A Novel Trafficking Signal within the HLA-C Cytoplasmic Tail Allows Regulated Expression Upon Differentiation of Macrophages

Abstract

Major histocompatibility complex class I molecules (MHC-I) present peptides to cytotoxic T lymphocytes (CTLs). In addition, HLA-C allotypes are recognized by killer cell Ig-like receptors (KIR) found on natural killer (NK) cells and effector CTLs. Compared to other classical MHC-I allotypes, HLA-C has low cell surface expression and an altered intracellular trafficking pattern. We present evidence that this results from effects of both the extracellular domain and the cytoplasmic tail. Notably, we demonstrate that the cytoplasmic tail contains a dihydrophobic (LI) internalization and lysosomal targeting signal that is partially attenuated by an aspartic acid residue (DXSLI). In addition, we provide evidence that this signal is specifically inhibited by hypophosphorylation of the adjacent serine residue upon macrophage differentiation and that this allows high HLA-C expression in this cell type. We propose that tightly regulated HLA-C surface expression facilitates immune surveillance and allows HLA-C to serve a specialized role in macrophages.

Introduction

Major histocompatibility complex class I molecules (MHC-I) are necessary for presentation of antigens to naïve CD8⁺ cytotoxic T lymphocytes (CTLs) through engagement with the T cell receptor and CD8. There is evidence that professional antigen presenting cells (APCs) are required for this step, as they have unique co-stimulatory molecules needed for this process (1). APCs are thought to activate naïve CD8⁺ T cells by internalizing exogenous antigens and presenting them in association with MHC-I in a process known as cross-presentation (2). Activated CTLs then mature into effector cells, which have the capacity to kill cells bearing foreign epitopes through the release of perforin, granzymes and via the activation of apoptotic pathways (3).

MHC-I can also be recognized by MHC class I-specific inhibitory receptors, such as killer cell Ig-like receptors (KIR) (4). These receptors are classically thought to be expressed on natural killer (NK) cells to facilitate the eradication of virally infected or tumorigenic cells that have downmodulated MHC-I. More recently, evidence has been accumulating that these receptors are also up-regulated with the acquisition of cytotoxic function in CD8⁺ T cells (5). In this case they may serve as an important negative feedback mechanism that aids in the prevention of autologous damage by raising the threshold for cell lysis (5).

There are three major sub-types of classical MHC-I molecules that serve these roles. HLA-A, B and C all have the capacity to present viral antigens to CTLs. Additionally, almost all HLA-C molecules are recognized by KIRs. Perhaps because of the crucial role of HLA-C as an inhibitory molecule capable of sending a dominant negative signal (6), HLA-C is normally expressed at low levels at the cell surface. HLA-C heavy chain mRNA is unstable (7), the HLA-C heavy chain protein is not stably expressed at the cell surface, and it does not associate efficiently with the MHC-I light chain (β2-microglobulin) (8-10). Additionally, HLA-C presents a more restricted repertoire of peptides causing it to be retained in the endoplasmic reticulum (ER) in complex with the transporter associated with antigen processing (TAP), which is responsible for transporting peptides into the ER for MHC-I loading. The retained HLA-C is then eventually degraded in the ER (8). The addition of HLA-C specific peptides has been shown to release HLA-C from TAP in vitro (8) and to increase the cell surface expression of HLA-C (11).

We examined the expression of HLA-Cw*0401 relative to HLA-A*0201 in a variety of cell types, including T cell lines, primary T cells and monocytic cell lines and confirmed that HLA-Cw*0401 was poorly expressed on the cell surface relative to HLA-A*0201. To better understand the amino acid sequences governing HLA-C surface expression, we examined the intracellular trafficking of chimeric molecules that contained the HLA-A*0201 extracellular domain and the HLA-C cytoplasmic tail (A2/C) or the HLA-Cw*0401 extracellular domain and the HLA-A cytoplasmic tail (Cw4/A). Not surprisingly, the extracellular domain of HLA-C was responsible for promoting retention in the ER. Remarkably, however, the cytoplasmic tail also had an effect on cell surface expression by increasing internalization at the cell surface and targeting the molecules for degradation in acidic organelles. Mutagenesis studies revealed that aspartic acid at position 333, serine at position 335 and isoleucine at position 337 were key amino acids that affected the activity of this motif. Finally, we found that the complex regulation of HLA-C surface expression allowed the specific upregulation of HLA-C upon differentiation of primary monocytes and monocytic cell lines into macrophage-like cells. The specific induction of HLA-C expression with differentiation strongly suggests that there is a unique role for HLA-C in antigen presenting cells. We propose that inhibitory signals sent via HLA-C play a role in downmodulating the normal CD8⁺ cellular immune response and/or that it functions to specifically limit the lysis of APCs that are cross-presenting antigen.

Materials and Methods

DNA constructs

MSCV 2.1 HA-HLA-A*0201 was constructed as previously described (12). For MSCV 2.1 HA-HLA-Cw*0401, the HLA-Cw*0401 open reading frame (Peter Parham, Stanford University) was amplified with the following primers, 5’-CAATCTCCCCAGACGCCGAGATGCG-3’ and 5’-CCGCTCGAGTCAGGCTTTACAAGCGATGAGAGA-3’. The PCR product was digested with Nae I and Xho I and the 3’ fragment was gel purified. This fragment was then ligated to the 5’ leader sequence plus the HA tag from HA-HLA-A*0201 (isolated by digesting MSCV 2.1 HA-HLA-A*0201 with Eco RI and Nae I) and MSCV 2.1 digested with Eco RI and Xho I.

MSCV 2.1 HA-Cw4/A2 was constructed by digesting MSCV 2.1 HA-HLA- Cw*0401 with Eco RI and Xho I, sub-cloning this fragment into the same sites in Litmus 29 to generate Litmus 29 HLA-Cw*0401. A three-way ligation was then performed with a Eco RI to Sap I fragment from Litmus 29 HLA-Cw*0401 that encodes the extracellular domain of HLA-Cw*0401, a DNA fragment encoding the HLA-A*0201 cytoplasmic tail digested with Sap I and Xho I (generated by PCR amplification of MSCV 2.1 HA-HLA-A*0201 with the following primers 5’-GTGATCACTGGAGCTGTGGTCGCTGCT-3’ and 5’-CCGCTCGAGTCACACTTTACAAGCTGTGAGAGACAC-3’), and MSCV 2.1 digested with Xho I and Eco RI.

MSCV A2/C was constructed by first PCR amplifying the Cw*0401 cytoplasmic tail using the following primers 5’-CAGGTGACCGGTGCTGTGGTCGCTGCTGTGATGTGGAGGAGGAAGAGCTCAGGTGGA-3’ and 5’-CACCTGCAGCTGTCAGGCTTTACAAGCGATGAG-3’ and then digesting with Age I. This fragment was then ligated into pcDNA3.1 HLA-A*0201 Age I (a plasmid containing an HLA-A*0201 open reading frame with a silent sequence change to introduce an Age I site (13)) digested with Age I and Eco RV to generate pcDNA3.1 A2/Cw4. A DNA fragment encoding part of the HLA-A*0201 extracellular domain and the HLA-Cw*0401 cytoplasmic tail was isolated by digesting pcDNA3.1 A2/Cw4 with Pml I and Eco RV. This fragment was then ligated into MSCV2.1 HA-HLA-A*0201 digested with Pml I and Hpa I.

pcDNA3.1 (+) IRES GFP was generated by isolating the IRES GFP cassette from MSCV IRES GFP (14) digested with Xho I and Sal I. This cassette was then ligated into pcDNA3.1(+) digested with Xho I. pcDNA3.1(+) HA-HLA-A*0201 IRES GFP and pcDNA3.1(+) HA-HLA-Cw*0401 were generated by isolating HA-HLA-A*0201 or HA-HLA-Cw*0401 from MSCV 2.1 HA-HLA-A*0201 or MSCV2.1 HA-HLA-Cw*0401 as follows: MSCV 2.1 HA-HLA-A*0201 or MSCV 2.1 HA-HLA-Cw*0401 were digested with Eco RI, filled in using Klenow, and then digested with Xho I. These fragments were then ligated into pcDNA3.1(+) IRES GFP digested with Eco RV and Xho I.

