Skip to main content
NCBI home page
Immunology logoLink to Immunology
. 2008 Feb;123(2):209–217. doi: 10.1111/j.1365-2567.2007.02688.x

Interferon-γ regulates chemokine expression and release in the human mast cell line HMC1: role of nitric oxide

M Gilchrist 1,*, A D Befus 1
PMCID: PMC2433300  PMID: 17662042

Abstract

Mast cells (MCs) are critical immune effector cells that release cytokines and chemokines involved in both homeostasis and disease. Interferon-γ (IFN-γ) is a pleiotropic cytokine that regulates multiple cellular activities. IFN-γ modulates rodent MC responsiveness via production of nitric oxide (NO), although the effects in human MC populations is unknown. We sought to investigate the effects of IFN-γ on expression of the chemokines interleukin-8 (IL-8) and CCL1 (I-309) in a human mast cell line (HMC1) and to determine the underlying regulatory mechanism. Nitric oxide synthase (NOS), IL-8 and CCL1 expression was determined using real-time polymerase chain reaction (PCR). NOS protein expression was analysed using western blot. NOS activity was determined using the citrulline assay. IL-8 and CCL1 release was measured by specific enzyme-linked immunosorbent assay (ELISA). IFN-γ inhibited phorbol 12-myristate 13-acetate (PMA)-induced release of IL-8 and CCL1 (by 47 and 38%). Real-time PCR analysis of IFN-γ-treated HMC1 showed a significant (P < 0·05) time-dependent increase in NOS1 and NOS3 mRNA. NOS3 protein was significantly increased at 18 hr, which correlated with a significant (P < 0·05) increase in constitutive NOS (cNOS) activity. IFN-γ-induced inhibition of chemokine expression and release was NO dependent, as treatment with the NOS inhibitor NG-nitro-l-arginine methyl ester (l-NAME) reduced the IFN-γ inhibitory effect on IL-8 and CCL1 mRNA expression. NO donors mimicked the IFN-γ effect. IFN-γ inhibited PMA-induced cAMP response element binding protein (CREB) phosphorylation and DNA-binding activity. Our observations indicate for the first time that IFN-γ enhances endogenous NO formation through NOS3 activity, and that NO regulates the transcription and release of IL-8 and CCL1 in a human MC line.

Introduction

Mast cells (MCs) are bone marrow-derived, tissue-resident effector cells.1 They secrete a variety of preformed and newly synthesized mediators with diverse roles in homeostasis and disease.2 In the light of the diversity of their mediators and their strategic localization, MCs have been implicated in disease states such as multiple sclerosis and allergic inflammation, including asthma.3

MC populations are heterogeneous and their functional responses can be sculpted by various cytokines. Indeed, the prevalence of T helper type 2 (Th2) cytokines, such as interleukin (IL)-4 and IL-5, in asthma can enhance MC release of histamine, leukotrienes, prostaglandins and cytokines, thereby promoting disease. Conversely, the archetypal Th1 cytokine, interferon (IFN)-γ, has been shown to down-regulate various responses of rodent MCs, including adhesion, degranulation and cytokine release.4–6 The role that IFN-γ plays in regulating human MCs is complex, and the results of various studies are often contradictory. Some studies have shown enhancement by IFN-γ of apoptosis in MCs, either enhancement or inhibition of granule mediator release, and induction of a distinct pattern of cytokine/chemokine expression,7 while another study showed no effect.8 Interestingly, down-regulation of IFN-γ levels has been implicated as a contributing factor in human asthma.9

Chemokines are a family of small (< 8 kDa) secreted proteins that are involved in cellular chemotaxis. Activation of MCs results in the release of many chemokines, including members of the CC and CXC families, IL-8 and CCL1 (I-309). IL-8 is the primary chemoattractant for neutrophils, while CCL1 has been shown to recruit CCR8-positive Th2 cells to the lung following allergen challenge.10

In rodents, one of the many effects downstream of IFN-γ is the production of the gaseous radical nitric oxide (NO).11 NO is derived from l-arginine by the nitric oxide synthase (NOS) family of enzymes. The calcium (Ca2+)-dependent members of this family include endothelial NOS (eNOS/NOS3) and neuronal NOS (nNOS/NOS1), characterized by constitutive expression and low NO production. Inducible NOS (iNOS/NOS2) is up-regulated by a variety of inflammatory mediators and functions independently of cellular Ca2+ levels and releases large amounts of NO.12 Numerous investigators have shown that rodent MCs are regulated by endogenous NO from both constitutive (NOS1/3) and inducible sources (NOS2).5,13,14 We have recently shown that the human MC lines HMC1 and LAD2 as well as ex vivo skin MCs can constitutively express NOS1 and NOS3 but not NOS2, and that NO produced upon phorbol 12-myristate 13-acetate (PMA) or immunoglobulin E (IgE)/anti-IgE activation regulates leukotriene release.15 However, no information is available about the potential involvement of NO as a moderator of IFN-γ effects in human MC populations.

The aim of the present study was to investigate the regulation of chemokine production by IFN-γ in a human MC line (HMC1), and the possible contribution of NO. These results indicate that NO may be a novel modulator of the functional phenotype of human MCs.

