptide CXCR2 antagonist that inhibits interleukin-8-induced neutrophil migration. J Biol Chem. 1998;273:10095–10098. doi: 10.1074/jbc.273.17.10095. [DOI] [PubMed] [Google Scholar]
  41. Wigle JT, Oliver G. Prox1 function is required for the development of the murine lymphatic system. Cell. 1999;98:769–778. doi: 10.1016/s0092-8674(00)81511-1. [DOI] [PubMed] [Google Scholar]
  42. Wolf M, Delgado MB, Jones SA, Dewald B, Clark-Lewis I, Baggiolini M. Granulocyte chemotactic protein 2 acts via both IL-8 receptors, CXCR1 and CXCR2. Eur J Immunol. 1998;28:164–170. doi: 10.1002/(SICI)1521-4141(199801)28:01<164::AID-IMMU164>3.0.CO;2-S. [DOI] [PubMed] [Google Scholar]
  43. Wuyts A, Proost P, Lenaerts JP, Ben-Baruch A, Van Damme J, Wang JM. Differential usage of the CXC chemokine receptors 1 and 2 by interleukin-8, granulocyte chemotactic protein-2 and epithelial-cell-derived neutrophil attractant-78. Eur J Biochem. 1998;255:67–73. doi: 10.1046/j.1432-1327.1998.2550067.x. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Anatomy are provided here courtesy of Anatomical Society of Great Britain and Ireland

RESOURCES