The MSCV 2.1 HA-A2/Cw4 point mutations N₃₂₇D, E₃₃₄V, I₃₃₇T, D₃₃₃A, SSAA, S₃₃₅E and MSCV 2.1 HA-A*0201 T₃₃₇I were introduced using PCR. The 5’ primer for all the constructs was 5’-CGACCGCCTCGATCCTCC-3’. The 3’ primers used are as follows: N₃₂₇D 5’-CCGCTCGAGTCAGGCTTACAAGCGATGAGAGACTCATCAGAGCCCTGGGCACTGTCGCTGGACGC-3’, E₃₃₄V 5’-CCGCTCGAGTCAGGCTTTACA AGCGATGAGAGATACATCAGAGCCCTG-3’, I₃₃₇T 5’-CGGCTCGAGCTGTCAGGCTTTACAA GCTGTGAGAGACTC-3’, D₃₃₃A 5 ’ -GCCCTCGAGTCAGGCTTTACAAGCGATGAGAGACTCTGCAGAGCCCTGGGCACTGTTGCTGGA -3’, SSAA 5’-CCGCTCGAGCGGTCAGGCTT TACAAGCGATGAGTGCCTCATCTGCGCC-3’ and S₃₃₅E 5’-CCGCTCGAGCG GTCAGGCTTTACAAGCGATGAGCTCCT CATCAGA-3’. The template for all the PCR reactions was MSCV 2.1 HA-A2/Cw4. The resulting PCR product was digested with EcoR I and Xho I and ligated into MSCV 2.1 digested with the same enzymes. The C320Y point mutation was generated using a two round PCR mutagenesis approach. The first round PCR consisted of two reactions; reaction 1 contained the primers 5’-C G A C C G C C T C G A T C C T C C -3’ and 5’-AGCCTGAGAGTAGCTCCCTCC-3’, and reaction 2 contained the primers 5’-GGAGGGAGCTACTCTCAGGCT-3’ and 5’-CCGCTCGAGTCAGGGTTTACAAGCGATGAGAGA-3’. The template for both reactions was MSCV 2.1 HA-A2/Cw4. The second round PCR reaction contained primers 5’-C G A C C G C C T C G A T C C T C C -3’ and 5’-CCGCTCGAGTCAGGGTTTACAAGCGATGAGAGA-3’. The template for this reaction was one microliter from each of the round one PCR reactions. The resulting PCR product was digested with Eco RI and Xho I and ligated into MSCV 2.1 digested with the same enzymes.

Cell lines

THP-1 and U937 macrophage cell lines were obtained from the ATCC. THP-1 cells were cultured in RPMI 1640 supplemented with 2 mM L-glutamine, 10 mM HEPES, 1 mM sodium pyruvate, 4.5 g/L glucose, 1.5 g/L sodium bicarbonate, 10% fetal bovine serum, 0.05 mM beta-mercaptoethanol, and 2mM penicillin, streptomycin and glutamine. U937 and CEM cells were cultured with RPMI 1640 supplemented with 10% fetal bovine serum, 10 mM HEPES, and 2 mM penicillin, streptomycin and glutamine (R10). Cell lines expressing various MHC-I molecules were generated using murine retroviral vectors as previously described (15, 16) except that they were pseudotyped with pCMV VSV-G (Dr. Nancy Hopkins, MIT). 1× 10⁶ cells were spin infected with the retroviral supernatants by centrifuging at 2500 RPM in a table top centrifuge for two hours with 8μg/ml polybrene. The cells were then selected with neomycin (1mg/ml).

PBMC isolation and electroporation

Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats provided by the Lansing Red Cross by Ficoll-Hypaque centrifugation. Following isolation they were stimulated with 10μg/ml PHA (Sigma); 24 hours later interleukin (IL)-2 was added at 50 units/ml, and fresh IL-2 was added after 3 days. Five days after isolation, 5 × 10⁶ stimulated PBMCs were electroporated using the Amaxa Nucleofector system. Electroporations were performed according to the manufacturer’s protocol except that following electroporation the cells were place in 500μl of media in 1.5ml eppendorf tubes and incubated for 10 minutes at 37°C before being placed in a 12-well dish.

Macrophage Differentiation

Buffy coats provided by the New York Blood Center were purified by ficoll-hypaque centrifugation and CD14⁺ mononuclear cells were isolated using the EasySep Human CD14 positive selection kit (StemCell Technologies). Purity of the sorted CD14 positive cells was assessed by flow cytometry using FITC conjugated mouse anti-human CD14 antibody (clone M5E2, BD Pharmingen). To assess MHC-I expression levels, freshly purified, undifferentiated cells were pre-incubated with 10% Fc Block (Accurate) in FACS buffer (10mM HEPES, 2% fetal bovine serum, 1% human serum, 0.02% azide) for 20 min on ice and then stained with antibodies directed against HLA-A2 (BB7.2), HLA-C (L31, gift of Patrizio Giacomini, Regina Elena Cancer Institute, Italy), Bw4 (One Lambda) and Bw6 (One Lambda), depending on the donors MHC-I phenotype. The cells were also stained with matched, isotype control antibodies (protein A purified IgG2b for BB7.2, IgG1 ascities for L31 and IgM for anti-Bw4 and anti-Bw6). For staining with L31, a citrate-phosphate buffer (pH 3.0) was used to release β₂microglobulin and expose the epitope as described previously (17, 18). To induce maturation, the CD14⁺ cells were plated at 1×10⁶/ml in R10 plus GM-CSF for five days. The cells were then harvested and stained again with anti-MHC-I antibodies as described above.

For differentiation of monocytic cell lines, one million THP-1 or U937 cells were treated with lipopolysaccharide (LPS, 100 ng/mL for THP-1 and 10ng/ml for U937) solubilized in DMSO in 1 mL of media in a 24-well plate. Twenty-four hours later, another 1 mL of media was added containing phorbol-12-myristate-13-acetate (PMA, 200 ng/mL for THP-1 and 10ng/ml for U937) and LPS. After 72 hours at 37°C, cells were harvested by treatment with cell dissociation solution (Sigma) for 20 min at 37°C.

Western blot analysis

Cells were lysed in PBS 0.3% CHAPS, 0.1% SDS pH 8, 1mM PMSF. They were then normalized for total protein and separated by SDS-PAGE. Western blot analysis was performed with the following antibodies: HA (HA.11, Covance, 1:5,000), and rat anti-mouse-HRP (Zymed, 1:25,000).

Immunofluorescence microscopy

CEM T cells were prepared for immunofluorescence microscopy as previously described (12) except that they were permeabilized with 0.1% digitonin (Wako Chemicals USA) diluted in D-PBS with calcium and magnesium and blocked with equal parts wash buffer and F_c receptor blocker (Accurate Chemical and Scientific Corp). To identify cell surface staining (Figure 1G), concanavalin A conjugated to Alexa Flour 488 (Molecular Probes) was diluted to 40μg/ml and incubated with cells for 5 minutes on ice. To identify acidic compartments (Figure 4C), CEM cells were pre-treated with 100nm Bafilomycin A or DMSO for 4 hours at 37 degrees. Following treatment, CEM cells were adhered to glass slides, fixed, permeabilized, and stained for indirect immunofluorescence as previously described (19). MHC-I was visualized using BB7.2 (1:100), and Alexa Fluor 488 goat anti-mouse IgG_2b (1:250, Invitrogen). LAMP-1 was visualized using a anti-LAMP-1 antibody (clone H4A3, 1:500, BD Pharmingen) and Alexa Fluor 546 goat anti-mouse IgG₁ (1:250, Invitrogen). For identification of the endoplasmic reticulum (Figure 2C), HA-tagged molecules and KDEL were stained using mouse monoclonal antibodies (HA.11, 1:50, Covance, and anti-KDEL, 1:200, Stressgen, respectively) followed by staining with appropriate secondary antibodies (goat anti-mouse IgG₁ Alexa Fluor 488, and goat anti-mouse IgG_2a Alexa Fluor 546, 1:250, Molecular Probes). Images were collected using a Zeiss LSM 510 confocal microscope and processed with Adobe Photoshop software.