Materials and methods

Reagents

IFN-γ was obtained from Peprotech (Rocky Hill, NJ). The NOS inhibitor NG-nitro-l-arginine methyl ester (l-NAME) and the NO donor S-nitrosoglutathione (SNOG) were obtained from Calbiochem (San Diego, CA). Rabbit polyclonal antibodies against NOS isoforms and actin were obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Rabbit antibodies against phosphorylated-p38, -extracellular regulated MAP kinase (ERK), -Jun N-terminal kinase (JNK) and -cAMP response element binding (CREB) were obtained from Cell Signaling Technologies (Danvers, MA).

Cell lines

HMC1 (a kind gift from J. H. Butterfield, Mayo Clinic, Minneapolis, MN), was cultured in Iscove's medium (Life Technologies, Grand Island, NY), with 10% fetal bovine serum (FBS), 2 mm glutamine, 40 U/ml penicillin/streptomycin and 1·0 mm thioglycerol. Cells were harvested and fed every 3–4 days and maintained at 37° in a humidified incubator at 5% CO2.

Real-time polymerase chain reaction (PCR) analysis

HMC1 cells were plated at 0·5 × 106 cells/ml in RPMI (low serum; 1% FBS) for 24 hr before the start of the assay. Low-serum-containing medium was used, as HMC1 cells have been shown to produce constitutive levels of CCL1 in normal media.16 Total RNA was isolated using Trizol reagent. Synthesis of cDNA was completed with murine Moloney leukaemia virus (MMLV) reverse transcriptase (Promega, Madison, WI) according to the manufacturer's recommendations and primed with oligo d(T) (Promega). Quantitative real-time PCR was performed on an ABI 7700 (Applied Biosystems, Foster City, CA) using TaqMan Universal PCR Master Mix (Applied Biosystems). Probes (IDT) labelled with 5′ FAM and 3′ TAMRA modifications were used at a final concentration of 0·9 mm, and primers were used at 0·2 mm (Invitrogen, Carlsbad, CA). The PCR programme was as follows: 50° for 2 min and 95° for 10 min (95° for 15 seconds and 60° for 1 min) for 40 cycles. All data were normalized to GAPDH expression in the same cDNA set. Data are presented in relative mRNA units and represent the average of at least three values ± standard deviation. Primer/probe sequences were as given in Table 1.

Table 1.

Primer/probe sequences used

Gene Forward primer Reverse primer Probe
NOS1 ATGCGTCACTTCTAGACACAGCCA ATGATTTCCTGCATCCGCCTCTCT TCTGCCTGGTCAACCATCACTTCCTT
NOS2 AATCTCTCGGCCACCTTTGATGAG AGCTCAGATGTTCTTCACTGTGGG AAGGCACAGGTCTCTTCCTGGTTTGA
NOS3 TCTCCGCCTCGCTCATG AGCCATACAGGATTGTCGCC CACGGTGATGGCGAAGCGAGTG
IL-8 TTGGCTGGCTTATCTTCACCATC CTGAAGCTCCACAATTTGGTGAA CCATGATCTTGTTCTAACACCTGCCACTC
CCL1 TGGATGGAATGACGTAGGGTTGGA TGTCCTGGTTGAGTGGGAAGCAAA CACAGAGGCCACTTCCTCTCACTTA
GAPDH CCACATCGCTCAGACACCAT ACCAGGCGCCCAATACG CAAATCCGTTGACTCCGACCTTCA
Open in a new tab

IL, interleukin; NOS, nitric oxide synthase.

Western blot

HMC1 cells were incubated at 1 × 106 cells/well from 0 to 18 hr in various experimental conditions. The cells were dissociated using 500 µl of radioimmunoprecipitation (RIPA) buffer [phosphate-buffered saline (PBS) and 1% NP-40]. The total protein content of each sample was determined by the Bradford technique (Bio-Rad, Hercules, CA). Fifteen µg of protein from each sample was mixed with Lamelli loading buffer containing sodium dodecyl sulphate (SDS) and β-mercaptoethanol. Samples were separated on a 12% SDS–polyacrylamide gel electrophoresis (SDS-PAGE) gel and transferred onto a polyvinylidene difluoride membrane (Bio-Rad). The membrane was incubated with primary antibodies for 1 hr at room temperature. The secondary antibody, 1/5000 horseradish peroxidase conjugated goat anti-rabbit IgG (Serotec, Raleigh, NC) was added to the membrane for 1 hr at room temperature. Labelling was detected by chemiluminescence by addition of SuperSignal substrate solution (Pierce, Rockford, IL).

Assay for NOS activity

NOS activity was measured by the conversion of l-[14C] arginine to l-[14C] citrulline, using a NOS assay kit (Calbiochem) according to the manufacturer's procedures and as we have previously described.15 Duplicate incubations at 37° for each sample were run for 30 min in the presence of ethyleneglycoltetraacetic acid (EGTA) (2 mm) to determine the levels of calcium-dependent (constitutive) NOS activity. Calcium-independent (inducible) NOS activity was determined by subtracting the constitutive activity from the total NOS activity in the sample. The level of citrulline produced was expressed as picomoles/min/mg of protein. The protein content was determined by the Bradford technique (Bio-Rad). The specificity of the assay was validated by adding the pan-NOS inhibitor NG-monomethyl-l-arginine (l-NMMA) (100 µm), to ensure that the citrulline detected arose from the activity of NOS.

Enzyme-linked immunosorbent assay (ELISA) for chemokines

IL-8 (R & D Systems, Minneapolis, MN) and CCL1 release was measured in MC culture supernatants 4 hr after stimulation with various concentrations of PMA using commercially available ELISA according to the manufacturer's protocols (R & D Systems). The sensitivity of the IL-8 assay is 5·0 pg/ml and that of the CCL1 assay is 0·01 pg/ml.

