Abstract
The main goal of this work is to clarify the predictive value of known genetic markers of Neisseria gonorrhoeae resistance to penicillin, tetracycline, and fluoroquinolones. The correlation between the presence of certain genetic markers and susceptibility of N. gonorrhoeae isolates to penicillin, tetracycline, and fluoroquinolones has been analyzed by means of statistical methods. Susceptibility testing with penicillin, tetracycline, and fluoroquinolones was performed by the agar dilution method. N. gonorrhoeae genomic DNA was isolated. The presence of blaTEM-1 and tet(M) genes was analyzed by PCR. A novel method of polymorphism discovery based on a minisequencing reaction followed by matrix-assisted laser desorption ionization-time-of-flight mass spectrometry was applied for the analysis of chromosomal N. gonorrhoeae genes involved in antimicrobial resistance development. Clinical N. gonorrhoeae isolates (n = 464) were collected. Susceptibility levels to penicillin, tetracycline, and fluoroquinolones were found to be 25.9%, 35.9%, and 54.1%, respectively. Among the 19 N. gonorrhoeae isolates with penicillin MICs of ≥4 μg/ml, the blaTEM-1 gene was detected in 12. The Tet(M) determinant was found in 4 of 12 N. gonorrhoeae isolates with tetracycline MICs of ≥16 μg/ml. The chromosomal genetic markers of penicillin and tetracycline resistance were detected especially in isolates with penicillin MICs of 0.25 to 2.0 μg/ml and tetracycline MICs of 0.5 to 4 μg/ml. Mutations in GyrA and ParC were found in 208 of 211 quinolone-resistant N. gonorrhoeae isolates. This work is the first representative molecular research of the N. gonorrhoeae population in Russia. Information about the prevalence of antibiotic resistance mechanisms and the positive predictive value of certain genetic determinants is given. The positive predictive values of the analyzed genetic markers were found to be different for fluoroquinolones (90.3%), penicillin (91.1%), and tetracycline (81.9%).
Gonorrhea remains one of the major sexually transmitted diseases in Russia; in 2005, the disease rate was 90 cases per 100,000 people. Although the incidence of gonorrhea decreased slightly during recent years, the situation remains alarming due to the spread of multiresistant strains which are resistant to at least penicillin, tetracycline, and fluoroquinolones (31). However, replacement in routine practice of culture and susceptibility testing by nucleic acid amplification techniques reduces the amount of information on antimicrobial susceptibility patterns and highlights the need for the development of molecular tools for the detection of antibacterial resistance in Neisseria gonorrhoeae.
Beta-lactams, fluoroquinolones, and spectinomycin are recommended for the treatment of gonorrhea by national and international guidelines (17), and tetracyclines are also used in countries with limited resources. The genetic mechanisms of N. gonorrhoeae resistance to antibacterials are complicated and not definitely elucidated. However, acquisition of some genes and a number of mutations in structural genes and regulatory regions are considered to be involved unambiguously in resistance development.
Resistance to penicillin can be mediated by the production of TEM-1 beta-lactamase, encoded by the plasmid-borne blaTEM-1 gene, or by mutations in a number of chromosomal genes (2, 21, 22, 25). It has been proposed that resistance due to chromosomal mutations is a result of a complicated interplay between reduced affinities of modified penicillin-binding proteins (encoded by the penA and ponA genes) to penicillin, activation of the MtrC-MtrD-MtrE efflux pump (by mutation in the promoter region of the mtrR gene), and reduction in the permeation of the outer membrane porin PorB1b (encoded by porB1b) (i.e., by penB mutations) (4, 9, 10, 19, 23). It is likely that mutations in the pilQ gene, encoding a protein of the secretin family, are also involved in the development of resistance to penicillin (32).
Resistance to tetracycline is also mediated by different mechanisms, including high-level resistance due to acquisition of the tet(M) gene, encoding a ribosome-protecting protein (18), and low-level resistance due to a combination of target modification (mutation in the rpsJ gene, encoding ribosomal protein S10), derepressed efflux (mtrR gene), and reduced permeation (porB1b gene) (9, 10, 11, 19). Involvement of the last two mechanisms in the development of resistance to both penicillin and tetracyclines can explain the high frequency of associated resistance to these antibacterials in clinical isolates of chromosomally resistant N. gonorrhoeae.
Mechanisms of fluoroquinolone resistance in N. gonorrhoeae are not as complicated as those of resistance to beta-lactams and involve mutations in gyrA and parC genes (5, 28). Reduction of cell permeation and efflux activation can participate in the increase of fluoroquinolone MICs for N. gonorrhoeae, but the significance of these mechanisms is not obvious (6, 15).
The aims of this study were to reveal the correlation between the presence of known resistance determinants and the levels of susceptibility of clinical N. gonorrhoeae isolates to penicillin, tetracycline, and fluoroquinolones and to evaluate the usefulness of detection of these determinants for clinical resistance prediction.
Standard PCR combined with matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) mass spectrometry-based minisequencing or a sequencing procedure was used for the detection of single-nucleotide polymorphisms (SNPs) associated with antimicrobial resistance. This method is based on enzymatic extension of an oligonucleotide primer annealing close to a polymorphic site, using a deoxynucleoside triphosphate-dideoxynucleoside triphosphate (dNTP-ddNTP) mixture. The SNPs in the analyzed genes were detected by measurement of the molecular weights of reaction products. This technique is as accurate as direct sequencing for SNP identification but is far simpler and less expensive. Previously, this method was applied successfully for hepatitis C virus genotyping (13).
(Parts of this work were presented at the 46th Interscience Conference on Antimicrobial Agents and Chemotherapy, San Francisco, CA, 14 to 17 September 2006.)
MATERIALS AND METHODS
Bacterial isolates and susceptibility testing.
N. gonorrhoeae isolates from patients with uncomplicated gonorrhea were collected in the laboratories of clinics for sexually transmitted diseases in different regions of Russia during the period 2004-2005. Isolates were sent frozen on dry ice to the central laboratory (Central Research Institute of Dermatology and Venereology). In the central laboratory, isolates were retrieved from cryobeads on GC agar plates and subcultured once before susceptibility testing. Identification was confirmed using a crystal Haemophilus/Neisseria test (BBL). Susceptibility testing with penicillin G, tetracycline, and ciprofloxacin (all from Sigma) was performed by the agar dilution method, using GC agar (bioMerieux, France) supplemented with PolyViteX (bioMerieux, France). N. gonorrhoeae strain ATCC 49226 was used as a control. Current CLSI interpretive criteria were used to define antimicrobial resistance (3).
Genotypic characterization.