Microscopy Quantification

Microscopy images were quantified independently by two individuals who assessed the relative amount of co-localization and assigned a co-localization score between 0 and 3, where 3 was the maximal possible co-localization. For each condition, the samples were averaged and the percent maximum co-localization was determined by dividing each score by the highest score achieved.

Flow cytometry

Stains were performed as previously described (20) using an anti-HA antibody (HA.11, 1:50, Covance) or an anti-HLA-A2 antibody (BB7.2 (21)) and goat-anti-mouse-phycoerythrin (1:250, Biosource or Invitrogen). FACS analysis of the THP-1 and U937 cells was the same except the cells were incubated with Fc receptor blocker (Accurate Chemical and Scientific Corp.) for 20 min at 4°C prior to the anti-HA antibody incubation.

Transport, internalization and metabolic labeling assays

The transport and endocytosis assays were performed essentially as previously described (22) except that an antibody directed against the HA tag (HA.11, Covance) was used. For metabolic labeling of total protein, fifteen million CEM T cells were pulse labeled for 15 minutes with [³⁵S]-methionine and cysteine. For inhibitor studies a third of the sample was harvested after the pulse while the remaining cells were then chased for 12 hours in either RPMI with DMSO or 100nM bafilomycin A (Sigma). Lysates were generated in PBS 0.3% CHAPS, 0.1% SDS pH 8, 1mM PMSF and pre-cleared over night. They were immunoprecipitated for two hours with an antibody against HA (HA.11, Covance) and washed three times in radioimmunoprecipitation assay (RIPA) buffer (50 mM TRIS pH 8, 150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% SDS). The immunoprecipitates were then eluted by boiling in 10% SDS, re-precipitated with an antibody against HA, and washed three times in RIPA buffer. The final immunoprecipitates were then separated by SDS-PAGE.

For metabolic labeling of phosphorylated protein, five million CEM T cells were labeled for 4 hours with 0.5mCi/mL ³²P-orthophosphate in phosphate free media (RPMI, Specialty Media, Inc.) supplemented with 10% dialyzed FBS (Invitrogen). The cells were lysed with NP-40 lysis buffer (1% NP-40, 0.15 M NaCl, 0.01 M sodium phosphate, 2 mM EDTA, 50 mM sodium fluoride, 0.2 mM sodium vanadate and 1mM PMSF) and pre-cleared overnight. They were immunoprecipitated with BB7.2 antibody for two hours and washed three times in radioimmunoprecipitation assay (RIPA) buffer (50 mM TRIS pH 8, 150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% SDS). The immunoprecipitates were then separated by SDS-PAGE and the dried gel was exposed to a phosphorimager screen and analyzed on a Typhoon Trio Phosphorimager (GE Healthcare). Where indicated, cells were treated with 100nM bafilomycin A or DMSO solvent control for 18-24 hours.

Recycling assays

A measurement of the rate of recycling of internalized molecules was performed as described previously (23), except that washes were performed at room temperature to avoid inhibiting recycling with cold temperature (24). Briefly, cells were incubated with 150μg/ml cycloheximide (Sigma) for 2-3 hours in RPMI plus 10% serum. Then cells were harvested and an aliquot was removed and placed on ice. The remainder of the samples were stripped of stainable HLA-A2 by washing in 50 mM glycine, 100 mM NaCl, (pH 3.4 ), twice, at room temperature for one minute. The stripped cells were then washed in PBS and incubated at 37°C, 5% CO₂ in media without serum for the indicated period of time, in the presence of 150 μg/ml cycloheximide. (Samples were incubated without serum to avoid substitution of bovine β₂-microglobulin present in serum for the human β₂-microglobulin removed with the stripping protocol.) Cells were then placed on ice and stained for HLA-A2 with BB7.2, using wash buffers that included BSA instead of serum.

Results

HLA-C allotypes are classical MHC-I molecules that play a dual role. They are able to activate CD8⁺ CTLs via their ability to present antigens. Additionally, HLA-C allotypes have the capacity to send inhibitory signals to CD8⁺ T cells bearing inhibitory receptors. Perhaps as a result of this unique role, HLA-C molecules are known to be expressed at much lower levels on the cell surface than other classical MHC-I molecules (HLA-A and HLA-B allotypes). However, is unclear what elements determine these differences in expression. The extracellular domains of MHC-I proteins are known to be highly polymorphic, whereas the cytoplasmic tail domains are generally highly conserved within allotypes (Figure 1A). A comparison amongst the three types of classical MHC-I molecules revealed that there are four amino acids unique to the HLA-C cytoplasmic tail domain (Figure 1A).

Figure 1. The extracellular and cytoplasmic tail domains of HLA-C influence surface expression.

(A) The cytoplasmic tail sequences of HLA-A, HLA-B and HLA-C molecules. Amino acid differences unique to HLA-C are boxed. (B) Schematic diagram of HA-tagged MHC-I molecules. Open boxes represent HLA-A*0201 sequences, black boxes represent HLA-Cw*0401 sequences, the gray box represents the HA-tag and L indicates the position of the leader sequence. (C) Expression of HA-tagged chimeric MHC-I molecules. CEM T cells (“control”) or CEM T cells expressing the indicated MHC-I were pulse labeled with [³⁵S]-methionine and cysteine for 15 minutes. Lysates from these samples were immunoprecipitated with an antibody against HA, and separated by SDS-PAGE. (D) Quantitation of pulse labeling. A phosphorimager and ImageQuant software were used to quantify samples. Values were corrected for differences in methionine and cysteine content. The counts from the HLA-A*0201 sample were set to 100% and the values from other samples were expressed relative to it. The results are displayed as the means +/- SD from 3 experiments. (E) Cell surface expression of HA-A2, HA-Cw4, HA-A2/C and HA-Cw4/A. CEM T cell lines were generated expressing the indicated MHC-I molecules. The cells were stained with an antibody directed against the HA-tag and analyzed by flow cytometry. The filled gray curve represents the expression of the indicated molecules while the filled black curve represents control cells stained with the HA antibody. The mean fluorescence intensity (MFI) +/- standard deviation (SD) from 6 experiments is shown in the upper right hand corner. (F) Cell surface expression of untagged HLA-A2 and A2/C in CEM T cells. The CEM T cell line expressing un-tagged HLA-A2 has been previously described (19, 41, 42). Untagged MSCV A2/C was generated from pcDNA3.1 A2/Cw4 (see Materials and Methods) and was expressed in CEM cell lines as described in Materials and Methods. The cell surface expression of the indicated untagged MHC-I was assessed by flow cytometry using the HLA-A2 specific antibody, BB7.2 as described in Materials and Methods. The lightly shaded curve represents parental CEM cell lines. The darkly shaded curve represents CEM cells expressing untagged HLA-A2 and the un-shaded curve represents CEM cell expressing untagged A2/C. (G) Subcellular distribution of MHC-I molecules. The indicated CEM T cell lines were incubated with concanavilin A (ConA) to label the cell surface (green). They were then fixed, permeabilized, and stained with HA to examine MHC-I localization (red). Merge panels represent the product of these two overlapping images in which regions of overlap are highlighted in yellow. All images were collected on a Zeiss LSM 510 confocal microscope and single z-sections are displayed. (H) Quantification of ConA and HA co-localization. Quantification was determined as described in Materials and Methods. Quantification is shown for 4 cells expressing HA-A2 and 4 cells expressing HA-A2/C. (I) Cell surface expression of HA-A2 and HA-Cw4 in primary T cells. PBMCs were electroporated with a bi-cistronic GFP-expressing construct as described in Materials and Methods. Twenty-four hours post electroporation PBMCs were stained using an antibody directed against HA and analyzed by flow cytometry. Cells with equal GFP expression were selected and their GFP expression is shown in the upper panels. The corresponding HA stain is shown in the panels below. In the lower panels, the filled curve is the background staining on mock-transfected cells and the black line represents HA staining for cells transfected with the indicated construct. As a control, stable CEM T cells expressing the same molecules were also stained in parallel and are shown in the panels on the right.