Binding activity of nuclear transcription factors

Nuclear proteins were isolated from PMA-stimulated HMC1 (5 × 106 cells) using the transfactor nuclear/cytosolic extraction kit (Clontech, Mountain View, CA). Fifteen μg of the resulting nuclear extracts was assayed by binding ELISA (Transfactor Inflammation Profiling kit; Clontech) for p65, p50, Rel, Fos, activating transcription factor 2 (ATF2) and CREB. Detection of specific transcription factors to binding-site oligonucleotides was determined with specific antibodies following the manufacturer's protocol. DNA-binding activity was expressed as a ratio to the Jurkatt cell lysate provided as a positive control.

Statistical analysis

All experiments were performed at least three times. Data were analysed using analysis of variance (ANOVA) followed by the Bonferroni test for comparisons. P-values < 0·05 were considered significant.

Results

Effects of IFN-γ on chemokine release by HMC1

To determine whether IFN-γ affects chemokine release from HMC1, cells were treated with varying doses of IFN-γ (20, 200 and 500 U/ml for 18 hr) and stimulated with PMA (30 ng/ml for 4 hr), and then chemokine levels were determined by ELISA. PMA has previously been shown to induce chemokine release from HMC.16 In low-serum media, HMC1 cells constitutively release minimal amounts of IL-8 or CCL1 (Fig. 1). Stimulation with PMA resulted in a significant (P < 0·05) increase in IL-8 (593 ± 37·9) and CCL1 (1506·6 ± 92·4) release compared with constitutive levels. Pretreatment with IFN-γ at all three doses, before PMA activation, significantly (P < 0·05) inhibited the release of IL-8 and CCL1 (Fig. 1). For further studies, 200 U/ml of IFN-γ was utilized.

Figure 1.

Figure 1

Open in a new tab

Interferon (IFN)-γ regulation of chemokine release in the human mast cell line HMC1. Concentrations of interleukin (IL)-8 and CCL1 in medium from HMC1 were determined by enzyme-linked immunosorbent assay (ELISA). Cells were preincubated with IFN-γ (20, 200 or 500 U/ml; 18 hr) then stimulated with phorbol 12-myristate 13-acetate (PMA; 30 ng/ml) for 4 hr. Results are expressed as mean ± standard error of the mean (SEM) for three independent experiments. *P < 0·05 by comparison with control; ‡P < 0·05 compared with PMA-stimulated cells.

IFN-γ regulation of NOS mRNA expression

IFN-γ regulates gene expression and can induce NO production by up-regulating NOS2 expression in rodent MCs.13 We thus investigated NOS mRNA expression by IFN-γ in human HMC1. Total RNA was extracted from unstimulated HMC1, and from HMC1 treated with IFN-γ (200 U/ml) for 6 and 18 hr and analysed by real-time PCR (Fig. 2). Within 6 hr following treatment with IFN-γ, both the NOS1 and NOS3 signals in HMC1 increased, with NOS3 increasing (P < 0·05) more than 2-fold. Levels of NOS3 mRNA stabilized at 18 hr, with a more than 4-fold change in expression (Fig. 2). No change in NOS mRNA was noted in unstimulated HMC1 at similar time-points. Stimulation with PMA did not up-regulate NOS expression. Furthermore, NOS2 mRNA was not detected (data not shown).

Figure 2.

Figure 2

Open in a new tab

Interferon (IFN)-γ regulation of nitric oxide synthase (NOS) mRNA expression in the human mast cell line HMC1. Relative mRNA levels for NOS1, NOS2 and NOS3 were determined by real-time polymerase chain reaction (PCR) in HMC1 cultured with 200 U/ml IFN-γ for 0, 6 and 18 hr. Error bars represent the standard error of the mean (SEM) from three separate experiments. *P < 0·05 compared with the control; **P < 0·05 compared with IFN-γ at 6 hr. ND, not detected.

NOS protein expression

To evaluate the effects of IFN-γ on NOS protein expression, western blot analysis was employed on cell extracts from HMC1. Unstimulated HMC1 constitutively produced NOS1 (155 kDa) and NOS3 (135 kDa) (Fig. 3). Treatment with IFN-γ (200 U/ml) produced an increase in NOS3 protein expression, with maximal stimulation at 18 hr. Interestingly, there was little increase in NOS1 expression (Fig. 3). Untreated HMC1 cultured for the same time showed no increase in NOS protein expression, nor was NOS2 protein detected (data not shown).

Figure 3.

Figure 3

Open in a new tab

Interferon (IFN)-γ regulation of nitric oxide synthase (NOS) protein expression in the human mast cell line HMC1. Western blot analysis was performed using anti-NOS1 and NOS3 antibody with 15 µg of protein from whole cell lysates obtained from HMC1 treated with IFN-γ (200 U/ml) for the indicated times. Results are representative of three separate experiments.

NOS activity and NO formation in HMC1

We next investigated NOS activity in HMC1 homogenates using the citrulline assay. As we have previously shown,15 HMC1 extracts showed significant citrulline generation (54·3 ± 6·0 pmol/min/mg) attributable to constitutive NOS (NOS1 and/or NOS3) but not NOS2 activity, as chelation of Ca2+ from the reaction mixture abrogated citrulline formation (7·4 ± 5·1 pmol/min/mg) (Fig. 4). HMC1 treated for 6 or 18 hr with IFN-γ (200 U/ml) showed a significant (P < 0·05) up-regulation of cNOS activity (70·1 ± 6·9 pmol/min/mg) (Fig. 4). Rat brain homogenates were run concurrently as a positive control.