Total genomic DNAs from N. gonorrhoeae isolates were obtained according to the method of Boom et al. (1). If necessary, the prepared DNA samples were stored at a temperature of −20°C.
(i) Conventional PCR for detection of blaTEM-1 and tet(M) genes.
Genomic DNA was used as a template, and the oligonucleotide primers are described in Table 1. Amplification was carried out in a 10-μl reaction mixture containing 66 mM Tris-HCl, pH 9.0, 16.6 mM (NH4)2SO4, 2.5 mM MgCl2, a 0.2 mM concentration of each dNTP, 5 pmol of each primer, and 1 unit of Taq polymerase (Fermentas, Lithuania) under the following conditions: 94°C for 20 s, 60°C for 20 s, and 72°C for 15 s for 35 cycles. A programmed Tetrad DNA Engine thermocycler (MJ Research, Inc.) was used. The amplification products were analyzed by means of electrophoresis on a 2% agarose gel.
TABLE 1.
List of primers for N. gonorrhoeae gene fragment amplification
| Gene locus | Primer name | Sequence (5′-3′)b | Amplicon length (bp) | Reference |
|---|---|---|---|---|
| por (part I)a | M13F-Por01 | GTCACGACGTTGTAAAACGACGGCCAGTCTGACTTTGGCAGCCCTT | 500-600c | 30 |
| M13R-Por08 | CACACAGGAAACAGCTATGACCGTATTGTGCGAAGAAGC | 500-600c | 30 | |
| por (part II)a | M13F-Por11 | GTCACGACGTTGTAAAACGACGGCCAGTCTGTCCGTACGCTACG | 500-600c | 30 |
| M13R-Por14 | CACACAGGAAACAGCTATGACCAGATTAGAATTTGTGGCGC | 500-600c | 30 | |
| blaTEM-1 | B1f | TACTCAATCGGTAATTGGCT | 340 (Asian and African types) or 142 (Toronto type) | This article |
| D2r | GCCCAAAAAAGGGACGAAAG | 340 (Asian and African types) or 142 (Toronto type) | This article | |
| B3f | CGTATATCTAGTTGAGGCAC | 340 (Asian and African types) or 142 (Toronto type) | This article | |
| D4r | GTGCCTCAACTAGATATACG | 340 (Asian and African types) or 142 (Toronto type) | This article | |
| tet(M) | Tet1 | ATCCTTTCTGGGCTTCCATTG | 436 | This article |
| Tet2 | CCGAGCAGGGATTTCTCCAC | 436 | This article | |
| penA | penA-f | CGTGATTGCGAAGGCATTGG | 379 | This article |
| penA-r | GTGCGTCAGTGCGGTATAGG | 379 | This article | |
| ponA | PonA1-f | GAGAAAATGGGGGAGGACCG | 206 | This article |
| PonA1-r | GGCTGCCGCATTGCCTGAAC | 206 | This article | |
| rpsJ | RPS-for | GTGCTGTTGTAAAAGGCCCG | 186 | This article |
| RPS-rev | CGGCCGGCAAATCCAGCTTC | 186 | This article | |
| gyrA | GyrAFEx | GACGGCCTAAAGCCGGTGCA | 431 | 5 |
| GyrAREx | ATGTTGGTCGCCATACCGAC | 431 | 5 | |
| parC | ParCFEx | GTTTCAGACGGCCAAAAGCCC | 300 | 28 |
| ParCREx | GGAACAACAGCAATTCCGCAAT | 300 | 28 | |
| mtrR | MtrAF | GCCAATCAACAGGCATTCTTA | 401 | 16 |
| MtrAR | GTTGGAACAACGCGTCAAAC | 401 | 16 |
The por gene was amplified as two overlapping parts (parts I and II).
The M13F and M13R sequences are underlined.
Amplified fragments are different for PIA and PIB serovars of N. gonorrhoeae.
(ii) Nucleotide polymorphisms in the penA, ponA, rpsJ, gyrA, and mtrR genes and the mtrR gene promoter were detected by minisequencing reactions.
PCR was performed as described above, using the sets of primers listed in Table 1. Some primers were previously recommended (5, 16, 28, 30), and the others were newly designed using Oligo_6.31 software (Molecular Biology Insights Inc.) and sequences of N. gonorrhoeae strain FA1090 (GenBank accession no. NC_002946).
Dephosphorylation of the 5′-end phosphate groups of dNTPs in the postamplification reaction mixture was done by incubation with 0.5 U of shrimp alkaline phosphatase (Fermentas, Lithuania) for 20 min at 37°C, followed by inactivation of the enzyme by heating for 10 min at 85°C.
Minisequencing reactions were carried out with the amplicons of all genes of interest, obtained by conventional PCR with original internal primers designed for each particular SNP (Table 2) in such a way that, after annealing, their 3′ ends were close to polymorphic sites. In the presence of certain dNTPs and ddNTPs in the reaction mixture, these primers were extended in accordance with the nucleotide sequence of the complementary chain. Hence, the reaction products were different for wild (native) and mutant types. The SNPs were detected by measurement of the molecular masses of the reaction products by means of MALDI-TOF mass spectrometry and comparison to the theoretical molecular masses.
TABLE 2.
Internal primers used in minisequencing reactions for antimicrobial resistance-associated SNP discovery
| Gene locus | Detected marker | Primer sequence (5′-3′) | Molecular mass (Da) | Composition of dNTP and ddNTP mix | Predicted molecular mass (Da) of primer extension reaction product for wild type (reaction conditions) | Predicted molecular mass (Da) of primer extension reaction product for mutant type (reaction conditions) |
|---|---|---|---|---|---|---|
| penA | Asp345a | GGGGTAAACATGGGTATCG | 5,933 | dT, ddC | 6,206 (primer + ddC) | 6,510 dDDD (primer + dT + ddC) |
| ponA | Leu421→Pro | GGTTCAAGAGCCGTTGC | 5,227 | dT, dG, ddC | 6,133 (primer + dT + dG + ddC) | 5,500 (primer + ddC) |
| gyrA | Ser91→Phe | ATACCACCCCCACGGCGATT | 6,020 | dT, dA, ddC | 6,293 (primer + ddC) | 6,597 (primer + dT + ddC) |
| Ser91→Tyr | ATACCACCCCCACGGCGATT | 6,020 | dT, dA, ddC | 6,293 (primer + ddC) | 6,606 (primer + dA + ddC) | |
| Asp95→Gly | CGCCATACGGACGATGGTG | 5,870 | dT, ddC, ddG | 6,447 (primer + dT + ddC) | 6,143 (primer + ddC) | |
| Asp95→Ala | CGCCATACGGACGATGGTG | 5,870 | dT, ddC, ddG | 6,447 (primer + dT + ddC) | 6,183 (primer + ddG) | |
| Asp95→Asn | CGCCATACGGACGATGGTG | 5,870 | dT, ddC, ddG | 6,447 (primer + dT + ddC) | 6,791 (primer + dT + dT + ddG) | |
| mtrR | −35delA | ACATACACGATTGCACGGAT | 6,110 | dA, dC, ddT, ddG | 7,676 (primer + 5dA + ddG) | 7,363 (primer + 4dA + ddG) |
| −10insTT | ATTGCACGGATAAAAAGTC | 5,607 | dA, dC, ddT, ddG | 7,492 (primer + 6dA + ddG) | 8,101 (primer + 8dA + ddG) | |
| Gly45→Asp | TGAAATGCCAATAGAGCGCG | 6,175 | dA, dC, ddT, ddG | 6,770 (primer + dC + dC + ddG) | 6,463 (primer + ddT) | |
| rpsJ | Val57→Met | ACATTTTCCGTTCTCCGCAC | 5,979 | dA, dT, ddG | 6,292 (primer + ddG) | 6,910 (primer + dA + dT + ddG) |
The common scheme for using a MALDI-TOF mass spectrometry-based primer extension reaction for SNP scanning is shown in Fig. 1.