To determine which amino acid differences played a role in reducing HLA-C surface expression, we first developed a way to clearly compare expression of these molecules. This was accomplished by attaching an HA tag to the N-terminus of HLA-A*0201 and HLA-Cw4*0401 (HA-A2 and HA-Cw4, Figure 1B). The HA tag, which was inserted just after the leader cleavage site, allowed us to compare the expression of heterologous proteins using the same antibody so that differences in antibody affinity did not confound our results. In prior publications, we have demonstrated that the presence of this tag does not affect the maturation and expression of HLA-A2 (19). Additionally, we have demonstrated that this tag does not affect recognition by the conformationally sensitive anti-HLA-A2 antibody, BB7.2 (19, 21).

We also made chimeric molecules in which the cytoplasmic tail domains of HLA-A or HLA-C were fused to the transmembrane domain of HA-Cw4 and HA-A2 to create HA-Cw4/A and HA-A2/C respectively (Figure 1B). DNAs encoding each of these proteins were cloned into murine retroviral vectors and viral supernatants were used to transduce CEM T cells at a low multiplicity of infection to limit the number of transductants with multiple integrated copies. Bulk cell lines were then grown in selective media to obtain a uniform population. To ensure that our results were not influenced by arbitrary variations introduced by individual transfections or transductions, the cell lines used in our investigations were re-made with new transfections and transductions on three separate occasions and in each case yielded similar relative expression levels.

Because, the translation initiation and leader sequences were the same for each molecule, we were able to measure initial protein synthesis as an estimate of the amount of translatable RNA in the cell. As shown in Figure 1C (and quantified in Figure 1D), the expression level of HA-A2 and HA-A2/C was not significantly different (p=0.12). Despite this, we found that there was approximately three-fold less HA-A2/C on the cell surface [mean fluorescence intensity (MFI) =50+/-4 for HA-A2/C, compared with 149+/-18 for HA-A2] (Figure 1E). This was not an artifact of the presence of the HA tag, as independently constructed and expressed HLA-A2 and A2/C that lacked the tag behaved similarly when stained with the HLA-A2 specific monoclonal antibody, BB7.2 (Figure 1F). In addition, these data were corroborated by confocal microscopy (Figure 1G and 1H), which confirmed that HA-A2 was largely expressed on the cell surface, where it co-localized significantly with concanavalin A (ConA). In comparison, HA-A2/C had a staining pattern that was distinctly different relative to that of ConA (compare panels 3 and 7 in Figure 1G and quantification shown in Figure 1H).

We also found that molecules with an HLA-C extracellular domain were expressed poorly on the cell surface relative to those containing HLA-A extracellular domains [(MFI)= 12 +/- 3 for HA-Cw4 and 20 +/- 2 for HA-Cw4/A2 (Figure 1E)]. Given that we noted a slightly lower level of initial protein synthesis for these molecules relative to HLA-A2 (Figure 1C and D), we also verified these results in a different system that could better account for potential differences in gene copy number. In this case, HA-A2 and HA-Cw4 were cloned into a different vector, which allowed expression of both MHC-I and GFP from the same RNA molecule via an IRES element. Thus, this vector system allowed us to monitor the relative number of gene copies present in the cell by measuring GFP expression by FACS. These constructs were directly transfected into activated primary T cells and the surface expression levels of HA-A2 and HA-Cw4 in primary T cells expressing equivalent amounts of GFP was measured and compared to what was observed in CEM T cells. As shown in Figure 1 I, at similar GFP expression levels, the cell surface expression of HA-A2 and HA-Cw4 was comparable to that achieved in stable CEM T cell lines stained in parallel (Figure 1 I, right panels). Moreover, as shown in Figure 1 I, the pattern we observed was not changed by adding twice as much DNA to the transfection, indicating that, the surface expression of HA-Cw4 and HA-A2 was not substantially affected by differences in transfection conditions.

The HLA-C cytoplasmic tail contains an internalization and lysosomal trafficking signal

To determine how the cytoplasmic tail affected cell surface expression, we utilized pulse-chase labeling with endo H digestion to measure the rate at which molecules harboring this domain were transported into the Golgi apparatus where they become modified such that they were resistant to endo H digestion. We observed that the cytoplasmic tail did not influence the rate molecules acquired resistance to digestion by endo H (Figure 2A and B). In contrast, we confirmed prior indications that the extracellular domain of HLA-C promoted ER retention and degradation (Figure 2A). These data were confirmed by confocal microscopy in which molecules containing the HLA-C extracellular domain co-localized with KDEL, a marker of the ER compartment (Figure 2C and 2D).

Figure 2. The HLA-C tail does not affect transport from the ER into the Golgi apparatus.

(A and B) CEM T cells expressing the indicated MHC-I were pulse labeled with [³⁵S]-methionine and cysteine for 15 minutes, chased for the indicated time period and harvested. Lysates were immunoprecipitated with an antibody against HA, treated with endo H, and separated by SDS-PAGE. “C” indicates control CEM cells that do not express the HA tag. (B) A phosphorimager and ImageQuant software were used to quantify the gel shown in part A. The percentage of molecules that were resistant to endo H digestion over time was calculated as follows: [((endo H resistant)/(endoH resistant +endo H sensitive)) ×100]. (C) The HLA-C extracellular domain promotes co-localization with markers of the ER. CEM T cells expressing the indicated MHC-I were fixed, permeabilized and stained for HA to examine MHC-I localization (green), or KDEL (red) to mark the ER. The merge panels depict regions of overlap in yellow. All images were collected on a Zeiss LSM 510 confocal microscope and single z-sections are displayed. (D) Quantification of KDEL and MHC-I co-localization. The relative amount of co-localization between KDEL and BB7.2 staining was determined as described in Materials and Methods. Quantification is shown for 6 cells expressing HA-A2, 5 cells expressing HA-A2/C, 4 cells expressing HA-Cw4, and 5 cells expressing HA-Cw4/A.

We then used pulse-labeling followed by a chase period in the presence of a cell impermeable biotinylation reagent, to determine the rate at which these molecules arrived at the cell surface. In these assays, the cell lysates were first immunoprecipitated with anti-HA. Then, one-third of the cell lysates was analyzed directly (total), and the remaining two-thirds was eluted from the beads and re-precipitated with avidin-agarose to isolate the subset of MHC-I at the cell surface (Figure 3A and B). As determined by phosphorimager analysis, we found that HA-A2/C was transported to the cell surface approximately two-fold more slowly than HA-A2 (p<0.01, n=2).

Figure 3. The HLA-C tail disrupts protein transport and accelerates internalization from the cell surface.

(A and B) CEM T cells expressing the indicated MHC-I were pulse labeled with [³⁵S]-methionine and cysteine. They were then chased for one or four hours in biotin. Lysates from these samples were immunoprecipitated with an antibody against HA and one-third of the immunoprecipitate was analyzed by SDS-PAGE (total). The remaining two-thirds was reprecipitated with avidin-agarose and then analyzed by SDS-PAGE (surface). “NC” is an immunoprecipitation of control CEM cells that do not express the HA tag. (B) Quantitation of cell surface transport. A phosphorimager and ImageQuant software were used to quantify recovered protein. The percentage of MHC-I molecules that had reached the cell surface at the indicated time point was calculated as follows: [((surface MHC-I)/(Total MHC-I*2)) ×100]. The mean from two experiments +/- standard deviation is shown. (C) A2/C is internalized at an accelerated rate. CEM T cells stably expressing the indicated protein were incubated on ice with the anti-HLA-A2 antibody, BB7.2. The cells were shifted to 37°C for the indicated time and then stained with a secondary antibody to determine the percentage of HA-A2 (black square) or HA-A2/C (gray square) remaining on the cell surface over time. The mean +/- standard deviation for an experiment performed in quadruplicate is shown. (D) Internalization of CD4 by the HIV Nef protein. CEM T cells were transduced with adenoviral vectors as previously described (42, 43) and the flow cytometric internalization assay was used to measure endocytosis as described for HLA-A2 and A2/C. Briefly, CEM T cells were incubated on ice with the anti-CD4 antibody, OKT4. The cells were shifted to 37°C for the indicated time and then stained with a secondary antibody goat α-mouse-phycoerythrin (Invitrogen, 1:250). The cells were analyzed by flow cytometry and the percentage of CD4 remaining on the surface of control cells (black square) or HIV-1 Nef expressing cells (gray square) was calculated. The mean +/- standard deviation for an experiment performed in duplicate is shown. (E) The cytoplasmic tail of HLA-C does not inhibit recycling. The rates of HA-A2/C, HA-A2/C I337T and HA-A2 recycling in CEM T cells were measured as described previously (44) and as outlined in Materials and Methods.

We then compared the internalization rate of HA-A2 and HA-A2/C using a flow cytometric assay in which cells were incubated on ice with a primary antibody directed against an HLA-A2 specific epitope (BB7.2). The cells were then shifted to 37°C for the indicated time period after which they were labeled with a secondary antibody. Flow cytometry was then used to quantify the amount of antigen remaining on the cell surface (22). As shown, we observed that, HA-A2/C was internalized twice as fast as HA-A2 (p<0.01, n=3, Figure 3C). The magnitude of the rate increase was somewhat less than what we observed with the well-documented internalization of CD4 induced by the HIV Nef protein (25, 26), in which Nef accelerates internalization approximately 3-6 fold (Figure 3D).

We also examined whether HLA-A2 and A2/C differed with respect to how rapidly they were recycled to the cell surface following internalization. As shown in Figure 3E, we did not detect any significant differences in recycling of HA-A2/C relative to HLA-A2 that would explain its lower expression levels. In fact, a slightly higher percentage of HA-A2/C was recycled to the cell surface from internal compartments (p=0.036, n=3).

We then examined the ultimate fate of HA-A2/C with longer pulse-chase experiments to determine whether it was targeted to lysosomal compartments after internalization. As shown in Figure 4A and quantified in Figure 4B, we found that mature, endo H resistant HA-A2/C was degraded approximately twice as fast as HA-A2. (HA-A2 had a half-life of 10.5 hours, compared to 6 hours for HA-A2/C). These data were confirmed by confocal microscopy in which we noted that HA-A2/C displayed extensive co-localization with LAMP-1, a marker of lysosomal organelles, when degradation was inhibited by bafilomycin, an inhibitor of the vacuolar ATPase that is required for efficient acidification and degradation in lysosomal compartments (Figure 4C and quantified in Figure 4D).

Figure 4. The HLA-C cytoplasmic tail promotes lysosomal targeting.

(A and B) CEM T cells expressing the indicated MHC-I molecule were pulse labeled with [³⁵S]-methionine and cysteine for 15 minutes, and chased for the indicated time. Lysates from these samples were immunoprecipitated with an anti-HA antibody as in figure 2A. “C” denotes results from the parental CEM T cell line that does not express the HA tag. (B) Quantitation of pulse-labeling. A phosphorimager and ImageQuant software was used to determine the amount of MHC-I at each time point. The amount at time 0 was set to 100% and the percentage remaining was then calculated for each time point. The mean +/- standard deviation from two experiments is shown. (C) HA-A2/C is directed to acidic compartments. CEM T cells expressing the indicated MHC-I were treated for 4 hours with 100nM Bafilomycin or DMSO and stained with an antibodies directed against HLA-A2 and LAMP-1, a marker of lysosomal compartments. The images were collected using a Zeiss 510 LSM and processed using Adobe Photoshop software. Single z-sections are displayed. (D) Quantification of LAMP-1 and MHC-I co-localization in bafilomycin treated cells. The degree of co-localization of LAMP-1 and BB7.2 staining was determined as described in Materials and Methods. Quantification is shown for 28 cells expressing HA-A2 and 30 cells expressing HA-A2/C. (E and F) Bafilomycin stabilizes the degradation of HA-A2/C. Pulse-chase analysis was performed as in (A) except that the cells were chased in either 100nM bafilomycin A or solvent (DMSO). (F) A phosphorimager and ImageQuant software was used to determine the percentage of MHC-I remaining [(value following chase/initial value) ×100]. The mean +/- standard deviation is shown for three experiments.

Finally, to provide further evidence that the degradation of HA-A2/C occurred in acidic compartments, such as lysosomes, we treated CEM T cells with bafilomycin to determine whether it reversed the degradation observed by pulse-chase analysis. As shown in Figures 4E and quantified in Figure 4F, bafilomycin treatment resulted in a six-fold increase of HA-A2/C compared with a 2.2-fold increase for HA-A2 (p=0.015, n=3). In sum, these data suggest that the HLA-C cytoplasmic tail contains an internalization and lysosomal targeting signal.

Identification of a trafficking signal in the HLA-C cytoplasmic tail that promotes intracellular localization and lysosomal targeting

To determine which amino acids were responsible for the effects of the HLA-C tail, we focused on four amino acid differences between HLA-C and HLA-A/B molecules (Figure 1A). Each of these amino acids was mutated in HA-A2/C, and stable CEM T cell lines were made as described above for HA-A2/C. Initial protein synthesis measurements indicated that the expression of each of these molecules was not significantly different than that of HA-A2/C, except for HA-A2/C D₃₃₃A, which was expressed slightly less (p=0.04, Figure 5A and B).

Figure 5. Isoleucine at position 337 (I₃₃₇) is required for accelerated internalization and lysosomal targeting.

(A and B) Expression of A2/C cytoplasmic tail point mutations. CEM T cells (negative control) or CEM T cells expressing the indicated MHC-I were pulse-labeled as described in Figure C, and analyzed by SDS PAGE. Bands were quantified using a phosphorimager and ImageQuant software. The results are displayed in part B as the means +/- SD from three experiments. (C and D) I₃₃₇ is necessary for reduced steady state cell surface expression of HA-A2/C. CEM T cell lines were generated expressing the indicated MHC-I. (C) CEM T cells expressing the indicated mutant were stained with an antibody directed against the HA-tag and analyzed by flow cytometry. The filled gray curve represents the expression of the indicated molecule while the filled black curve represents untagged cells stained with the HA antibody. (D) Quantitation of the HA-A2/C cytoplasmic tail mutant surface expression. The results are depicted as MFI +/- SD from three experiments. (E) I₃₃₇ is not required for slow export of HA-A2/C. A transport assay was performed as in Figure 3A, except cells were chased in biotin for only 1hr. The transport assay was quantified as in Figure 3B, except that percent of HA-A2 transported to the cell surface was set to 100%. The mean +/- standard deviation is shown for two experiments. (F) I₃₃₇ is necessary for accelerated internalization of HA-A2/C. A flow cytometric internalization assay was used as in Figure 3C to determine the percentage of each molecule remaining on the cell surface over time. The mean +/- SD for an experiment performed in triplicate is shown. (G and H) I₃₃₇ is necessary for lysosomal targeting of HA-A2/C. A pulse chase was performed as in Figure 4E and was quantified as in Figure 4F. The mean +/- SD is shown for two experiments.

We then examined surface expression via flow cytometric analysis on cells stained with an anti-HA antibody. As shown in Figure 5C and D, only one of the amino acids substitutions reversed the effect of the HLA-C tail. Specifically, changing isoleucine at position 337 in the HLA-C tail to the threonine found in HLA-A and B tails (I₃₃₇T) increased surface expression by three-fold compared with HA-A2/C (p<0.001, n=3). Conversely, we found that the reciprocal mutation in the HLA-A cytoplasmic tail (A2 T₃₃₇I), reduced surface expression of HA-A2 by 3-fold (p<0.0001, n=3, Figure 5C and D).

An analysis of intracellular transport, using the assay described above, revealed that HA-A2/C I₃₃₇T transport was reduced compared with wild type HA-A2 (p<0.001, n=3), but was not significantly different than A2/C (Figure 5E). Whereas, the flow cytometric internalization assay (described above) revealed that substitution of I₃₃₇ reduced the internalization rate 15-fold (from 3.73% per minute to 0.25% per minute p<0.01, Figure 5F).

Finally, we used pulse-chase analysis plus or minus bafilomycin to measure the degree to which wild type and mutant molecules were degraded in acidic compartments. As shown in Figure 5G and quantified in Figure 5H, substitution of I₃₃₇ in HA-A2/C increased the amount of recovered protein four-fold in the control, DMSO treated, sample (compare lanes 5 and 8 in Figure 5G, and quantification in Figure 5H, p<0.01), resulting in expression that was similar to that of HA-A2 (compare lanes 3 and 8 in Figure 5E). Thus, I₃₃₇ is a determinant required for accelerated internalization and degradation of molecules containing an HLA-C cytoplasmic tail domain.

To further define the internalization and lysosomal targeting motif in HLA-C, the highly conserved aspartic acid (D) at position 333 was changed to an alanine. Based on initial protein synthesis, this mutant was expressed slightly less than HA-A2/C (Figure 5A and B, p=0.04), but its expression was not significantly different than HLA-A2 and most A2/C mutants (C₃₂₀Y, N₃₂₇D, I₃₃₇T, T₃₃₇I, Figure 5A and B). Substitution of D₃₃₃ resulted in a substantial loss of cell surface expression compared to HA-A2/C, HA-A2 and the other HA-2/C mutants (Figure 5C and D, p values ranged from < 1×10^-4-10^-6). The intracellular transport rate was not the explanation for the reduction in surface expression as this was similar to HA-A2/C (Figure 6A). However, we found that substitution of D₃₃₃ resulted in a two-fold increase in internalization rate compared with HA-A2/C (p<1×10^-4) and a five-fold increase relative to wild type HA-A2 (p<1×10^-4, Figure 6B). Additionally, pulse-chase analysis revealed that mutation of D₃₃₃ also caused an increase in turnover of mature, endo H resistant molecules (Figure 6C and D). In sum, these data indicate that D₃₃₃ functions to attenuate the downstream dihydrophobic internalization and lysosomal targeting signal.

Figure 6. Aspartic acid at position 333 (D₃₃₃) in the HLA-C cytoplasmic tail attenuates the internalization and lysosomal targeting signal.

(A) D₃₃₃ is not needed for reduced HA-A2/C cell surface transport rate. CEM T cells expressing the indicated protein were utilized for a transport assay performed as described in Figure 3A and quantified as in Figure 3B. (B) Substitution of D₃₃₃ accelerates internalization. The rate of internalization was determined using CEM T cells stably expressing the indicated mutant. A flow cytometric internalization assay was used as in Figure 3C to determine the percentage of MHC-I remaining of the cell surface over time. The mean +/- SD for an experiment performed in triplicate is shown. (C and D) Substitution of D₃₃₃ enhances lysosomal targeting. To assess the degradation rate of each construct a pulse chase was performed using CEM T cells expressing the indicated mutant as described in Figure 2.

Evidence for regulated cell surface expression of HLA-C in antigen presenting cells

The data we have acquired indicates that there are multiple mechanisms by which cells precisely regulate HLA-C expression. The extracellular domain promotes retention and degradation in the ER and the cytoplasmic domain promotes a limited amount of internalization and degradation. Thus, it seems that complex mechanisms exist to maintain significant intracellular levels of HLA-C while limiting (but not eliminating) surface expression. It makes sense that a molecule capable of sending a dominant inhibitory signal to killer T cells should be tightly regulated, as high expression could result in higher activation thresholds for the detection of virally infected or tumorigenic cells. However, the fact that intracellular pools of HLA-C are maintained suggests that there may be conditions in which it is advantageous to rapidly upregulate HLA-C cell surface expression. We were unable to specifically induce HLA-C surface expression in T cells with a variety of stimuli, such as interferons alpha and gamma or with compounds that stimulate T cells, such as IL-2 and PHA. Additionally, we were unable to upregulate HLA-C expression by treatment of T cells with specific pathogens, such as HIV and adenovirus (data not shown).

It remained possible, however, that HLA-C had evolved to present peptides from certain types of pathogens, or that it functioned to inhibit killing under some conditions. For example, when antigen presenting cells (APCs) activate naïve CTLs by cross-presenting exogenous antigen, it would not be advantageous to lyse the uninfected, cross-presenting APC. Thus it would make sense for these cells to upregulate molecules that would send inhibitory signals to effector T cells that might otherwise mistake the APC for an infected target cell and lyse it. Indeed, it has recently been reported that co-incident with acquisition of killer T cell effector functions, CTLs up-regulate the KIR family of inhibitory receptors (5).

To examine this possibility further, we isolated primary human CD14⁺ mononuclear cells from a normal, healthy donor’s peripheral blood. Some of the cells were stained immediately for HLA-C and HLA-B allotypes and the remainder was incubated in GM-CSF for five days to induce macrophage differentiation. To measure HLA-C surface expression, we obtained an antibody that specifically recognizes most HLA-C allotypes, (18, 27). As shown in Figure 7A, left panel, HLA-C staining, as measured with the L31 antibody, was low in freshly isolated, undifferentiated CD14⁺ (about 2.8–fold above background and more than forty-fold less than Bw6). After five days of culture in GM-CSF, HLA-C surface expression was dramatically upregulated more than twenty-fold relative to Bw6.

Figure 7. Macrophage differentiation upregulates HLA-C and HA-A2/C.

(A) Upregulation of HLA-C upon differentiation of primary CD14⁺ cells into macrophages. CD14⁺ mononuclear cells were isolated from the blood of a normal donor. A subset of the cells was stained immediately (untreated) with anti-HLA-C (L31), an antibody against a subset of HLA-B allotypes (HLA-Bw6) or isotype control antibodies. The remainder of the cells were cultured for five days in GM-CSF, harvested and stained with the same antibodies. (B) Upregulation of HA-Cw4 and HA-A2/C with differentiation of monocytic cells lines into macrophage-like cells. U937 (left panels) and THP-1 (right panels) cell lines were derived as described in Material and Methods. Cell surface expression was determined by flow cytometry using an antibody to HA for undifferentiated (DMSO) and differentiated (LPS/PMA) cells. (C) Macrophage differentiation stabilizes the endo H resistant form of HA-A2/C and HA-Cw4. U937 and THP-1 cell lines were treated with LPS and PMA as in (B). Lysates were generated, digested with endo H, and analyzed by western blot using an antibody directed at HA. The endoH resistant band is indicated by “R” and the endoH sensitive band is indicated by “S”. (D) Macrophage differentiation inhibits internalization of HA-A2/C. The flow cytometric internalization assay described in Figure 3C was used to determine the percentage of HA-A2 or HA-A2/C remaining on the cell surface over time in undifferentiated (DMSO) or differentiated (LPS/PMA) U937 cell lines. For these experiments an HLA-A2-specific monoclonal antibody (BB7.2) was used. The mean +/-standard deviation for an experiment performed in quadruplicate is shown.

The data described above confirms that HLA-C expression is normally much lower than that of HLA-B allotypes in undifferentiated primary monocytes using antibodies that recognize natural epitopes. However, this approach does not allow the determination of which domains of HLA-C are responsible for regulated expression in differentiated macrophages. To further investigate this observation in a more well defined system, we expressed HA-A2, HA-Cw4 and HA-A2/C in cell lines (THP-1 and U937) that were capable of differentiating into macrophage-like cells by the addition of LPS and PMA. For comparison, we also expressed HA-tagged B*4405 and B*4402 in these cells. These two HLA-B molecules differ by only a single amino acid, but are known to vary substantially in terms of peptide loading and rates of ER egress (28).

In undifferentiated non-adherent solvent (DMSO)-treated cells, HA-A2, HA-A2/C and HA-Cw4 were expressed in a manner that was very similar to what we observed in primary T cells and stable CEM T cell lines (Figure 7B, panels 1 and 3). HA-A2 was expressed at comparably high levels and was largely endo H resistant (Figure 7C lanes 2 and 6), whereas HA-Cw4 was expressed at very low levels at the cell surface (Figure 7B, panels 1 and 3) and was largely endo H sensitive (Figure 7C lanes 18 and 22). HA-A2/C was expressed at intermediate levels (Figure 7B, panels 1 and 3) and had reduced amounts of endo H resistant material relative to HLA-A2 (Figure 7C lane 10 and 14), presumably due to increased internalization and degradation in acidic compartments as was observed in other cell types (Figures 3 and 4). B*4405 was expressed well on the cell surface (Figure 7B, panels 5 and 7) and was largely endo H resistant (Lanes 34 and 38 in Figure 7C), whereas B*4402 was expressed comparatively less well on the cell surface (Figure 7B, panels 5 and 7) and was largely endo H sensitive due to ER-retention [lanes 26 and 30 in Figure 7C, see also (28)].

When U937 and THP-1 cell lines were treated with LPS and PMA to induce differentiation into macrophage-like cells, we observed no change in the surface expression of HA-A2 or HA-B*4402 and we noted a small decrease in the surface expression of HA-B*4405 (Figure 7B). In contrast, we observed that A2/C cell surface expression was increased to achieve levels that were similar to wild type HA-A2 (Figure 7B compare panels 1 and 2 or 3 and 4). Additionally, as shown in Figure 7A, we also observed an increase in full length HA-Cw4 cell surface expression.

The increase in surface expression of A2/C was reflected by an increase in the amount of endo H resistant protein detected by western blot analysis (Figure 7C, compare lanes 10 and 12 for U937 cells or lanes 14 and 16 for THP-1 cells). We also noted an increase in the ratio of endo H resistant: sensitive forms of full length HLA-Cw*0401 (Figure 7C compare lanes and 18 and 20 for U937 or lanes 22 and 24 for THP-1). Albeit, most of the full-length HLA-C molecules remained endo H sensitive.

The relative amount of endoH resistant material for HA-A2 and HA-B*4405 remained unchanged. However, we did note an increase in the fraction of HA-B*4402 that became resistant to endo H (Figure 7C, compare lanes 26 and 28 or 30 and 32). Thus, macrophage differentiation resulted in a complex set of effects that enhanced ER exit of some MHC-I molecules, like B*4402, that are normally retained in the ER because of problems with protein loading (28). In addition, macrophage differentiation increased the amount of endo-H-resistant HA-A2/C, which is normally low because of lysosomal targeting of mature molecules.

To better understand the striking upregulation of surface HA-A2/C and the stabilization of mature, endo H resistant forms of A2/C in differentiated macrophage-like cells, we first examined internalization rate. As shown in Figure 7D, we found that HA-A2/C was internalized 3.6 times more rapidly than HA-A2 in DMSO treated monocytic cells. However, after treatment with LPS and PMA, HA-A2 and HA-A2/C were internalized at very similar rates, suggesting that the activity of the cytoplasmic tail signal was modified with differentiation.

Evidence that HLA-C Cell Surface expression in Macrophages is Regulated by Phosphorylation

The HLA-C internalization and lysosomal targeting signal is surrounded by serine residues (SDXSLI) and thus could be regulated by phosphorylation (29, 30). To examine this, we mutated these serine residues to alanine to prevent phosphorylation (A2/C SSAA). These constructs were expressed in both CEM cells and in U937 cells as described above. Then, phosphorylation of HA-A2, HA-A2/C and the mutant A2/C SSAA was directly assessed by labeling the cells with ³²P orthophosphate and immunoprecipitating each molecule with the HLA-A2-specific antibody, BB7.2. As shown in Figure 8A and B, we readily detected phosphorylation of HLA-A2 (Figure 8A and B, lane 2. However, A2/C was expressed at reduced levels (Figure 8A, lane 10 and Figure 8B, lane 9) and clear detection of phosphorylated A2/C required stabilization of the degraded molecules with the lysosomal inhibitor, bafilomycin (Figure 8A and B, compare lanes 3 and 4 in each figure). Mutation of serine residues 332 and 335 stabilized A2/C protein (Figure 8B, compare lanes 9 and 11) and dramatically reduced recovery of phosphorylated molecules (Figure 8A lane 8 and Figure 8B, lane 5. Thus, serines 332 and 335 were clearly necessary for both degradation and phosphorylation of the HLA-C cytoplasmic tail.

Figure 8. Serines 332 /335 in the HLA-C cytoplasmic tail are phosphorylated.

(A) CEM T cells or (B) U937 cells expressing the indicated MHC-I were treated with 100nM bafilomycin or DMSO overnight and metabolically labeled with ³²P orthophosphate as described in Materials and Methods. MHC-I molecules were immunoprecipitated from lysates with an antibody directed against HLA-A2 (BB7.2) and separated by SDS PAGE. In the lower panel, western blots of lysates from cells grown in parallel are shown. (C) Treatment of U937 cells with LPS and PMA to induce differentiation into macrophage-like cells results in a reduction of phosphorylation and a stabilization of A2/C protein. U937 cells were treated with DMSO or PMA and ionomycin as described in Figure 7. Cells were labeled with ³²P orthophosphate and immunoprecipitated as described above. In the lower panel, western blots of lysates from cells grown in parallel are shown. “Control” indicates results obtained with the parental cell line that lacked expression of HLA-A2.

To determine whether phosphorylation affected surface expression, we examined these molecules by flow cytometry in undifferentiated U937 and CEM cells. As shown in Figure 9A, we found that mutation of both serines to alanines increased HA-A2/C expression to that of wild type HA-A2. Mutation of serine 332 alone had no effect (data not shown), indicating that serine 335 was sufficient for this phenotype. Mutation of this serine residue to glutamic acid (S₃₃₅E), to mimic phosphorylation, did not affect expression of HA-A2/C in undifferentiated cells. Remarkably however, when macrophage differentiation was induced in U937 cells with LPS and PMA, we found that mimicking phosphorylation prevented upregulation, whereas unmodified HA-A2/C was upregulated 4.7-fold (p<1×10^-6, Figure 9A and B). Thus, these data provide confirmation that the phosphorylated form of A2/C is degraded and that inhibition of A2/C phosphorylation results in a stabilization of A2/C protein.

Figure 9. Serine 335 (S₃₃₅) regulates HLA-Cw*0401 expression in macrophage cell lines.

(A and B) Mutation of the phosphorylated serines to alanines stabilizes A2/C surface expression. U937 cells expressing the indicated MHC-I molecule were treated with DMSO or LPS/PMA as indicated and were then stained with the anti-HLA-A2 antibody, BB7.2. (B) The fold increase in MFI relative to HA-A2 is shown. The mean +/- standard deviation for three experiments is shown. (C and D) Macrophage differentiation inhibits lysosomal targeting of HA-A2/C through inhibition of S₃₃₅ phosphorylation. The indicated U937 cell lines were pulse-labeled with ³⁵S and chased for 12 hours plus or minus bafilomycin as in Figure 4E. The indicated protein was immunoprecipitated with BB7.2 and separated by SDS PAGE. White lines indicate places where the gel image was cropped and rearranged to place samples in a consistent order relative to one another. (D) A phosphorimager and ImageQuant software were used to quantify each band. Fold stabilization was calculated as follows: [% remaining for each condition/ % remaining for the untreated sample]. (% Remaining was calculated as in Figure 4F). (E) Macrophage differentiation inhibits internalization of HA-A2/C through hypophosphorylation of S₃₃₅. An internalization assay performed as described in Figure 3C was used to determine the percentage of the indicated MHC-I molecules remaining on the cell surface over time in DMSO versus LPS/PMA-treated U937 cells. The anti-HLA-A2 monoclonal antibody BB7.2 was used to detect surface expression in these experiments. The mean +/- standard deviation for an experiment performed in triplicate is shown.

To further examine the mechanism by which S₃₃₅ affected HA-A2/C expression, we examined degradation by pulse-chase analysis. As shown in Figure 9C, HA-A2/C expression was reduced by 97% by 12 hours (compare lanes 15 and 16 with lanes 17 and 18 in Figure 9C). Inhibition of phosphorylation by alanine substitutions (SSAA) resulted in stabilization of the molecule nearly four-fold (compare lanes 17 and 18 with lanes 29 and 30 in Figure 9C). In contrast, mimicking phosphorylation of S₃₃₅ by glutamic acid substitution resulted in degradation similar to HA-A2/C (compare lane 17 and 18 with lanes 41 and 42 in Figure 9C). In all cases, the observed degradation was rescued with bafilomycin, indicating that it was secondary to lysosomal targeting.

Following treatment with LPS and PMA to induce macrophage differentiation, we observed a four-fold increase in HA-A2/C protein at the 12 hour chase point compared to DMSO-treated cells (compare lanes 17 and 18 with lanes 23 and 24 in Figure 9C). Mimicking phosphorylation at position 335 (S₃₃₅E) prevented differentiation-induced stabilization of HA-A2/C (compare lanes 23 and 24 with lanes 47 and 48 in Figure 9C). Conversely, inhibiting phosphorylation by substituting alanine at the same position maintained protein stability under all conditions (Figure 9C, lanes 35-38). In sum, these data strongly indicate that phosphorylation of S₃₃₅ in the HLA-C tail is necessary for lysosomal targeting and that macrophage differentiation inhibits phosphorylation of this residue.

To examine the effect of mimicking or inhibiting phosphorylation on internalization rate, we used the flow cytometric internalization assay described above. As shown in Figure 9E (left graph), mimicking phosphorylation (S₃₃₅E) accelerated internalization 1.7-fold (p<0.01), whereas preventing phosphorylation at this position (SSAA) inhibited it 2.0 fold (p<0.01). Following treatment with LPS and PMA, we again observed a decrease in the internalization rate of HA-A2/C (Figure 9E, right graph). However, the phosphorylation mimic (S₃₃₅E) did not respond, and continued to be internalized at a rapid rate. These data further support the model that phosphorylation is necessary for the internalization and degradation of HLA-C, and that macrophage differentiation resulted in hypophosphorylation, and increased expression of HLA-C.

Finally, to directly demonstrate that phosphorylation of A2/C is reduced upon macrophage differentiation, phosphorylation of HA-A2 and HA-A2/C was directly assessed by labeling the cells with ³²P orthophosphate and each molecule was immunoprecipitated with the HLA-A2-specific antibody, BB7.2. As shown in Figure 8C, induction of differentiation dramatically increased the recovery of total A2/C relative to that of HA-A2, as measured by western blot analysis (Compare Figure 8C, lanes 5 and 6 with Figure 8B lanes 8 and 9) without demonstrating a corresponding increase in phosphorylated forms (Figure 8C, lanes 2 and 3). Thus, these data support our model, that differentiation reduced A2/C phosphorylation, which in turn resulted in stabilization of A2/C protein.

Discussion

In this study, we demonstrated that HLA-C is a highly regulated MHC-I molecule and in most cell types its expression is limited at almost every step in the biosynthetic pathway. Maintenance of a low level of HLA-C surface expression may allow a balance between the signals needed for antigen presentation and appropriate inhibition of NK cells, without sending strong dominant signals that might overly increase activation thresholds. The extracellular domain of HLA-C reduced expression by promoting ER retention whereas the cytoplasmic tail affected expression via the activity of an internalization and lysosomal targeting signal.

The influence of the extracellular domain of MHC-I on its surface expression was not surprising. This region of the molecule dictates the peptides MHC-I will bind and ultimately regulates release from the ER and transport to the cell surface. Indeed, the addition of HLA-C specific peptides has been reported to promote the release of HLA-C from TAP in vitro (31), and thus would be expected to decrease ER retention. Based on these data, it is tempting to speculate that HLA-C expression would increase with a broadening of intracellular peptides such as would occur with infection by viruses or intracellular bacteria. To this end we did examine several viruses (HIV and adenovirus) without detecting any significant change in HLA-C expression. Obviously, however, we cannot rule out the possibility that specific peptides found in other kinds of pathogens might stimulate the release of HLA-C from the ER.

The bigger surprise was the discovery of an internalization and lysosomal targeting signal within the HLA-C cytoplasmic tail. This motif was identified by the demonstration that mutating isoleucine at position 337 to a threonine reversed the phenotype conferred by swapping the HLA-C cytoplasmic tail for the HLA-A2 cytoplasmic tail. Interestingly, the sequence surrounding this residue resembles a Golgi localized, gamma-ear containing, ARF-binding (GGA) consensus binding motif (DXXLL: reviewed in (32)). GGAs are localized to the TGN and endosomal compartments, and are thought to play a role in trafficking between the TGN and endosomes. Thus, it was possible that GGAs played a role in targeting HLA-C into the endolysosomal pathway from the cell surface or the TGN. However, while we observed some reduction in surface expression and some alteration in intracellular localization with knockdown of GGA-2 and –3, we observed no significant change in the surface transport rate, internalization, recycling or degradation rates. Also, arguing against a role for the GGAs, we found that mutation of the required aspartic acid residue at position 333 (DXSLI) to an alanine, actually increased the activity of the signal. Based on these data, the role of this amino acid was not to provide a GGA binding site, but rather to attenuate the dihydrophobic signal so as to allow some HLA-C to remain on the cell surface. Thus, we have defined a set of amino acids in the HLA-C cytoplasmic tail, which comprise a novel signal that serves to maintain a precise, low level of HLA-C surface expression. Further work will be needed to identify the corresponding trafficking protein that binds it.

Interestingly, the activity of the HLA-C internalization and lysosomal targeting signal also depended on an adjacent serine (DXSLI), which we directly demonstrated was phosphorylated in vivo. Changes in this position increased or decreased internalization and degradation, depending on the substitution that was made. When serine 335 was changed to a glutamic acid residue, which mimicked the negative charge provided by phosphorylation, internalization and degradation occurred rapidly. When phosphorylation was prevented by changing the serine to an alanine, internalization and degradation were inhibited and cell surface expression was increased.

The complex regulation of HLA-C trafficking was puzzling in that HLA-C cell surface expression was kept low while HLA-C intracellular levels remained fairly high. These observations suggested that under most conditions it is beneficial to keep HLA-C expression low to reduce inhibitory signals that might limit immune surveillance, but that there might be some circumstances in which HLA-C might be rapidly up-regulated, either to increase the capacity of the cell to present certain types of antigens, or to turn down an immune response by increasing signaling to KIRs.

To examine whether HLA-C might be specifically upregulated under some conditions of immune activation, we treated CEM cells with interferons (alpha and gamma) or with chemicals known to activate T cells (PHA and IL-2), without success. Additionally, we infected the cells with viral pathogens such as adenovirus and HIV, again without significant affect. We then turned to APCs, because these cells have unique roles in antigen presentation (e.g. the capacity to present exogenous antigens in association with MHC-I).

We found that undifferentiated primary monocytes and monocytic cell lines expressed low levels of HLA-C, similar to the other cell types we examined. Upon differentiation, however, we observed a reduction in phosphorylation of A2/C, which correlated with a reduction in internalization and degradation and a corresponding upregulation of HLA-C and molecules bearing the HLA-C cytoplasmic tail. Under the same conditions, the surface expression of HLA-A and HLA-B molecules remained essentially unchanged or was even reduced somewhat. The dependence of this effect on the cytoplasmic tail, which we demonstrated governs post-Golgi trafficking, ruled out the possibility that this was solely due to a change in the peptide loading capacity of the APCs in the ER. Upregulation of expression with differentiation depended on the serine adjacent to the dihydrophobic motif (DXSLI). When this serine was modified to a glutamic acid, mimicking phosphorylation, low expression and rapid internalization was maintained upon induction of differentiation. When phosphorylation was inhibited by changing the serine to an alanine residue, high surface expression and reduced internalization resulted and was maintained upon induction of differentiation.

These observations, together with the strong evidence that HLA-C plays a crucial role as an inhibitor of NK cell lysis by virtue of its specific binding of KIRs, suggests that HLA-C is upregulated on macrophages to downregulate and/or specifically inhibit lysis of cells bearing these receptors. Interestingly, it has recently been demonstrated that CTLs acquire KIRs coincident with acquisition of effector functions (5). Thus, HLA-C may be upregulated to provide feedback inhibition of CTLs, once they have fully matured. Alternatively, another, perhaps more intriguing possibility is that HLA-C is specifically upregulated on APCs to protect them from lysis by mature CTLs while they are cross-presenting exogenous antigens to naïve CTLs. The capacity to specifically prevent the lysis of cross-presenting APCs would be advantageous in the setting of a chronic infection in which it was necessary to continuously present antigens over an extended period of time. In preserving these cells by such a mechanism, the resulting increased threshold to lysis may inadvertently create a protected reservoir that aids in the persistence of certain organisms. Indeed, there is a long list of persistent pathogens that can be found in macrophages, including HIV, leishmania, brucella, salmonella, herpes viruses, tuberculosis, legionella, plus others (33-40). Thus, HLA-C may be precisely regulated in order to balance the need for continued immune activation by APCs presenting antigens against the cost of allowing some pathogens to persist.