Figure 4.

Figure 4

Open in a new tab

Nitric oxide synthase (NOS) activity in the human mast cell line HMC1. NOS activity in untreated (0 hr) and interferon (IFN)-γ (6 or 18 hr)-stimulated HMC1 was measured using the citrulline assay. Positive (control) results were derived from rat brain homogenates. The results are expressed as picomoles l-citrulline formed per minute, per mg of protein. Data are shown as mean ± standard error of the mean (SEM) for three independent experiments. *P < 0·05 compared with unstimulated HMC1.

Regulation of IL-8 and CCL1 release by NO

To further evaluate the role of NO in IFN-γ-mediated chemokine release, HMC1 were pretreated with IFN-γ (18 hr) followed by either l-NAME (NOS inhibitor) or SNOG (NO donor) added 30 min prior to PMA stimulation (4 hr). SNOG significantly (P < 0·05) enhanced IFN-γ inhibition of chemokine release, while l-NAME removed the IFN-γ effect on PMA-induced chemokine release. Addition of l-NAME before PMA activation produced a moderate, but not significant enhancement of chemokine release. By contrast, treatment with the NO donor SNOG before PMA activation mimicked the IFN-γ effect (Fig. 5).

Figure 5.

Figure 5

Open in a new tab

Effect of nitric oxide synthase (NOS) inhibition and exogenous NO on interleukin (IL)-8 and CCL1 release in the human mast cell line HMC1. Concentrations of IL-8 and CCL1 in medium from HMC1 were determined by enzyme-linked immunosorbent assay (ELISA) [calculated as a percentage of phorbol 12-myristate 13-acetate (PMA)-stimulated cells; 100%]. Cells were incubated (18 hr) with interferon (IFN)-γ (200 U/ml) and a NOS inhibitor [NG-nitro-l-arginine methyl ester (l-NAME); 100 µm] or NO donor [S-nitrosoglutathione (SNOG); 100 µm] added 30 min before PMA (30 ng/ml) activation (4 hr). Results are expressed as mean ± standard error of the mean (SEM) for three independent experiments. *P < 0·05 by comparison with PMA-treated cells; †P < 0·05 compared with IFN-γ-treated cells.

Regulation of IL-8 and CCL1 mRNA expression by NO

To determine whether NO plays a role in the IFN-γ modulation of HMC1 chemokine expression at the transcriptional level, HMC1 cells were treated with IFN-γ (200 U/ml) for 18 hr, with the NOS inhibitor l-NAME (100 µm) or the NO donor SNOG (100 µm) added 30 min before PMA activation. Total RNA was isolated and analysed for IL-8 and CCL1 expression by real-time PCR (Fig. 6). HMC1 treated with both IFN-γ and l-NAME before PMA stimulation did not exhibit the inhibitory effect on either IL-8 or CCL1 of IFN-γ alone, while the addition of SNOG with IFN-γ potentiated the inhibitory effect on PMA-induced chemokine release. Addition of l-NAME before PMA activation produced a significant enhancement of IL-8 but not CCL1 expression. Similar to the results obtained with ELISA, treatment with the NO donor SNOG before PMA activation mimicked the IFN-γ effect (Fig. 6).

Figure 6.

Figure 6

Open in a new tab

Interleukin (IL)-8/CCL1 mRNA regulation by interferon (IFN)-γ and nitric oxide (NO). Relative mRNA expression for IL-8 and CCL1 from the human mast cell line HMC1 was determined by real-time polymerase chain reaction (PCR) [calculated as a percentage of phorbol 12-myristate 13-acetate (PMA)-activated cells (100%), with GAPDH expression as the internal standard]. Cells were incubated (18 hr) with IFN-γ (200 U/ml) and a nitric oxide synthase (NOS) inhibitor [NG-nitro-l-arginine methyl ester (l-NAME); 100 µm] or NO donor [S-nitrosoglutathione (SNOG); 100 µm] added 30 min before PMA (30 ng/ml) activation (4 hr). Results are expressed as mean ± standard error of the mean (SEM) for three independent experiments. *P < 0·05 by comparison with PMA-treated cells; †P < 0·05 compared with IFN-γ treated cells.

Regulation of MC transcription factor activity

We determined the effects of IFN-γ on transcription factor binding activity in PMA-activated HMC1. PMA activation resulted in significant induction of nuclear factor (NF)-κB (p65), Jun and CREB, but not ATF2 or p50 (data not shown). Pretreatment with IFN-γ resulted in significant inhibition of CREB binding, and partial, but not significant, inhibition of Jun binding activity (Fig. 7). Co-treatment of HMC1 with l-NAME significantly reversed the IFN-γ-induced inhibition of CREB binding (Fig. 7).

Figure 7.

Figure 7

Open in a new tab

Regulation of mast cell transcription factor (TF) activation by interferon (IFN)-γ and nitric oxide (NO). Cells of the human mast cell line HMC1 were incubated (18 hr) with IFN-γ (200 U/ml), with a nitric oxide synthase (NOS) inhibitor [NG-nitro-l-arginine methyl ester (l-NAME); 100 µm] added 30 min before phorbol 12-myristate 13-acetate (PMA; 30 ng/ml) activation (4 hr). Nuclear proteins were extracted and 15 µg was assayed for binding activity. Results are expressed as mean ± standard error of the mean (SEM) for three independent experiments. *P < 0·05 by comparison with untreated cells; †P < 0·05 compared with PMA-treated cells; ‡P < 0·05 compared with IFN-γ-treated cells.