FIG. 1.
Scheme of minisequencing reaction followed by MALDI-TOF mass spectrometry analysis. An amplified fragment of N. gonorrhoeae genomic DNA is used as a template. An internal oligonucleotide primer is selected close to the polymorphic site (the variable nucleotides are shown in bold). The annealing primer is extended by TermiPol DNA polymerase (Solis Biodyne, Estonia) at one or two nucleotides, in accordance with the nucleotide sequence of the polymorphic site. As a rule, a mixture of deoxynucleotides and dideoxynucleotides is used. The dideoxynucleotide which terminates primer elongation is indicated by an asterisk. The annealing primer and its extended products are shown in boxes. Subsequent MALDI-TOF mass spectrometry analysis of reaction products allows us to detect the diversity between the nonextended primer and products of the minisequencing reaction, which are different for the wild type (a) and the mutant (b).
Thermocyclic primer extension reactions were carried out in 20-μl reaction mixtures containing 66 mM Tris-HCl, pH 9.0, 16.6 mM (NH4)2SO4, 2.5 mM MgCl2, a 0.2 mM concentration of each dNTP and ddNTP, 10 pmol of each respective internal primer (Table 2), and 2 units of TermiPol DNA polymerase (Solis Biodyne, Estonia) according to the following profile: 94°C for 20 s, 58°C for 20 s, and 72°C for 15 s for 70 cycles.
The minisequencing reaction products were purified using a SpectroCLEAN kit (Sequenom USA) according to the manufacturer's instructions.
A sample aliquot (0.2 to 1 μl) was spotted onto the matrix, which was preliminarily dried on AnchorChip (Bruker Daltonics, Germany) 400-μm targets. The matrix employed was a saturated solution of 3-hydroxypicolinic acid (Fluka, Germany) in a 1:1 acetonitrile-water mixture (Merck, Germany) mixed with 0.4 M dibasic ammonium citrate (Fluka, Germany) at 9:1 (vol/vol) ratio. All solvents were of a quality suitable for mass spectrometry. Mass spectra were collected on a Reflex IV MALDI-TOF mass spectrometer (Bruker Daltonics, Germany) that was operated in the positive linear mode. A 337-nm nitrogen laser with a 9-Hz pulse frequency was used. Mass spectrometer parameters were optimized for the range of m/z values from 1,000 to 10,000, using a peptide standard set for calibration. Each mass spectrum was collected with 30 laser pulses at constant laser power and a constant threshold value in order to enhance the resolution.
(iii) Sequencing procedure for analysis of porB1 and parC gene changes.
PCRs were performed with the corresponding primer sets (Table 1) under the same conditions as those described above. DNA sequence analysis was performed by the modified Sanger method, using an ABI Prism BigDye Terminator cycle sequencing ready reaction kit and an ABI Prism 3100 genetic analyzer (Applied Biosystems; Hitachi, Japan) according to the manufacturer's instructions.
Analysis of the nucleotide sequence as well as of deduced amino acid sequences was performed using Vector NTI Advance v. 9.0 software (Infomarks Inc.).
Por typing of N. gonorrhoeae isolates.
N. gonorrhoeae typing based on analysis of por gene variability was done as described previously (8, 14, 24, 30). The por type of a particular isolate was determined by identification of the obtained nucleotide sequences of the porB1 genes in the EMBL (European Molecular Biology Laboratory) and NCBI (National Center for Biotechnology Information) databases.
Statistical analysis.
Associations between genetic factors and susceptibility categories were examined by using chi-square (χ2) and Cramer (V) tests. All statistical calculations were two-tailed and were conducted with the significance set at P values of <0.05. Statistical analyses were performed with STATISTICA 6.0 software.
RESULTS
Four hundred sixty-four isolates were included in the study. Por typing revealed genetic heterogeneity among the isolates studied. Four hundred twelve (88.8%) isolates belonged to the PIB serovar, and the most prevalent serotypes were PIB2, PIB3, and PIB22, detected in 170 (36.6%), 122 (26.3%), and 41 (8.8%) isolates, respectively. The remaining PIB serovar isolates (80 [17.2%]) belonged to seven different serotypes. The PIA serovar was found in 52 (11.2%) isolates, with the PIA6 serotype being predominant, as it was found in 37 (8%) isolates.
Genotypes and penicillin susceptibility.
Among isolates included in the study, 120 (25.9%) were susceptible to penicillin, 289 (62.2%) had intermediate susceptibility, and 55 (11.9%) were resistant. The penicillin MIC distribution for isolates with different genotypes is shown in Table 3. The wild type (no mutations in target genes and no blaTEM-1 gene) was detected in 54 (11.6%) isolates and was significantly associated with clinical susceptibility (χ2 = 134.3; P < 0.001).
TABLE 3.