Effects of IFN-γ on MC signalling events

Potential regulatory mechanisms for the IFN-γ/NO pathway were then investigated. HMC1 cells were treated with IFN-γ (200 U/ml for 18 hr) and then stimulated with PMA in the presence or absence of l-NAME. We examined levels of phosphorylated proteins at 0, 5, 30 and 60 min time-points. HMC1 showed similar levels and temporal patterns of phosphorylation for p38, ERK and JNK (data not shown). As expected, levels of phosphorylated CREB were significantly decreased in IFN-γ-treated HMC1. This effect was partially reversed by addition of the NO inhibitor l-NAME. Cellular levels of total CREB protein remain unchanged (Fig. 8).

Figure 8.

Figure 8

Open in a new tab

Regulation of protein phosphorylation by interferon (IFN)-γ and nitric oxide (NO). (a) Cells of the human mast cell line HMC1 were incubated (18 hr) with IFN-γ (200 U/ml), and a nitric oxide synthase (NOS) inhibitor [NG-nitro-l-arginine methyl ester (l-NAME); 100 µm] was added 30 min before phorbol 12-myristate 13-acetate (PMA; 30 ng/ml) activation. Proteins were then extracted and analysed by western blot as described in the ‘Materials and methods’. (b) Densitometry summary of data in (a). *P < 0·05 by comparison with PMA-treated cells; ‡P < 0·05 compared with IFN-γ-treated cells. All blots are representative of three independent experiments.

Discussion

IFN-γ is a multifunctional cytokine with pleiotropic effects on various aspects of immune cell function.10 In rodent MCs, IFN-γ up-regulates expression of NOS2 with a concordant increase in NO formation, which inhibits MC mediator secretion and adhesion.5,6 NO formed in this fashion acts as a downstream effector of IFN-γ. The role of IFN-γ in human MCs is, however, less well defined, with often contradictory effects of the cytokine on MC responses and phenotype.17,7

Previously, in rat MCs we showed that IFN-γ up-regulated NOS2 mRNA and protein, but had no effect on NOS3 expression.13 To our knowledge this is the first study to show that IFN-γ alone up-regulates mRNA for both constitutive NOS (NOS1 and NOS3) isoforms in a human MC line. Previous studies in astrocytes showed that treatment with a mix of IL-12b, tumour necrosis factor (TNF) and IFN-γ up-regulated NOS3 expression, although NOS1 was not investigated.18 Conversely, IFN-γ has been shown to down-regulate NOS3 expression in endothelial cells.19 The NOS3 promoter sequence is complex, with binding sites for numerous common transcription elements including NF-κB and activator protein 1 (AP1), and studies show that NOS3 can be modulated by numerous stimuli.20 However, the promoter region is also subject to multiple positive and negative transcription signals, including epigenetic influences at the level of histone modifications.21 Indeed, NOS3 regulation is hypothesized to be complex and cell type specific, as the above studies have shown.20 The fact that NOS1 mRNA levels were increased in our study, while protein levels remained stable, indicates that NOS1 regulation may take place at both transcriptional and translational levels.

The lack of NOS2 expression is HMC1 is surprising, given that IFN-γ is a potent inducer of NOS2 in many rodent cell populations. In support of these findings, Swindle et al. have also convincingly shown that human MC populations do not produce detectable NOS2 protein.22 However, the absence of NOS2 expression has been noted in studies from other human cell types, including monocytes, macrophages and neutrophils, even when activated with known NOS2 inducers.23 However, NOS2 expression has now been noted in various cell types when isolated from patients with various diseases.24 Nevertheless, success in reproducing this in vivo effect in vitro has remained elusive and the necessary conditions to stimulate NO production remain incompletely characterized. Thus, it remains a possibility that, under appropriate conditions of stimulation, NOS2 expression may also be induced in human MCs.

Chemokines are a family of structurally related chemoattractant cytokines that play a central role in inflammation.10 In previous human MC studies, IL-8 and CCL1 expression and release were up-regulated after activation.16,25 As MCs are strategically located next to vessels and epithelial surfaces, such release after activation may account for the cellular influx of lymphocytes, neutrophils and eosinophils into the asthmatic lung.5 Indeed, recent in vivo studies in both humans and rodents have shown that CCL1 is an important mediator of the attraction of eosinophils in asthmatic inflammation.26 Given that endogenous NO has been shown to regulate chemokine expression in other cell types,27 and that NO formed in inflammatory conditions such as asthma may be a key element in determining the cellular influx seen in this disease,28 our findings that IFN-γ-treated human MCs up-regulate NOS3, resulting in decreased chemokine release, suggests a critical role for IFN-γ in determining the long-term environmental phenotype of MCs in certain disease states.

Previous studies in effector T cells indicated that IFN-α inhibited CCL1 expression and release, although the role of NO was not investigated.29 As human NOS3 has γ-activated sequences (GAS) in its promotor region and both type I (α/β) and type II (γ) interferon signalling pathways converge at signal transducer and activator of transcription 1 (STAT1) downstream of their respective receptors, NO-dependent IFN effects may be a common mechanism for the control of chemokine expression in immune cells. Indeed, our understanding of the role of NOS3 in regulating immune responses is evolving and recent studies show that NOS3 is necessary for propagating macrophage responsiveness.30 Moreover, a unique role for NOS1 has been identified in a mouse model of asthma.31 As production of NOS2 has not yet been confirmed in human MC populations, further study of NOS1/NOS3 signalling pathways may be of clinical interest.

In this study we showed that inhibition of endogenous NO production in HMC1 with l-NAME removed the IFN-γ-induced down-regulation of mRNA for IL-8 and CCL1. In other cell types, NO can regulate gene expression through modulating transcription factor activity.29 In this study, we provide further evidence of a transcriptional mechanism for these findings by demonstrating IFN-γ inhibition of CREB phosphorylation with an associated defect in CREB DNA binding. Although CREB plays an important role in diverse cellular functions and has been extensively studied, limited information is available regarding its role in MC function. IFN-γ-mediated inhibition of CREB phosphorylation suggests that a signalling pathway leading to CREB activation may be impaired. However, investigation of several key activation pathways known to impinge on CREB (ERK, p38 and JNK) showed no differences in levels of phosphorylation. Studies in neurotropin signalling have previously described inhibition of CREB binding through NOS activity, although, again, ERK and JNK signalling pathways were unaffected.32 However, this previous study did not address the potential role of mitogen activated protein kinase (MAPK) phosphatase activity. Indeed, MAP kinase-specific phosphatase 1 (MKP1) has recently been shown to directly modulate CREB phosphorylation and activity in mouse embryonic fibroblasts, and thus offers a new potential area of study for IFN-γ regulation.33

A role for NO in transcriptional regulation of MC cytokine production has previously been described. Using various exogenous sources of NO, Davis et al. showed that the transcription factors Fos and Jun are key NO targets in antigen-driven MC responses.34 Although some inhibition was seen, our studies failed to show similar significant effects on Fos binding activity, although we did not investigate other AP1 family members. Macphail et al. showed that NO had no effect on chemokine expression in peripheral blood mononuclear cells (PBMC), while several other papers have noted an increase in IL-8 expression.35 Clearly, the nature of the model system and the source of NO have a significant impact on biological outcomes.

While NO is known as an important regulator of MC phenotype and function, controversy remains concerning MC production of endogenous NO. Swindle et al. have recently shown no detectable NO in mouse, rat and human MCs in a flow cytometric assay employing the NO-specific fluorescent probe diaminofluorescein (DAF).22 However, our group and others have consistently shown that a variety of murine and human MC populations, including cell lines, tissue sections and ex vivo-derived MCs from the rat peritoneum or human skin,13–15,36 express NOS mRNA and protein in addition to functional NO. As MCs produce relatively little NO compared with macrophages, some of the differences noted among the studies may be dependent on the sensitivity of the specific assay used for the detection of NO. With this in mind, our group and others have employed multiple assay systems to detect NO (or NOS activity) in MC populations, including the relatively insensitive Griess assay (which detects nitrite levels as a surrogate for NO), as well as the exquisitely sensitive citrulline assay or real-time confocal analysis with DAF.13–15 While it is agreed that the levels of NO detected in MCs are low, they are comparable with levels produced by other cell types, including vascular endothelium, in which these low NO levels still exert significant biological regulation.19 This control arises from both the temporal kinetics and site-specific production of this highly reactive radical.

We have previously shown, using live-cell confocal microscopy, that HMC1 cells endogenously produce NO following PMA activation in both cytoplasmic and nuclear sites, probably through the activity of NOS3.15 Thus, endogenously derived NO may have effects on both gene expression and mediator release as a result of this pattern of subcellular targeting, effects that may be quite distinct from that seen with NO donors. Such differences in effect have been noted in other studies of NO and chemokine expression,37 and stress the importance of the source of NO for observed outcomes in cellular responses. Indeed, recent studies have shown a role for nuclear NOS3 in regulating NOS2 expression in rat hepatocytes.38

It has previously been shown that NO can moderate MC mediator secretion (degranulation) and MC leukotriene production,15 and now we have presented evidence that human MC-derived NO is up-regulated by IFN-γ treatment and moderates chemokine expression and release. Thus, NO appears to be a critical player in orchestrating MC responses and phenotype. Further study of MC NO-mediated effects may yield new pharmacological tools with which to treat MC-associated diseases such as asthma.

Acknowledgments

MG is a recipient of a Fellowship from the Alberta Heritage Foundation for Medical Research. ADB is the AstraZeneca Canada Inc. Chair in Asthma Research. This work was funded by a grant from the Canadian Institutes of Health Research.