Distribution of penicillin MICs for N. gonorrhoeae isolates with different genotypes
| Genotypea | No. (%) of isolates | No. of isolates with MIC (μg/ml)
|
No. (%) of isolates by susceptibility levelb
|
P valuec | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0.015 | 0.03 | 0.06 | 0.12 | 0.25 | 0.5 | 1 | 2 | 4 | 8 | 16 | S | I | R | |||
| wt | 54 (11.6) | 29 | 16 | 4 | 4 | 1 | 49 (90.7) | 5 (9.3) | 0 | <0.001 | ||||||
| penAmut | 51 (9.4) | 19 | 1 | 4 | 13 | 4 | 6 | 2 | 25 (49.0) | 24 (47.1) | 2 (3.9) | >0.05 | ||||
| mtrRmut | 1 (0.2) | 1 | 1 (100) | 0 | 0 | |||||||||||
| penBmut | 2 (0.4) | 2 | 2 (100) | 0 | 0 | |||||||||||
| penAmutpenBmut | 7 (1.5) | 2 | 1 | 4 | 2 (28.6) | 5 (71.4) | 0 | >0.05 | ||||||||
| penAmutmtrRmut | 15 (3.2) | 2 | 4 | 4 | 2 | 3 | 1 | 1 | 5 (33.3) | 9 (60.0) | 1 (6.7) | >0.05 | ||||
| penAmutpenBmutmtrRmut | 6 (1.3) | 1 | 2 | 2 | 1 | 1 | 3 (50.0) | 3 (50.0) | 0 | >0.05 | ||||||
| penAmutponAmut | 39 (8.4) | 2 | 2 | 2 | 13 | 4 | 9 | 5 | 2 | 6 (15.4) | 31 (79.5) | 2 (5.1) | <0.001 | |||
| penAmutponAmutmtrRmut | 62 (13.4) | 4 | 2 | 7 | 7 | 21 | 17 | 4 | 1 | 6 (9.7) | 51 (82.3) | 5 (8.0) | <0.001 | |||
| penAmutpenBmutponAmut | 76 (16.4) | 2 | 3 | 1 | 11 | 9 | 17 | 27 | 6 | 1 | 6 (7.9) | 63 (82.8) | 7 (9.2) | <0.001 | ||
| penAmutpenBmutponAmutmtrRmut | 133 (28.7) | 6 | 5 | 4 | 11 | 9 | 33 | 40 | 18 | 4 | 1 | 15 (11.3) | 95 (71.4) | 23 (17.3) | <0.001 | |
| blaTEM-1pres | 18 (3.9) | 3 | 3 | 2 | 4 | 6 | 0 | 3 (16.7) | 15 (83.3) | <0.001 | ||||||
| Total | 464 | 66 | 29 | 25 | 63 | 36 | 92 | 98 | 36 | 7 | 6 | 6 | 120 (25.9) | 289 (62.2) | 55 (11.9) | |
Pattern of known genetic markers selected for analysis of antimicrobial resistance to penicillin. wt, wild-type (native) sequence in loci associated with resistance to penicillin; mtrRmut, nucleotide substitutions are found in either the mtrR gene or its promoter; blaTEM-1pres, combination of blaTEM-1 gene presence with any variants of other genetic loci.
S, susceptible strains; I, intermediately resistant strains; R, resistant strains (in accordance with CLSI criteria [3] for certain antibiotics). Nonsusceptible categories are shown in bold.
Significance of distinctions between isolates from different phenotypes for the particular genotype examined (two-tailed Fisher's exact test was used).
Eleven different combinations of determinants involved in the development of resistance to penicillin were detected. As a single resistance determinant, an Asp345a insertion in penA (penAmut) was found in 51 (9.4%) isolates, and the distribution of penicillin MICs for these isolates was found to be bimodal.
Analysis of the PorB1b protein (PenB locus) revealed that 225 (48.5%) isolates possessed two different combinations of amino acid substitutions at positions 120 and 121, which have been regarded as critical in mediating resistance to penicillin and tetracycline (9, 19). The combination of a Gly120→Lis mutation with an Ala121→Asp mutation was found in 115 isolates, and a Gly120→Asp mutation with an Ala121→Asn mutation was found in 74 isolates. Because all of these mutations led to the same effect in the following analysis, we did not discriminate them in individual isolates and considered them together as penB mutants (penBmut).
Within the mtrR region, the following changes were detected: amino acid substitution Gly45→Asp in the MtrR protein (72 isolates) and nucleotide mutation −35delA in the gene's promoter (170 isolates). It should be noticed that among the isolates, 19 carried both mutations simultaneously. Taking into account that both mutations led to overexpression of the MtrC-MtrD-MtrE efflux pump (23, 29) and that a cumulative effect had not been shown, we considered them together to be mtrR mutants (mtrRmut).
Three genotypes (penAmut penBmut, penAmut mtrRmut, and penAmut penBmut mtrRmut) were detected in 7, 15, and 6 isolates, respectively. An obvious trend toward higher MICs for isolates with these genotypes than those for wild-type isolates was observed, but the correlation with clinical nonsusceptibility was not significant (P > 0.05). The genotypes with isolated mutations in mtrR and penB were observed in one and two isolates, respectively, with a penicillin MIC of 0.015 μg/ml.
Four genotypes (ponAmut penAmut, ponAmut penAmut mtrRmut, ponAmut penAmut penBmut, and ponAmut penAmut penBmut mtrRmut) were more prevalent and were detected in 39 (8.4%), 62 (13.4%), 76 (16.4%), and 133 (28.7%) isolates, respectively. All of these genotypes were significantly associated with clinical nonsusceptibility (χ2 = 281.7; P < 0.001). The highest penicillin MICs were observed for 18 (3.9%) beta-lactamase-positive isolates, but in 8 of them the MICs varied from 1.0 to 4.0 μg/ml, while usually the production of beta-lactamases is associated with values of ≥8.0 μg/ml. The relationship between the analyzed groups (genotype, as a complex of known genetic markers, and phenotype) was confirmed by the Cramer factor, which was found to be 0.64 for penicillin resistance.
Genotypes and tetracycline susceptibility.
One hundred sixty-seven (35.9%) isolates were susceptible to tetracycline, 121 (26.0%) had intermediate susceptibility, and 176 (38.1%) were resistant. The tetracycline MIC distribution for isolates with different genotypes is shown in Table 4. The wild type [no mutations in genes involved in development of resistance and no tet(M) gene] was detected in 91 (19.6%) isolates and was significantly associated with clinical susceptibility (χ2 = 116.7; P < 0.001).
TABLE 4.
Distribution of tetracycline MICs for N. gonorrhoeae isolates with different genotypes
| Genotypea | No. (%) of isolates | No. of isolates with MIC (μg/ml)
|
No. (%) of isolates by susceptibility levelb
|
P valuec | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0.03 | 0.06 | 0.12 | 0.25 | 0.5 | 1 | 2 | 4 | 8 | 16 | 32 | S | I | R | |||
| wt | 91 (19.6) | 38 | 12 | 9 | 17 | 11 | 3 | 1 | 76 (83.5) | 15 (16.5) | 0 | <0.001 | ||||
| mtrRmut | 3 (0.6) | 1 | 1 | 1 | 3 (100.0) | 0 | 0 | |||||||||
| penBmut | 3 (0.6) | 2 | 1 | 2 (66.7) | 1 (33.3) | 0 | >0.05 | |||||||||
| rpsJmut | 59 (12.7) | 9 | 3 | 1 | 5 | 13 | 17 | 9 | 2 | 18 (30.5) | 30 (50.8) | 11 (18.7) | <0.05 | |||
| rpsJmutmtrRmut | 78 (16.8) | 10 | 4 | 4 | 3 | 8 | 13 | 22 | 11 | 1 | 2 | 21 (26.9) | 21 (26.9) | 36 (46.2) | <0.01 | |
| rpsJmutpenBmut | 87 (18.8) | 9 | 5 | 1 | 3 | 8 | 14 | 13 | 27 | 7 | 18 (20.7) | 22 (25.3) | 47 (54.0) | <0.01 | ||
| rpsJmutpenBmutmtrRmut | 139 (30.0) | 16 | 6 | 1 | 6 | 11 | 21 | 24 | 33 | 15 | 6 | 29 (20.9) | 32 (23.0) | 78 (56.1) | <0.01 | |
| tet(M)pres | 4 (0.9) | 2 | 2 | 0 | 0 | 4 (100.0) | <0.01 | |||||||||
| Total | 464 | 85 | 31 | 16 | 35 | 51 | 68 | 70 | 73 | 23 | 10 | 2 | 167 (40.0) | 119 (25.6) | 178 (38.4) | |
Pattern of known genetic markers selected for analysis of antimicrobial resistance to tetracycline. wt, wild-type (native) sequence in loci associated with resistance to tetracycline; mtrRmut, nucleotide substitutions are found in either the mtrR gene or its promoter; tet(M)pres, combination of tet(M) determinant presence with any variants of other genetic loci.
S, susceptible strains; I, intermediately resistant strains; R, resistant strains (in accordance with CLSI criteria [3] for certain antibiotics). Nonsusceptible categories are shown in bold.
Significance of distinctions between isolates from different phenotypes for the particular genotype examined (two-tailed Fisher's exact test was used).
Seven different combinations of determinants involved in the development of resistance to tetracycline were observed. Isolated mutations in mtrR and penB genes in the absence of other known determinants involved in the development of resistance to tetracyclines were rare: three isolates with each genotype were detected. The isolated mutation Val57→Met in the rpsJ gene (rpsJmut) was found in 59 (12.7%) isolates. In comparison to wild-type isolates, an obvious shift toward higher MIC values was observed for isolates harboring mutations in the rpsJ gene, but the association was not statistically significant.
Three genotypes (rpsJmut mtrRmut, rpsJmutpenBmut, and rpsJmut penBmut mtrRmut) were more prevalent and were detected in 78 (16.8%), 87 (18.8%), and 139 (30%) isolates, respectively. All of these genotypes were significantly associated with clinical nonsusceptibility (χ2 = 163.1; P < 0.001). The association between the analyzed groups (genotype, as a complex of known genetic markers, and phenotype) was confirmed by the Cramer factor, which was found to be 0.53 for tetracycline resistance.
Genotypes and ciprofloxacin susceptibility.
Among the studied isolates, 251 (54.1%) were susceptible to ciprofloxacin, 2 (0.4%) had intermediate susceptibility, and 211 (45.5%) were resistant (Table 5).
TABLE 5.
Distribution of ciprofloxacin MICs for N. gonorrhoeae isolates with different genotypes
| Genotypea | No. (%) of isolates | No. of isolates with MIC (μg/ml)
|
No. (%) of isolates by susceptibility levelb
|
P valuec | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0.002 | 0.004 | 0.008 | 0.015 | 0.03 | 0.06 | 0.12 | 0.25 | 0.5 | 1 | 2 | 4 | 8 | 16 | 32 | 64 | S | I | R | |||
| wt | 150 (32.2) | 76 | 42 | 21 | 6 | 4 | 1 | 149 (99.3) | 1 (0.7) | 0 | <0.001 | ||||||||||
| mtrRmut | 85 (18.3) | 40 | 12 | 16 | 10 | 4 | 1 | 1 | 1 | 82 (96.5) | 0 | 3 (3.5) | <0.001 | ||||||||
| gyrAmut | 17 (3.7) | 2 | 1 | 2 | 4 | 6 | 1 | 1 | 2 (11.8) | 1 (5.9) | 14 (82.3) | <0.001 | |||||||||
| parCmut | 4 (0.1) | 1 | 1 | 2 | 1 (25.0) | 0 | 3 (72.0) | >0.05 | |||||||||||||
| gyrAmutmtrRmut | 6 (1.3) | 2 | 1 | 2 | 1 | 2 (33.3) | 0 | 4 (66.7) | >0.05 | ||||||||||||
| parCmutmtrRmut | 13 (2.8) | 1 | 1 | 2 | 2 | 1 | 4 | 2 | 1 | 2 (15.4) | 0 | 11 (84.6) | <0.001 | ||||||||
| gyrAmutparCmut | 70 (15.1) | 1 | 6 | 3 | 28 | 16 | 11 | 5 | 1 (1.4) | 0 | 69 (98.6) | <0.001 | |||||||||
| gyrAmutparCmutmtrRmut | 119 (25.6) | 5 | 1 | 1 | 4 | 1 | 3 | 12 | 10 | 20 | 29 | 21 | 11 | 12 (10.1) | 0 | 107 (89.9) | <0.001 | ||||
| Total | 464 | 128 | 55 | 38 | 21 | 9 | 0 | 1 | 1 | 0 | 9 | 25 | 24 | 52 | 50 | 35 | 16 | 251 (54.1) | 2 (0.4) | 211 (45.5) | |
Pattern of known genetic markers selected for analysis of antimicrobial resistance to fluoroquinolones. wt, wild-type(native) sequence in loci associated with resistance to fluoroquinolones; mtrRmut, nucleotide substitutions are found in either the mtrR gene or its promoter.
S, susceptible strains; I, intermediately resistant strains; R, resistant strains (in accordance with CLSI criteria [3] for certain antibiotics). Nonsusceptible categories are shown in bold.
Significance of distinctions between isolates from different phenotypes for the particular genotype examined (two-tailed Fisher's exact test was used).
The known amino acid substitutions in the QRDR region were identified in 208 of 211 ciprofloxacin-resistant isolates. Most of them (n = 193) possessed double mutations in GyrA, at Ser91 and Asp95. One isolate with a ciprofloxacin MIC of 0.25 μg/ml revealed a single mutation in GyrA (Ser91→Phe). The ParC alterations occurred in the QRNG region in 194 isolates, at residue Asp86, Ser87, or Glu91. Commonly, mutations in the parC gene were represented with the same frequencies as those in gyrA. Alterations in both gyrA and parC genes were found for 176 resistant strains with fluoroquinolone MICs of ≥4 μg/ml.
The wild type (no mutations in genes involved in resistance development) was detected in 148 (31.9%) isolates. In 85 (18.3%) isolates, mtrRmut was detected as a single resistance determinant; the ciprofloxacin MIC distribution for these isolates did not differ significantly from that for wild-type isolates. Both genotypes were significantly associated with clinical susceptibility (χ2 = 180.8; P < 0.001).
Isolated mutations in ParC and a combination of a mutation in GyrA with mtrRmut were rare, and we were unable to find any significant association with a particular phenotype.
Four genotypes (gyrAmut, parCmut mtrRmut, gyrAmut parCmut, and gyrAmut parCmut mtrRmut) were detected in 17 (3.7%), 13 (2.8%), 70 (15.1%), and 119 (25.6%) isolates, respectively. All of these genotypes were significantly associated with clinical nonsusceptibility (χ2 = 404.1; P < 0.001), and the Cramer factor was found to be 0.89 for fluoroquinolone resistance.
DISCUSSION
Our work focused on estimation of the impact of molecular mechanisms on the development of N. gonorrhoeae clinical strains with resistance to penicillin, tetracycline, and fluoroquinolones. Previously, a number of mechanisms were found to be significant for the development of N. gonorrhoeae resistance in transformation and site-directed mutagenesis experiments, but the data dealing with their prevalence in large groups of clinical isolates were lacking (11, 15, 25, 32). These data are also important for the improvement of resistance detection molecular tools. Because the majority of resistance mechanisms in N. gonorrhoeae are linked to mutations in the chromosomal DNA, adequate methods for SNP scanning should be created. MALDI-TOF mass spectrometry-based minisequencing or a sequencing procedure for the detection of SNPs was applied successfully for hepatitis C virus genotyping (13), detection of genetic markers of antibacterial resistance in Mycobacterium tuberculosis (12), and discrimination of mef genes in Streptococcus pneumoniae (unpublished data). This approach has been applied to N. gonorrhoeae strains for the first time.
The nonclonal character of the analyzed strains was confirmed by por typing. Different genotypes were found for the whole group as well as for samples from a particular region of Russia.
Analysis of the prevalence of known resistance determinants in a large set of clinical isolates of N. gonorrhoeae indicates that their absence is associated with clinical susceptibility to penicillin, tetracyclines, and fluoroquinolones. The majority of isolates carrying penBmut, mtrRmut, penAmut, or rpsJmut as a single genetic marker demonstrated some antibiotic MIC shift toward higher values than those for wild-type isolates, but nevertheless, they remained in the susceptible category. As far as penB and mtrR mutations are concerned, this statement is in agreement with the observations that mutations in PorB1b have no effect alone and that both mtrR and penB mutations are required to decrease permeability of the cell membrane and to develop antimicrobial resistance in gonococci (20, 27).
Most of the penicillin-resistant N. gonorrhoeae strains either carried the blaTEM-1 gene or had different combinations of nucleotide substitutions in the penA, mtrR, penB, or ponA gene. The presence of the blaTEM-1 gene was observed in 12 strains with high-level resistance to penicillin (MICs = 4.0 to 16.0 μg/ml), but for six blaTEM-1-positive isolates the MICs of penicillin varied from 1.0 μg/ml to 2.0 μg/ml. This may be explained by a decreased β-lactamase activity due to amino acid substitutions. However, whole blaTEM-1 gene sequencing did not reveal any alterations (data not shown). This phenomenon requires further investigation. Nevertheless, the difference between susceptible and resistant groups for that genotype (blaTEM-1) was found to be reliable (P < 0.001).
An isolated alteration in the penA gene was found only for 51 isolates. Insertion of an aspartic acid (Asp345a) in PBP2 was linked to the decreased rate of acylation by penicillin (7) and to an increase of the antibiotic MIC to 0.12 to 0.25 μg/ml and is considered to be the first step in the acquisition of high-level resistance to penicillin (2). However, the distribution of penicillin MICs for isolates possessing this mutation as a single possible mechanism of resistance to penicillin was bimodal, with peaks at 0.015 μg/ml and 0.12 μg/ml. Probably, additional mutations in penA or other genes are necessary for the expression of resistance, and the development of compensatory mutations is less likely. The absence of a statistically significant correlation between susceptible and nonsusceptible strains (P > 0.05) confirmed the ambiguous impact of penA mutation on penicillin resistance phenotype formation. Similar data were obtained for 28 strains which had penA alteration with additional mutations in penB or mtrR loci.
The combination of mutations in both the penA and ponA genes with any nucleotide sequence in penB or mtrR loci was shown for 310 strains, especially those with penicillin MICs of 0.5 to 1.0 μg/ml. Previously, it was shown that a Leu421→Pro substitution in PBP1 (ponA gene) was involved in high-level penicillin resistance of gonorrhea, but only as an additional locus (25). Our data are not in complete agreement with this finding. Among the strains examined, only those with mutations in both the ponA and penA loci were found, especially for N. gonorrhoeae strains with MICs of 0.12 to 1.0 μg/ml. The high-level penicillin-resistant strains had alterations in almost all loci studied, i.e., penA, ponA, penB, and mtrR. Nevertheless, significant differences between strains that were susceptible and nonsusceptible to penicillin were found for all of these genotypes (P < 0.001). This was the reason that genotypes ponAmut penAmut, ponAmut penAmut mtrRmut, ponAmut penAmut penBmut, and ponAmut penAmut penBmut mtrRmut were selected as predictive of antimicrobial resistance of N. gonorrhoeae to penicillin.
Although 12 N. gonorrhoeae strains were identified as having high-level resistance to tetracycline (MICs of ≥16 μg/ml), only 4 of them carried the plasmid-encoded Tet(M) determinant. For the remaining eight strains, it might be the contributions of other, unstudied chromosomally mediated mechanisms that result in high-level tetracycline resistance. Ninety-one isolates that had neither tet(M) nor alterations in rspJ, mtrR, and penB loci were susceptible or intermediately resistant to tetracycline (MICs of <1.0 μg/ml). A similar trend was observed for six strains with mutations only in either mtrR or penB loci.
The amino acid substitution Val45→Met in ribosomal protein S10 (encoded by the rpsJ gene) was found for 363 N. gonorrhoeae strains. Fifty-nine samples revealed only an rpsJ nucleotide alteration. Among them, 18 were susceptible to tetracycline, with MICs of <0.25 μg/ml, and the others were nonsusceptible (30 were intermediately resistant strains with MICs of 0.5 to 1.0 μg/ml, and 11 had MICs of 2.0 to 4.0 μg/ml). As expected, we did not find significant differences in this marker between strains that were susceptible and resistant to tetracycline (P > 0.05). The point mutation in the rpsJ gene was initially described as an additional mechanism for chromosomally mediated tetracycline resistance in N. gonorrhoeae (11).
In most cases (n = 304), rpsJ alteration was combined with the mtrR and penB resistance determinants. A significant difference (P < 0.01) was found between strains that were susceptible and resistant to tetracycline for genotypes rpsJmut mtrRmut, rpsJmut penBmut, and rpsJmut penBmut mtrRmut. All of them were selected as considerable for the prediction of tetracycline resistance in N. gonorrhoeae, but it should be mentioned that the predictive markers of tetracycline resistance were selected with less significance than those for penicillin or fluoroquinolone resistance. This clearly shows that known genetic markers are not yet completely sufficient to explain the phenomenon of N. gonorrhoeae tetracycline resistance.
For most isolates, the association between the presence of particular mutations in the QRDR region and the fluoroquinolone resistance phenotype has been shown. In cases of fluoroquinolone resistance with substitutions analyzed in neither the GyrA nor ParC protein (six strains), one can suppose the existence of unknown alterations in the genes for gyrase and topoisomerase or the involvement of specific efflux mechanisms (26). As mentioned above, most QRNG regions exhibited double mutations at both positions in GyrA. Among the strains examined, we revealed one with a single mutation in GyrA that agrees with a low level of fluoroquinolone resistance (MIC = 0.25 μg/ml). The other, with a MIC of 0.12 μg/ml for ciprofloxacin, had no alterations in the analyzed loci.
A significant difference (P < 0.001) was found between strains that were susceptible and resistant to fluoroquinolones for genotypes gyrAmut, parCmut mtrRmut, gyrAmut parCmut, and gyrAmut parCmut mtrRmut. Thus, these genotypes were selected as considerable for prediction of fluoroquinolone resistance. Two other genotypes, gyrAmut mtrRmut and parCmut, were too rare, and it was impossible to evaluate their statistical significance. It looks like efflux derepression due to substitutions in the mtrR locus might play a role in fluoroquinolone resistance revealed by strains with altered ParC proteins.
Thus, based on the explanations described above, the analysis of the distributions of individual genetic markers and their combinations among susceptible and resistant N. gonorrhoeae strains allowed us to select particular genotypes for prediction of antimicrobial resistance to penicillin, tetracycline, and fluoroquinolones (set off with spaces in Tables 3, 4, and 5), with significance at P levels of <0.01. The average positive predictive values of these genetic determinants were found to be different for fluoroquinolones (90.3%), penicillin (91.1%), and tetracycline (81.9%).
The first representative molecular study of the prevalence of resistance mechanisms in a large set of N. gonorrhoeae clinical isolates allowed us to conclude that the surveillance of genetic changes may be useful for the prediction of clinical resistance, improvement of gonorrhea treatment, and prevention of disease spread.
Acknowledgments
We sincerely thank V. A. Karpov for oligonucleotide primer synthesis.
This work was supported by development contract BDALIPCM 270505 from Bruker Daltonik, Germany, and by development contract 24-05 from the Russian Agency of Health.
Footnotes
Published ahead of print on 31 March 2008.
REFERENCES
- 1.Boom, R., C. J. A. Sol, M. M. M. Salimans, C. H. Jansen, P. M. E. Wertheim-van Dillen, and J. van der Noordaa. 1990. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28:495-503. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Brannigan, J. A., I. A. Tirodimos, Q.-Y. Zhang, C. G. Dowson, and B. G. Spatt. 1990. Insertion of extra amino acid is the main cause of the low affinity of penicillin-binding protein 2 in penicillin-resistant strains of N. gonorrhoeae. Mol. Microbiol. 4:913-919. [DOI] [PubMed] [Google Scholar]
- 3.Clinical Laboratory Standards Institute. 2002. Performance standards for antimicrobial susceptibility testing; 15th informational supplement. CLSI document no. M100-S15. CLSI, Wayne, PA.
- 4.Cousin, S., Jr., M. C. Roberts, and W. L. Whittington. 2004. Insertion of a thymine (+T) in the 13 base pair inverted repeat of the Neisseria gonorrhoeae mtr promoter region and antibiotic susceptibility. Int. J. Antimicrob. Agents 23:418-419. [DOI] [PubMed] [Google Scholar]
- 5.Deguchi, T., M. Yasuda, M. Asano, K. Tada, H. Iwata, H. Komeda, T. Ezaki, I. Saito, and Y. Kawada. 1995. DNA gyrase mutations in fluoroquinolone-resistant clinical isolates of Neisseria gonorrhoeae. Antimicrob. Agents Chemother. 39:561-563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Dewi, B. E., S. Akira, H. Hayashi, and W. Ba-Thein. 2004. High occurrence of simultaneous mutations in target enzymes and MtrRCDE efflux system in quinolone-resistant Neisseria gonorrhoeae. Sex. Transm. Dis. 31:353-359. [DOI] [PubMed] [Google Scholar]
- 7.Dowson, C. G., A. E. Jephcott, K. R. Gough, and B. G. Spratt. 1989. Penicillin-binding protein 2 genes of non-beta-lactamase-producing, penicillin-resistant strains of Neisseria gonorrhoeae. Mol. Microbiol. 3:35-41. [DOI] [PubMed] [Google Scholar]
- 8.Fudyk, T. C., I. W. Maclean, N. J. Simonsen, E. N. Njagi, J. Kimani, R. C. Brunham, and F. A. Plummer. 1999. Genetic diversity and mosaicism at the por locus of Neisseria gonorrhoeae. J. Bacteriol. 181:5591-5599. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gill, M. J., S. Simjee, K. Al-Hattawi, B. D. Robertson, C. S. Easmon, and C. A. Ison. 1998. Gonococcal resistance to β-lactams and tetracycline involves mutation in loop 3 of the porin encoded at the penB locus. Antimicrob. Agents Chemother. 42:2799-2803. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hagman, K. E., W. Pan, B. G. Spratt, J. T. Balthazar, R. C. Judd, and W. M. Shafer. 1995. Resistance of Neisseria gonorrhoeae to antimicrobial hydrophobic agents is modulated by the mtrRCDE efflux system. Microbiology 141:611-622. [DOI] [PubMed] [Google Scholar]
- 11.Hu, M., S. Nandi, C. Davies, and R. Nicholas. 2005. High-level chromosomally mediated tetracycline resistance in Neisseria gonorrhoeae results from a point mutation in the rpsJ gene encoding ribosomal protein S10 in combination with the mtrR and penB resistance determinants. Antimicrob. Agents Chemother. 49:4327-4334. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ikryannikova, L. N., M. V. Afanas'ev, T. A. Akopian, E. N. Il'ina, A. V. Kuz'min, E. E. Larionova, T. G. Smirnova, L. N. Chernousova, and V. M. Govorun. 2007. Mass-spectrometry based minisequencing method for the rapid detection of drug resistance in Mycobacterium tuberculosis. J. Microbiol. Methods 70:395-405. [DOI] [PubMed] [Google Scholar]
- 13.Ilina, E. N., M. V. Malakhova, E. V. Generozov, E. N. Nikolaev, and V. M. Govorun. 2005. Matrix-assisted laser desorption ionization-time of flight (mass spectrometry) for hepatitis C virus genotyping. J. Clin. Microbiol. 43:2810-2815. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Il'ina, E. N., M. V. Malakhova, V. A. Vereshchagin, V. M. Govorun, V. I. Sergienko, M. M. Zubkov, M. M. Vasil'ev, and A. A. Kubanova. 2003. Molecular typing of N. gonorrhoeae strains prevalent in the Russian Federation. Bull. Exp. Biol. Med. 136:179-182. [DOI] [PubMed] [Google Scholar]
- 15.Lindbäck, E., S. Islam, M. Unemo, C. Lang, and B. Wretlind. 2006. Transformation of ciprofloxacin-resistant Neisseria gonorrhoeae gyrA, parE and porB1b genes. Int. J. Antimicrob. Agents 28:206-211. [DOI] [PubMed] [Google Scholar]
- 16.Lucas, C. E., J. T. Balthazar, K. E. Hagman, and W. M. Shafer. 1997. The MtrR repressor binds the DNA sequence between the mtrR and mtrC genes of Neisseria gonorrhoeae. J. Bacteriol. 179:4123-4128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ministry of Health Care in the Russian Federation. 20 August 2003. Order 415. About the statement of the protocol of conducting patients with gonococcal infection. Ministry of Health Care in the Russian Federation, Moscow, Russian Federation.
- 18.Morse, S. A., S. R. Johnson, J. W. Biddle, and M. C. Roberts. 1986. High-level tetracycline resistance in Neisseria gonorrhoeae is result of acquisition of streptococcal tetM determinant. Antimicrob. Agents Chemother. 30:664-670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Olesky, M., M. Hobbs, and R. A. Nicholas. 2002. Identification and analysis of amino acid mutations in porin IB that mediate intermediate-level resistance to penicillin and tetracycline in Neisseria gonorrhoeae. J. Antimicrob. Chemother. 46:2811-2820. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Olesky, M., S. Zhao, R. L. Rosenberg, and R. A. Nicholas. 2006. Porin-mediated antibiotic resistance in Neisseria gonorrhoeae: ion, solute, and antibiotic permeation through PIB proteins with penB mutations. J. Bacteriol. 188:2300-2308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Pagotto, F., T. Aman, L.-K. Ng, K.-H. Yeung, M. Brett, and J. R. Dillon. 2000. Sequence analysis of the family of penicillinase-producing plasmids of Neisseria gonorrhoeae based on DNA sequencing. Plasmid 43:24-34. [DOI] [PubMed] [Google Scholar]
- 22.Palmer, H. M., J. P. Leeming, and A. Turner. 2000. A multiplex polymerase chain reaction to differentiate β-lactamase plasmids of Neisseria gonorrhoeae. J. Antimicrob. Chemother. 45:777-782. [DOI] [PubMed] [Google Scholar]
- 23.Piddock, L. J. V. 2006. Clinically relevant chromosomally encoded multidrug resistance efflux pumps in bacteria. Clin. Microbiol. Rev. 19:382-402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Posada, D., K. A. Crandall, M. Nguyen, J. C. Demma, and R. P. Viscidi. 2000. Population genetics of the porB gene of Neisseria gonorrhoeae: different dynamics in different homology groups. Mol. Biol. Evol. 17:423-436. [DOI] [PubMed] [Google Scholar]
- 25.Ropp, P. A., M. Hu, M. Olesky, and R. A. Nicholas. 2002. Mutations in ponA, the gene encoding penicillin-binding protein 1, and a novel locus, penC, are required for high-level chromosomally mediated penicillin resistance in Neisseria gonorrhoeae. Antimicrob. Agents Chemother. 46:769-777. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Rouquette-Loughlin, C., S. A. Dunham, M. Kuhn, J. T. Balthazar, and W. M. Shafer. 2003. The NorM efflux pump of Neisseria gonorrhoeae and Neisseria meningitidis recognizes antimicrobial cationic compounds. J. Bacteriol. 185:1101-1106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Shafer, W. M., and J. P. Folster. 2006. Towards an understanding of chromosomally mediated penicillin resistance in Neisseria gonorrhoeae: evidence for a porin-efflux pump collaboration. J. Bacteriol. 188:2297-2299. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Trees, D. L., A. L. Sandul, W. L. Whittington, and J. S. Knapp. 1998. Identification of novel mutation patterns in the parC gene of ciprofloxacin-resistant isolates of Neisseria gonorrhoeae. Antimicrob. Agents Chemother. 42:2103-2105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Veal, W. L., R. A. Nicholas, and W. M. Shafer. 2002. Overexpression of the MtrCMtrD-MtrE efflux pump due to an mtrR mutation is required for chromosomally mediated penicillin resistance in Neisseria gonorrhoeae. J. Bacteriol. 184:5619-5624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Viscidi, R. P., J. C. Demma, J. Gu, and J. Zenilman. 2000. Comparison of sequencing of the por gene and typing of the opa gene for discrimination of Neisseria gonorrhoeae strains from sexual contacts. J. Clin. Microbiol. 38:4430-4438. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Vorobieva, V., N. Firsova, T. Ababkova, I. Leniv, B. C. Haldorsen, M. Unemo, and V. Skogen. 2007. Antibiotic susceptibility of Neisseria gonorrhoeae in Arkhangelsk, Russia. Sex. Transm. Infect. 83:133-135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Zhao, S., D. M. Tobiason, M. Hu, H. S. Seifert, and R. A. Nicholas. 2005. The penC mutation conferring antibiotic resistance in Neisseria gonorrhoeae arises from a mutation in the PilQ secretin that interferes with multimer stability. Mol. Microbiol. 57:1238-1251. [DOI] [PMC free article] [PubMed] [Google Scholar]