References

  • 1.Gurish MF, Austen KF. The diverse roles of mast cells. J Exp Med. 2001;194:F1–5. doi: 10.1084/jem.194.1.f1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wedemeyer J, Tsai M, Galli SJ. Roles of mast cells and basophils in innate and acquired immunity. Curr Opin Immunol. 2000;12:624–31. doi: 10.1016/s0952-7915(00)00154-0. [DOI] [PubMed] [Google Scholar]
  • 3.Brightling CE, Bradding P, Pavord ID, Wardlaw AJ. New insights into the role of the mast cell in asthma. Clin Exp Allergy. 2003;33:550–6. doi: 10.1046/j.1365-2222.2003.01636.x. [DOI] [PubMed] [Google Scholar]
  • 4.Schoeler D, Grutzkau A, Henz BM, Kuchler J, Kruger-Krasagakis S. Interleukin-6 enhances whereas tumor necrosis factor alpha and interferons inhibit integrin expression and adhesion of human mast cells to extracellular matrix proteins. J Invest Dermatol. 2003;120:795–801. doi: 10.1046/j.1523-1747.2003.12126.x. [DOI] [PubMed] [Google Scholar]
  • 5.Wills FL, Gilchrist M, Befus AD. Interferon-gamma regulates the interaction of RBL-2H3 cells with fibronectin through production of nitric oxide. Immunology. 1999;97:481–9. doi: 10.1046/j.1365-2567.1999.00790.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Eastmond NC, Banks EM, Coleman JW. Nitric oxide inhibits IgE-mediated degranulation of mast cells and is the principal intermediate in IFN-gamma-induced suppression of exocytosis. J Immunol. 1997;159:1444–50. [PubMed] [Google Scholar]
  • 7.Yanagida M, Fukamachi H, Takei M, et al. Interferon-gamma promotes the survival and Fc epsilon RI-mediated histamine release in cultured human mast cells. Immunology. 1996;89:547–52. doi: 10.1046/j.1365-2567.1996.d01-768.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Okayama Y, Kirshenbaum AS, Metcalfe DD. Expression of a functional high-affinity IgG receptor, Fc gamma RI, on human mast cells: Up-regulation by IFN-gamma. J Immunol. 2000;164:4332–9. doi: 10.4049/jimmunol.164.8.4332. [DOI] [PubMed] [Google Scholar]
  • 9.Salvi SS, Babu KS, Holgate ST. Is asthma really due to a polarized T cell response toward a helper T cell type 2 phenotype? Am J Respir Crit Care Med. 2001;164:1343–6. doi: 10.1164/ajrccm.164.8.2103080. [DOI] [PubMed] [Google Scholar]
  • 10.Panina-Bordignon P, Papi A, Mariani M, et al. The C-C chemokine receptors CCR4 and CCR8 identify airway T cells of allergen-challenged atopic asthmatics. J Clin Invest. 2001;107:1357–64. doi: 10.1172/JCI12655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Shtrichman R, Samuel CE. The role of gamma interferon in antimicrobial immunity. Curr Opin Microbiol. 2001;4:251–9. doi: 10.1016/s1369-5274(00)00199-5. [DOI] [PubMed] [Google Scholar]
  • 12.Alderton WK, Cooper CE, Knowles RG. Nitric oxide synthases: structure, function and inhibition. Biochem J. 2001;357:593–615. doi: 10.1042/0264-6021:3570593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gilchrist M, Savoie M, Nohara O, Wills FL, Wallace JL, Befus AD. Nitric oxide synthase and nitric oxide production in in vivo-derived mast cells. J Leukoc Biol. 2002;71:618–24. [PubMed] [Google Scholar]
  • 14.Kashiwagi S, Kajimura M, Yoshimura Y, Suematsu M. Nonendothelial source of nitric oxide in arterioles but not in venules: alternative source revealed in vivo by diaminofluorescein microfluorography. Circ Res. 2002;91:e55–64. doi: 10.1161/01.res.0000047529.26278.4d. [DOI] [PubMed] [Google Scholar]
  • 15.Gilchrist M, McCauley SD, Befus AD. Expression, localization, and regulation of NOS in human mast cell lines: effects on leukotriene production. Blood. 2004;104:462–9. doi: 10.1182/blood-2003-08-2990. [DOI] [PubMed] [Google Scholar]
  • 16.Selvan RS, Butterfield JH, Krangel MS. Expression of multiple chemokine genes by a human mast cell leukemia. J Biol Chem. 1994;269:13893–8. [PubMed] [Google Scholar]
  • 17.Mann-Chandler MN, Kashyap M, Wright HV, et al. IFN-gamma induces apoptosis in developing mast cells. J Immunol. 2005;175:3000–5. doi: 10.4049/jimmunol.175.5.3000. [DOI] [PubMed] [Google Scholar]
  • 18.Barna M, Komatsu T, Reiss CS. Activation of type III nitric oxide synthase in astrocytes following a neurotropic viral infection. Virology. 1996;223:331–43. doi: 10.1006/viro.1996.0484. [DOI] [PubMed] [Google Scholar]
  • 19.Wagner AH, Schwabe O, Hecker M. Atorvastatin inhibition of cytokine-inducible nitric oxide synthase expression in native endothelial cells in situ. Br J Pharmacol. 2002;136:143–9. doi: 10.1038/sj.bjp.0704678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Fleming I, Busse R. Molecular mechanisms involved in the regulation of the endothelial nitric oxide synthase. Am J Physiol Regul Integr Comp Physiol. 2003;284:R1–12. doi: 10.1152/ajpregu.00323.2002. [DOI] [PubMed] [Google Scholar]
  • 21.Fish JE, Matouk CC, Rachlis A, et al. The expression of endothelial nitric-oxide synthase is controlled by a cell-specific histone code. J Biol Chem. 2005;280:24824–38. doi: 10.1074/jbc.M502115200. [DOI] [PubMed] [Google Scholar]
  • 22.Swindle EJ, Metcalfe DD, Coleman JW. Rodent and human mast cells produce functionally significant intracellular reactive oxygen species but not nitric oxide. J Biol Chem. 2004;279:48751–9. doi: 10.1074/jbc.M409738200. [DOI] [PubMed] [Google Scholar]
  • 23.Weinberg JB, Misukonis MA, Shami PJ, et al. Human mononuclear phagocyte inducible nitric oxide synthase (iNOS): analysis of iNOS mRNA, iNOS protein, biopterin, and nitric oxide production by blood monocytes and peritoneal macrophages. Blood. 1995;86:1184–95. [PubMed] [Google Scholar]
  • 24.Fang FC, Vazquez-Torres A. Nitric oxide production by human macrophages: there's NO doubt about it. Am J Physiol Lung Cell Mol Physiol. 2002;282:L941–3. doi: 10.1152/ajplung.00017.2002. [DOI] [PubMed] [Google Scholar]
  • 25.Gilchrest H, Cheewatrakoolpong B, Billah M, Egan RW, Anthes JC, Greenfeder S. Human cord blood-derived mast cells synthesize and release I-309 in response to IgE. Life Sci. 2003;73:2571–81. doi: 10.1016/s0024-3205(03)00607-6. [DOI] [PubMed] [Google Scholar]
  • 26.Bishop B, Lloyd CM. CC chemokine ligand 1 promotes recruitment of eosinophils but not Th2 cells during the development of allergic airways disease. J Immunol. 2003;170:4810–7. doi: 10.4049/jimmunol.170.9.4810. [DOI] [PubMed] [Google Scholar]
  • 27.Muhl H, Dinarello CA. Macrophage inflammatory protein-1 alpha production in lipopolysaccharide-stimulated human adherent blood mononuclear cells is inhibited by the nitric oxide synthase inhibitor N (G)-monomethyl-L-arginine. J Immunol. 1997;159:5063–9. [PubMed] [Google Scholar]
  • 28.Thomassen MJ, Raychaudhuri B, Dweik RA, et al. Nitric oxide regulation of asthmatic airway inflammation with segmental allergen challenge. J Allergy Clin Immunol. 1999;104:1174–82. doi: 10.1016/s0091-6749(99)70010-2. [DOI] [PubMed] [Google Scholar]
  • 29.Natarajan R, Gupta S, Fisher BJ, Ghosh S, Fowler AA., III Nitric oxide suppresses IL-8 transcription by inhibiting c-Jun N-terminal kinase-induced AP-1 activation. Exp Cell Res. 2001;266:203–12. doi: 10.1006/excr.2001.5218. [DOI] [PubMed] [Google Scholar]
  • 30.Connelly L, Jacobs AT, Palacios-Callender M, Moncada S, Hobbs AJ. Macrophage endothelial nitric-oxide synthase autoregulates cellular activation and pro-inflammatory protein expression. J Biol Chem. 2003;278:26480–7. doi: 10.1074/jbc.M302238200. [DOI] [PubMed] [Google Scholar]
  • 31.De Sanctis GT, MacLean JA, Hamada K, et al. Contribution of nitric oxide synthases 1, 2, and 3 to airway hyperresponsiveness and inflammation in a murine model of asthma. J Exp Med. 1999;189:1621–30. doi: 10.1084/jem.189.10.1621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Riccio A, Alvania RS, Lonze BE, et al. A nitric oxide signaling pathway controls CREB-mediated gene expression in neurons. Mol Cell. 2006;21:283–94. doi: 10.1016/j.molcel.2005.12.006. [DOI] [PubMed] [Google Scholar]
  • 33.Wu JJ, Bennett AM. Essential role for mitogen-activated protein (MAP) kinase phosphatase-1 in stress-responsive MAP kinase and cell survival signaling. J Biol Chem. 2005;280:16461–6. doi: 10.1074/jbc.M501762200. [DOI] [PubMed] [Google Scholar]
  • 34.Davis BJ, Flanagan BF, Gilfillan AM, Metcalfe DD, Coleman JW. Nitric oxide inhibits IgE-dependent cytokine production and fos and jun activation in mast cells. J Immunol. 2004;173:6914–20. doi: 10.4049/jimmunol.173.11.6914. [DOI] [PubMed] [Google Scholar]
  • 35.Macphail SE, Gibney CA, Brooks BM, Booth CG, Flanagan BF, Coleman JW. Nitric oxide regulation of human peripheral blood mononuclear cells: critical time dependence and selectivity for cytokine versus chemokine expression. J Immunol. 2003;171:4809–15. doi: 10.4049/jimmunol.171.9.4809. [DOI] [PubMed] [Google Scholar]
  • 36.Bacci S, Rucci L, Riccardi-Arbi R, Borghi-Cirri MB. Colocalization of tumor necrosis factor-alpha and nitric oxide-synthase immunoreactivity in mast cell granules of nasal mucosa. Histol Histopathol. 1998;13:1011–4. doi: 10.14670/HH-13.1011. [DOI] [PubMed] [Google Scholar]
  • 37.Guo HT, Cai CQ, Schroeder RA, Kuo PC. Nitric oxide is necessary for CC-class chemokine expression in endotoxin-stimulated ANA-1 murine macrophages. Immunol Lett. 2002;80:21–6. doi: 10.1016/s0165-2478(01)00284-x. [DOI] [PubMed] [Google Scholar]
  • 38.Gobeil F, Jr, Zhu T, Brault S, et al. Nitric oxide signaling via nuclearized endothelial nitric-oxide synthase modulates expression of the immediate early genes iNOS and mPGES-1. J Biol Chem. 2006;281:16058–67. doi: 10.1074/jbc.M602219200. [DOI] [PubMed] [Google Scholar]

Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES