Abstract
Complex traits typically involve the contribution of multiple gene variants. In this study, we took advantage of a high-density genotyping analysis of the BY (S288c) and RM strains of Saccharomyces cerevisiae and of 123 derived spore progeny to identify the genetic loci that underlie a complex DNA repair sensitivity phenotype. This was accomplished by screening hybrid yeast progeny for sensitivity to a variety of DNA damaging agents. Both the BY and RM strains are resistant to the ultraviolet light–mimetic agent 4-nitroquinoline 1-oxide (4-NQO); however, hybrid progeny from a BY×RM cross displayed varying sensitivities to the drug. We mapped a major quantitative trait locus (QTL), RAD5, and identified the exact polymorphism within this locus responsible for 4-NQO sensitivity. By using a backcrossing strategy along with array-assisted bulk segregant analysis, we identified one other locus, MKT1, and a QTL on Chromosome VII that also link to the hybrid 4-NQO–sensitive phenotype but confer more minor effects. This work suggests an additive model for sensitivity to 4-NQO and provides a strategy for mapping both major and minor QTL that confer background-specific phenotypes. It also provides tools for understanding the effect of genetic background on sensitivity to genotoxic agents.
Author Summary
Complex traits often display a range of phenotypes due to the contribution of multiple gene variants. Advances in statistical models, genetic mapping, and DNA genotyping and sequencing have made baker's yeast an excellent system to identify quantitative trait loci (QTL), regions of the genome linked to a quantitative phenotypic trait. We focused on a complex DNA damage sensitivity phenotype in yeast in which parental strains are unaffected but give rise to progeny with a sensitive phenotype. We used a whole-genome approach to isolate defects in DNA repair caused by gene variants in two strains of baker's yeast that display approximately 0.5% sequence divergence. The parental strains are resistant to the ultraviolet light–mimetic agent 4-nitroquinoline 1-oxide (4-NQO); however, a large number of spore progeny displayed varying sensitivities to the drug. Through linkage and bulk segregant analyses we identified one major QTL, RAD5, and two minor QTL linked to sensitivity to 4-NQO, and we provide evidence that sensitivity is due to additive effects involving several QTL. These observations provide a powerful model in which to understand the basis of disease penetrance and how phenotypic variation can be mapped at the gene level.
Introduction
Complex traits often display phenotypic variation due to additive and interactive effects of gene variants located at multiple loci. Because of the above complications, only a relatively small number of quantitative trait loci (QTL) have been identified [1]–[7]. Baker's yeast has become an excellent system to model and dissect complex traits. For example, Steinmetz et al. [8], Brem et al. [9], and Perlstein et al. [10] took advantage of the natural variation between wild and laboratory yeasts to dissect the complex phenotypes that underlie high-temperature growth, transcriptional regulation, and drug sensitivity, respectively. Steinmetz et al. [8] mapped a trait present in one parental strain while Brem et al. [9] mapped transcriptional traits in both parents and hybrid progeny by looking for linkage between phenotypic variation and specific molecular markers. Perlstein et al. [10] performed linkage analysis to identify QTL linked to sensitivity to small molecule drugs. Such analyses involved the use of high-density oligonucleotide arrays to analyze a large collection of F2 hybrid progeny.
Complex traits can be identified in one parental background and mapped by crossing the strain to one lacking the phenotype. However, a complex phenotype or disease can be caused by variants of genes derived from different strain backgrounds, resulting in offspring showing phenotypic variation not present in the parents. Such complex phenotypes have been shown to affect the penetrance of human cancers (e.g. [11]–[13]). For example, in rare cases of hereditary non-polyposis colorectal cancer, the disease is thought to result from the combined effect of non-pathogenic DNA mismatch repair alleles [13]. Such phenotypes could be due to impaired protein/protein interactions or other molecular interactions that occur only in the hybrid progeny; alternatively, they could be due to additive effects involving several QTL.
The above observations encouraged us to identify and dissect a complex trait in baker's yeast associated with defects in DNA repair. We focused on such phenotypes because of our interest [14] in understanding how DNA damage repair pathways contribute to maintaining genomic stability (reviewed in [15],[16]). Also, identifying loci that underlie such traits provides a model to explain differences in the penetrance of phenotypes observed in humans (e.g. [3],[8],[17]). We used a whole-genome approach to identify such loci in the meiotic progeny of a cross between the BY (S288c) and RM strains of S. cerevisiae. BY is a commonly used lab strain and RM is a wild isolate from a grape vineyard in California that displays approximately 0.5–1% sequence divergence relative to S288c [9],[18]. We tested RM and BY strains and the meiotic progeny of a BY/RM diploid for sensitivity to a variety of DNA damaging agents. Both the BY and RM strains are resistant to the ultraviolet light-mimetic agent 4-nitroquinoline 1-oxide (4-NQO); however, a large number of spore progeny from the BY/RM diploid showed varying sensitivity to the drug. Through linkage analysis and a backcrossing strategy involving a bulk segregant analysis and SNP genotyping, we identified one major and two minor QTL linked to the 4-NQO-sensitive phenotype. These observations provide a powerful model in which to understand the basis of disease penetrance and how genetic variation can be mapped at the gene level.
Results
Complex Molecular Interactions Are Observed in BY/RM Hybrid Progeny Treated with DNA Damaging Agents
To identify novel complex traits in Saccharomyces cerevisiae associated with DNA repair, we examined 123 haploid meiotic progeny of a BY/RM diploid [9] for sensitivity to DNA damaging agents (Tables 1, 2; Materials and Methods). Using high-density oligonucleotide arrays, 2956 genetic markers were identified between the two parental strains that cover over 99% of the genome [9],[19]. Meiotic spore progeny from the BY/RM hybrid were genotyped using the same high-density oligonucleotide array, creating an inheritance map for each of the 123 hybrid spore progeny [9],[20],[21].
Table 1. Phenotypes of BY/RM hybrid progeny.
Sensitivity Phenotype | |||||
Segregant | MMS | 4-NQO | Bleomycin | Caffeine | |
BY | + | + | + | + | |
RM | -- | + | + | + | |
1 | 1-1-d | + | ++ | ± | - |
2 | 1-2-d | - | ++ | + | ± |
3 | 1-3-d | - | - | ++ | + |
4 | 1-4-d | + | ++ | - | - |
5 | 1-5-c | - | - | - | + |
6 | 2-1-d | + | ++ | - | ± |
7 | 2-2-d | -- | - | ++ | + |
8 | 2-3-d | + | ++ | ± | + |
9 | 2-4-a | - | + | ± | ± |
10 | 2-5-d | -- | - | ++ | + |
11 | 2-6-d | + | ± | ± | ± |
12 | 2-7-d | -- | ± | ± | ++ |
13 | 3-1-d | -- | ± | - | - |
14 | 3-2-d | ± | ± | - | - |
15 | 3-3-d | ± | ± | ++ | + |
16 | 3-4-d | - | - | ± | ± |
17 | 3-5-d | -- | - | + | - |
18 | 4-1-c | -- | ± | -- | + |
19 | 4-2-a | + | + | ± | - |
20 | 4-3-d | -- | - | + | + |
21 | 4-4-d | ++ | ++ | + | + |
22 | 5-1-d | ± | ++ | - | ± |
23 | 5-2-d | -- | - | + | + |
24 | 5-3-d | -- | ± | + | + |
25 | 5-4-d | -- | ± | + | ± |
26 | 5-5-d | + | + | + | + |
27 | 6-1-d | ± | - | + | ± |
28 | 6-2-b | ± | + | + | ± |
29 | 6-3-c | -- | ± | ± | ± |
30 | 6-4-d | + | ++ | ++ | + |
31 | 6-5-d | - | ± | + | ± |
32 | 6-6-d | - | ± | - | - |
33 | 6-7-d | + | + | - | ± |
34 | 7-1-d | + | ++ | ± | - |
35 | 7-2-c | -- | ± | + | + |
36 | 7-3-d | + | ++ | + | + |
37 | 7-4-c | ++ | ++ | ± | ++ |
38 | 7-5-d | - | + | + | + |
39 | 7-6-c | -- | ± | + | + |
40 | 7-7-c | -- | ± | + | + |
41 | 7-8-d | -- | ± | + | ± |
42 | 8-1-a | - | + | ++ | ++ |
43 | 8-2-d | + | ++ | - | - |
44 | 8-3-a | ++ | + | - | + |
45 | 8-4-c | -- | ++ | + | ± |
46 | 8-5-b | ++ | ++ | ± | + |
47 | 8-6-c | -- | -- | - | + |
48 | 8-7-b | ± | + | - | ± |
49 | 9-1-d | + | ++ | ± | ± |
50 | 9-2-d | -- | ± | ± | - |
51 | 9-3-d | -- | ± | ++ | + |
52 | 9-4-d | - | ++ | + | + |
53 | 9-5-d | -- | - | ± | ± |
54 | 9-6-d | -- | -- | ± | + |
55 | 9-7-d | -- | ± | ± | ± |
56 | 10-1-c | + | ++ | - | - |
57 | 10-2-d | - | ++ | + | + |
58 | 10-3-c | - | ++ | ± | - |
59 | 10-4-d | + | ++ | - | ± |
60 | 11-1-a | + | + | ± | + |
61 | 11-2-d | - | - | ± | + |
62 | 11-3-b | - | + | ± | - |
63 | 12-1-d | - | - | - | ± |
64 | 12-2-b | ++ | ++ | - | + |
65 | 13-1-a | -- | - | + | ± |
66 | 13-2-c | -- | - | - | - |
67 | 13-3-b | + | ++ | ± | ± |
68 | 13-4-a | ± | ± | - | + |
69 | 13-5-c | + | ++ | ± | - |
70 | 14-1-b | -- | - | - | ± |
71 | 14-2-c | ± | + | ± | + |
72 | 14-3-d | ± | + | + | ± |
73 | 14-4-a | -- | ± | - | - |
74 | 14-5-b | + | ++ | ± | ± |
75 | 14-6-d | - | ++ | ± | - |
76 | 14-7-c | -- | - | ± | ± |
77 | 15-2-d | + | ± | - | + |
78 | 15-3-b | - | ± | + | ± |
79 | 15-4-d | + | + | - | + |
80 | 15-5-b | -- | - | -- | ± |
81 | 15-6-c | ± | ++ | -- | - |
82 | 16-1-d | - | ± | ± | ± |
83 | 17-1-a | + | ± | - | ± |
84 | 17-2-d | -- | - | + | + |
85 | 17-4-a | -- | - | ± | ± |
86 | 17-5-b | + | + | + | + |
87 | 18-1-d | + | ++ | -- | -- |
88 | 18-2-d | ± | - | ± | + |
89 | 18-3-d | -- | - | -- | - |
90 | 18-4-c | ± | + | ± | ± |
91 | 18-6-d | + | ++ | - | + |
92 | 19-1-c | -- | - | ++ | + |
93 | 19-2-c | -- | - | ++ | ± |
94 | 19-3-c | ++ | + | ++ | ++ |
95 | 19-4-b | + | + | - | + |
96 | 19-5-b | + | ++ | + | - |
97 | 20-1-d | + | + | + | - |
98 | 20-2-d | + | + | ++ | - |
99 | 20-3-c | -- | - | ± | + |
100 | 20-4-c | -- | ++ | ++ | + |
101 | 20-5-d | - | ± | ++ | + |
102 | 21-1-d | + | - | - | + |
103 | 21-2-d | + | ++ | -- | ± |
104 | 21-3-d | -- | - | - | + |
105 | 21-4-d | ± | ± | ± | + |
106 | 21-5-c | nt | nt | ++ | nt |
107 | 22-1-d | -- | ± | - | + |
108 | 22-2-d | ++ | ++ | ++ | ± |
109 | 22-3-b | ++ | + | ± | ± |
110 | 22-4-d | + | ± | + | ± |
111 | 22-5-d | + | + | ++ | ++ |
112 | 23-2-d | + | + | - | ± |
113 | 23-3-d | ± | + | - | + |
114 | 23-4-d | -- | - | - | ± |
115 | 23-5-d | -- | ± | + | + |
116 | 24-1-d | -- | - | - | - |
117 | 25-1-d | -- | - | - | ± |
118 | 25-3-d | -- | - | - | ± |
119 | 25-4-d | -- | ± | ± | ± |
120 | 25-5-d | + | + | ++ | ± |
121 | 26-1-d | + | + | - | ± |
122 | 26-2-d | ± | ± | ± | + |
123 | 26-3-d | + | ± | - | - |
RM, BY and RM/BY meiotic spore progeny were tested in triplicate using a plating assay and scored for resistance to the DNA damaging agents, MMS, 4-NQO, bleomycin and caffeine (See Materials and Methods). Strains were scored as follows: very sensitive (- -), sensitive (-), slightly sensitive (±), wild-type resistance (+) and increased resistance (+ +). nt, not tested.
Table 2. Strains.
Strain | Background | Relevant Genotype |
BY4716 | BY | MATα, lys2Δ |
RM11-1a | RM | MATa, leu2Δ, ura3Δ, ho::Kan |
EAY253 | S288c | MATα ura3-52, leuΔΔ1, his3Δ200, rad52Δ::LEU2 |
EAY1463 | BY | MATα, lys2Δ, RAD5-RM::NatMX |
EAY1465 | BY | MATα, lys2Δ, RAD5-BY::NatMX |
EAY1467 | RM | MATa, leu2Δ, ura3Δ, ho::Kan, RAD5-BY::NatMX |
EAY1469 | RM | MATa, leu2Δ, ura3Δ, ho::Kan, RAD5-RM::NatMX |
EAY1471 | BY | MATα, lys2Δ, RAD5-I791S::KanMX |
EAY2169 | BY | MATα, lys2Δ, RAD5-E783D::KanMX |
EAY2295 | 3D-BK3-12 | MATa, lys2Δ, ura3Δ, leu2Δ, RAD5-RM |
EAY2298 | 3D-BK3-52 | MATα, lys2Δ, ura3Δ, RAD5-RM |
EAY2336 | 3D-BK3-16 | MATa, lys2Δ, ura3Δ, leu2Δ, RAD5-RM |
EAY2317 | 3D-BK3-12 | MATa, lys2Δ, ura3Δ, leu2Δ, RAD5-RM, mkt1Δ::NatMX |
EAY2323 | 3D-BK3-52 | MATα, lys2Δ, ura3Δ, RAD5-RM, mkt1Δ::NatMX |
We looked for a reproducible DNA damage sensitivity phenotype in the hybrid progeny that was not seen in either parental strain. This phenotype was assessed by plating serial dilutions of saturated cultures from each hybrid segregant onto plates containing varying concentrations of DNA damaging agents (Table 1 and Figure 1). The DNA damaging agents tested included methyl methane sulfonate (MMS), a DNA alkylating agent, 4-nitroquinoline 1-oxide (4-NQO), an ultraviolet light (UV) mimetic, bleomycin, a radiomimetic antitumor drug, and caffeine, a compound that sensitizes cells to genotoxic agents [22]. We identified hybrid progeny that displayed varying sensitivities to 4-NQO, bleomycin, and caffeine treatments (Table 1). Surprisingly, the RM parent displayed sensitivity to MMS, and this sensitivity was observed in half of the progeny (Table 1); however, as shown below this phenotype does not appear to be entirely monogenic.
Linkage Analysis of DNA Damage Phenotypes
We performed linkage analysis for each of the phenotypes tested (Figure 2), determined significance cutoffs for each trait by permutation, and calculated support intervals (see Materials and Methods). MMS-sensitivity, which was seen in the RM parent and half of the hybrid segregants tested, showed strong linkage to a chromosome 12 locus near SMF3 (Figure 2A, LOD score of 16.6 for YLR034C_1989). Linkage analysis of 4-NQO-sensitivity identified the same region (LOD score 10.1 for YLR034C_1989, support intervals completely overlap), but in this case the phenotype was seen in the hybrid progeny but not in the parental strains, indicating that 4-NQO-sensitivity involves additional loci (Figure 1B, Table 1). The bleomycin-sensitive phenotype showed linkage to chromosome 2 (LOD score 5.2 for YBR138C_275; Figure 2C). The caffeine-sensitive phenotype also showed linkage to chromosome 2 (LOD score 5.0 for YBR161W_293; Figure 2D). Both loci overlap a region previously linked to growth-related transcripts and daughter cell separation [19]; however, the linkages described here are not likely to be due to the same locus because their support intervals do not overlap. We further pursued the MMS- and 4-NQO-sensitivity linkages because they showed the highest statistical significance.
A Single Polymorphism in RAD5 Confers Sensitivity to MMS and Contributes to the hybrid 4-NQO Sensitivity Phenotype
Twenty-two genes lie within the support interval associated with the MMS-sensitive and 4-NQO sensitive phenotypes. A prime candidate is RAD5, located ∼2 kb away from the peak marker. RAD5 encodes a DNA-dependent ATPase involved in the error-free branch of post-replicative repair [23]. rad5 null mutants are sensitive to MMS, UV, and ionizing radiation [24],[25]. Only one other gene within the region is required for resistance to MMS, AAT2, which encodes an aspartate aminotransferase involved in nitrogen metabolism [25],[26]. It is located on the edge of the region, approximately 12.5 kb from the peak marker. Although required for MMS-resistance, aat2 deletion strains are not UV-sensitive [25].
Based on the above information, we focused on RAD5 as a candidate gene associated with MMS and 4-NQO sensitivity observed in the hybrid progeny. We tested the role of RAD5 polymorphism by homologous allele replacement and plasmid suppression (Figures S1and S2) approaches. RM strains, which are sensitive to MMS, became resistant when the RAD5 gene in RM was replaced with the BY copy. In addition, the MMS-sensitivity observed in RM strains could be created in the BY strain by replacing RAD5 with the RM copy (Figure S1). Replacement of the BY open reading frame of RAD5 with the RM allele also re-created the 4-NQO sensitive phenotype in the BY strain (BY::RAD5-RM; Figure 3A, Materials and Methods). The sensitivity was not observed when the RAD5 gene in the RM strain was replaced with the BY copy (RM::RAD5-BY), consistent with the RM copy of RAD5 being associated with 4-NQO sensitivity. These data indicate that that the RM copy of RAD5 contains polymorphisms that confer the MMS-sensitive phenotype and contribute to sensitivity to 4-NQO. Interestingly, although the MMS-sensitivity phenotype appeared to be monogenic and showed strong linkage to RAD5, the locus does not completely account for the phenotype. Genotyping analysis of the 121 meiotic progeny indicated that although there is a very strong linkage to RAD5, there is overlap in which progeny displaying moderate (−, −/+) sensitivity to MMS fell into both the RAD5-BY and RAD5-RM genotype classes (data not shown).
The RAD5 open reading frames in BY and RM differ by two non-synonymous substitutions that map to amino acid positions 783 (glutamic acid in BY, aspartic acid in RM) and 791 (isoleucine in BY, serine in RM). These polymorphisms both map to the helicase domain of RAD5 (Figure 3B; [23]). Using site-directed mutagenesis and homologous gene replacement methodologies we found that the serine residue at position 791 in RM RAD5 contributed to sensitivity to 4-NQO. This was accomplished by introducing the RAD5-I791S substitution into the BY strain and showing that the resulting strain was sensitive to 4-NQO (Figure 3C, Materials and Methods). This allele was also responsible for the MMS-sensitivity phenotype observed in the RM parental strain (Figure S3). No other strains of Saccharomyces cerevisiae that have been sequenced (http://www.sanger.ac.uk/Teams/Team71/durbin/sgrp/) contain this serine 791 polymorphism. We also phenotype-tested a number of wild yeast strains in our collection and none of them showed sensitivity to MMS equivalent to that observed in the RM parental strain (data not shown). Finally, this polymorphism is not the same as the loss of function mutation that was previously identified in the W303-derived copy of RAD5, G535R [27].
No Candidate Genes Show Suppression of the Hybrid 4-NQO-Sensitive Phenotype
We identified one locus, RAD5, from the RM strain involved in sensitivity to 4-NQO. The fact that the parental strains were resistant to 4-NQO indicated that at least one locus from BY was also required. We searched for additional loci by partitioning the segregants by their genotype at RAD5 and performed linkage analysis on the subgroups, but there were no regions showing a significant linkage. This negative result could simply reflect the reduced sample size of each subgroup.
A candidate gene approach was also pursued to identify additional factors from the BY parent involved in the sensitivity phenotype. Because we were able to recreate the 4-NQO hybrid sensitivity phenotype by replacing RAD5 in the BY strain with the RM copy, we used the BY::RAD5-RM strain to search for candidate RM genes that could suppress the 4-NQO-sensitive phenotype. We pursued this approach because we were able to suppress the 4-NQO-sensitive phenotype of the BY::RAD5-RM strain by introducing a single-copy ARS CEN plasmid containing RAD5-BY (data not shown). Single-copy plasmids containing the entire open reading frame and ∼250–500 bp of downstream and upstream sequence from the RM parent strain were created and transformed into the BY::RAD5-RM strain (Materials and Methods). Plasmids were made containing several candidate genes that were shown to physically and/or genetically interact with RAD5. These include POL30 and RAD18, whose gene products interact with RAD5 through two-hybrid analysis [28],[29], and CTF18, CSM3, RAD50 and TOF1, mutations in which are synthetically lethal with rad5 mutations [30]. None of these candidate genes derived from the RM parent strain suppressed the 4-NQO-sensitivity of the BY::RAD5-RM strain (Figure S4; data not shown).
4-NQO-Sensitive Phenotype Is Maintained after Several Backcrosses
A backcrossing strategy was pursued to identify a subset of BY loci linked to 4-NQO-sensitivity. To isolate these loci we backcrossed the BY::RAD5-RM strain to the RM parent. Because both parental strains contained the RAD5-RM allele, all progeny from this cross have the potential to show sensitivity. BY::RAD5-RM was crossed to the RM parental strain and a sensitive spore from this cross was backcrossed to the RM parent (3D-BK1, Figure 4). This backcross was repeated two more times (progeny labeled BK2 and BK3 for second and third backcross, respectively). After each backcross, haploid hybrid progeny were phenotype tested and segregants displaying sensitivity to 4-NQO were chosen and backcrossed to RM. After the first backcross, roughly 35% of the progeny displayed the 4-NQO-sensitive phenotype. Even after the third backcross a 2:2 4-NQO sensitive: resistant segregation pattern for each tetrad was not seen, suggesting that a large number of loci modify sensitivity to 4-NQO. At the end of backcrossing, the parental contribution of the final segregants was approximately 94% RM and 6% BY.
To determine if multiple genetic loci were segregating in the second backcross, two 4-NQO-sensitive segregants from the second backcross (∼12.5% BY and ∼87.5% RM) were mated and sporulated. Incomplete complementation (varying degrees of sensitivity) of the 4-NQO-sensitive phenotype was seen in progeny from this cross and in progeny from other crosses involving second backcross segregants (Figure 4; data not shown). Thus, multiple loci that contribute to the hybrid 4-NQO-sensitive phenotype are likely to be segregating in the second backcross because all the progeny from this cross display some degree of sensitivity (Figure 4).
Microarray-Assisted Bulk Segregant Analysis Implicates Two Genomic Loci in the 4-NQO Phenotype
Bulk segregant analysis followed by microarray SNP genotyping was used to identify loci that conferred 4-NQO sensitivity in the third backcross lines. Genomic DNA was isolated from pooled resistant and sensitive segregants (40 from each set). The two pools were then hybridized to an Affymatrix reference sequence microarray that allows for the determination of inheritance between the two parental strains. Mapping was then performed (Materials and Methods; [31],[32]). If a locus is unlinked to the phenotype, it will not show preferential inheritance in either pooled sample and therefore will show an averaged baseline of inheritance (Figure 5C). For a linked locus, the genomic DNA in one pool will be enriched for one parental inheritance, and therefore will show a peak of inheritance when comparing the array results across the pooled progeny of the phenotype (Figures 5A and B). This method allowed us to screen a large number of segregants and measure the average genotype of progeny within each pool. From this analysis, two regions were identified that segregated preferentially with the 4-NQO phenotype (Figure 5). These regions are on chromosome 7, between 433,546 bp and 551,683 bp (smoothed value of >1), with the peak at 463,019 bp, and on chromosome 14, between 437,935 bp and 473,640 bp (smoothed value of >1.5), with the peak at 467,209 bp (Figure 5A and B). The regions mapped are large, approximately 118 kb and 36 kb in length for chromosome 7 and 14, respectively. This may be due to the backcrossing and the nature of pooled segregant analysis, but also could be due to several genes within each region contributing to the phenotype. We focused on candidate genes located near the peak of each region.
BY-Derived MKT1 Contributes to Hybrid 4-NQO-Sensitive Phenotype
For the chromosome 7 linkage region, the peak includes KAP122, which encodes a protein involved in importing the TOA1-TOA2 complex into the nucleus. This gene has been implicated in regulation of pleiotropic drug resistance [33], making it an excellent candidate to test for suppression. A second candidate gene, PDR1, maps to within 6 kb of the peak and was chosen because it also encodes a protein involved in the pleiotropic drug response [34]. Due to the large size of this region (>100 kb), we focused our analysis on these two genes. For the chromosome 14 linkage region, the peak lies near MKT1, which was named for it role in the maintenance of K2 killer toxin [35], and has been implicated in the posttranscriptional regulation of HO endonuclease [36]. This region has also been implicated in high temperature growth, sporulation, and expression quantitative traits [3],[37],[38],[39]. Sequence analysis of the RM and BY strains indicated that KAP122, PDR1, and MKT1 each contain non-synonymous and synonymous polymorphisms within their coding regions.
KAP122, PDR1, and MKT1 containing ∼500 bp of upstream and downstream sequence were cloned from both the RM and BY strains and inserted into ARS CEN plasmids (Table 3). These plasmids were introduced into 4-NQO-sensitive spores derived from the third backcross of BY::RAD5-RM×RM (3DBK3-12 and 3DBK3-52, included in the bulk segregant analysis). None of the KAP122 and PDR1 plasmids suppressed the 4-NQO phenotype of these segregants (data not shown). However, MKT1 derived from the RM parent suppressed the 4-NQO phenotype of these segregants and other segregants from the third backcross (Figure 6; data not shown). Neither of the parental derived alleles of MKT1 conferred increased sensitivity or resistance when inserted into a backcrossed segregant that did not show the 4-NQO-sensitive phenotype (3D-BK3-16, Figure 6).
Table 3. Plasmids.
Plasmid | Genotype |
pEAA403 | LYS2, ARSH4, CEN6, aatR1::CmR-ccdB::attR2 |
pEAA404 | MKT1-BY, LYS2, ARSH4, CEN6 |
pEAA405 | MKT1-RM, LYS2, ARSH4, CEN6 |
pEAA406 | KAP122-BY, LYS2, ARSH4, CEN6 |
pEAA407 | KAP122-RM, LYS2, ARSH4, CEN6 |
pEAA408 | PDR1-BY, LYS2, ARSH4, CEN6 |
pEAA409 | PDR1-RM, LYS2, ARSH4, CEN6 |
pEAA416 | RAD50-RM, LYS2, ARSH4, CEN6 |
pEAA430 | CSM3-RM, LYS2, ARSH4, CEN6 |
pEAA431 | RAD18-RM, LYS2, ARSH4, CEN6 |
pEAA433 | CTF18-RM, KanMX, ARSH4, CEN6 |
pEAA434 | PCNA-RM, KanMX, ARSH4, CEN6 |
pEAA435 | TOF1-RM, KanMX, ARSH4, CEN6 |
pEAI207 | RAD5-BY::KanMX |
pEAI208 | RAD5-RM::KanMX |
pEAI209 | RAD5-BY::NatMX |
pEAI210 | RAD5-RM::NatMX |
pEAI213 | RAD5-I791S::KanMX |
pEAI214 | RAD5-E783D::KanMX |
As a further test, we deleted the MKT1 gene present in the third backcross of BY::RAD5-RM×RM (3DBK3-12 and 3DBK3-52) and introduced into these strains the ARS CEN plasmids bearing the RM and BY derived MKT1 alleles. As shown in Figure 6, these strains displayed the same phenotype as was observed for the plasmid suppression in the parental third backcross strains, indicating that the MKT1-BY allele contributed to 4-NQO-sensitivity. We attempted to test suppression of the 4-NQO-sensitive phenotype in the backcrossed strains using homologous replacement of MKT1; however, we were unable to do so because the selectable marker used for integration interfered with MKT1 function.
Because we did not see a significant LOD score for the MKT1 locus in the original linkage analysis, we suspected that additional alleles are contributing to sensitivity to 4-NQO in the original BY/RM hybrid progeny. To test this, we looked for allele-specific suppression by MKT1-RM in the original BY/RM meiotic spore progeny that showed sensitivity to 4-NQO (Figure 7). Some of the original hybrid progeny showed allele-specific suppression of 4-NQO-sensitivity (segregants 16 and 27, genotype MKT1-BY and RAD5-BY) while others did not (segregants 20 and 29, genotype MKT1-RM and RAD5-RM). In a resistant segregant, no phenotypic difference was seen between the plasmids (segregant 52, genotype MKT1-RM and RAD5-BY). These observations are consistent with multiple genes contributing to the 4-NQO sensitivity phenotype. Finally, to determine whether the MKT1 and RAD5 alleles show non-additive interaction with respect to sensitivity to 4-NQO, we plotted the semi-quantitative phenotype for 4-NQO shown in Table 1 against the RAD5- and MKT1-region genotypes (Figure 8). This analysis shows that the loci do not strongly interact (see Discussion) and that the most extreme genotypes are recombinant: the RAD5-RM, MKT1-BY genotype is the most sensitive, while the RAD5-BY, MKT1-RM genotype is the most resistant. This is consistent with what we observed in the backcrosses where the MKT1-BY allele was associated with sensitivity to 4-NQO in a RAD5-RM background (Figure 6).
Discussion
We identified and dissected a complex trait, sensitivity to the DNA damaging agent 4-NQO, in hybrid progeny of baker's yeast. Through linkage mapping of genotyped hybrid progeny, we identified a major effect locus, RAD5, and identified the causative polymorphism. Using a backcrossing strategy along with microarray-assisted bulk segregant analysis we identified other QTL that contribute to the variability seen in the 4-NQO-sensitivity phenotype. The identification of a major effect locus likely contributed to our ability to map minor effect loci for sensitivity to 4-NQO.
Determining the number of loci that underlie a quantitative trait can be difficult due to epistasis, penetrance, and environmental factors that influence the phenotype. The 4-NQO- sensitive phenotype was seen at varying levels in about a quarter of the hybrid RM/BY progeny tested, indicating a minimum of two contributing loci. Backcrossing and bulk segregant analysis indicated that at least two other loci, including MKT1, contribute to a lesser degree to the sensitive phenotype observed in the hybrid progeny. The number of modifier QTL is likely greater than two due to the lack of suppression observed in some of the F1 hybrid progeny by MKT1 (Figure 7).
After backcrossing, we were able to identify a large QTL region (∼118 kb) located on chromosome 7; however, a candidate gene approach was unsuccessful. There are many difficulties in finding functional variants in large QTL. Steinmetz et al. [8] identified two QTL in yeast (chromosome XIV, 52 kb, and chromosome XVI, 8 kb-not pursued further) that mapped to a heat resistance trait. Using reciprocal hemizygosity, they identified three genes in the chromosome XIV QTL linked to this phenotype. Using a backcrossing approach, Deutschbauer and Davis [38] identified four QTL in yeast (30-71 kb) linked to sporulation efficiency. They also performed reciprocal hemizygosity analysis and identified three genes linked to the phenotype. Finally, Perlstein et al. [10] mapped cell growth in the presence of 83 small molecule drugs to 219 QTL (42 kb on average) that localized to eight main regions in yeast. In their analysis they were able to identify two loci, primarily by candidate gene testing, that were linked to a particular drug sensitivity. Each of the above examples illustrates the complexity of mapping QTL to individual genes and the need for candidate gene testing. In our studies the large size (∼118 kb) of the Chromosome VII QTL suggests that candidate gene testing is likely to be very time consuming and more importantly, that the QTL is likely to be complex. The extended nature of the locus, despite extensive backcrossing, points to the possibility of a cluster of closely linked polymorphisms within the region causing the phenotype, making the identification of the individual genes difficult.
We found a major effect QTL in RAD5, and a minor effect modifier locus, MKT1. The RAD5 gene was a logical candidate gene within its QTL because it is required for resistance to a number of DNA damaging agents and is a component of an extensively studied DNA repair pathway [25],[28],[29]. In contrast, MKT1 has not been associated with any DNA damage pathway but has been identified in multiple QTL mapping studies performed in yeast, including sporulation and high temperature growth [3],[8],[37],[38]. In these studies, the same polymorphism in MKT1 (D30G) was associated with the phenotype. Sinha et al. [3] hypothesized that BY derived MKT1 is a loss of function allele and Deutschbauer et al. [38] showed that the MKT1 polymorphism in the BY strain is rare; it was not found in 13 other S. cerevisiae strains. This same allele is likely to be involved in sensitivity to 4-NQO.
It is unclear how the RAD5 and MKT1 alleles interact to create the 4-NQO-sensitive phenotype in the hybrid progeny. The observations that these loci do not strongly interact each other, and that spore progeny displayed a wider range of sensitivity phenotypes, suggest an additive model for sensitivity to 4-NQO (Figure 8). In such a model, each parental strain contains negative and positive alleles, making them appear similar to each other. Segregation of such alleles in progeny would be expected to yield a wide range of phenotypes, as was seen. In this model, the 4-NQO-sensitive effect is transgressive rather than reflecting a defective interaction between the MKT1 and RAD5 gene products. Consistent with the above argument is the fact that genome-wide analyses of the response to DNA damaging agents (deletion, global expression studies) have not shown a direct connection between RAD5 and MKT1 that could explain the 4-NQO-sensitive phenotype with respect to known DNA repair pathways [40]–[42].
It is important to note that many QTL interactions cannot be easily explained in terms of an established genetic pathway. For example, for high temperature growth, the genes MKT1, END3 (involved in endocytosis) and RHO2 (a non essential GTPase) have been identified as QTL; how these three genes interact to confer heat resistance is unclear because no other genetic interactions involving these genes have been identified [3],[8]. MKT1 has been shown to contribute to 4-NQO sensitivity, high temperature growth, and sporulation phenotypes. The fact that a single modifier could be involved in such a variety of phenotypes suggests that a candidate gene approach that tests previously identified modifiers should be considered when searching for loci that underlie a complex trait.
The RAD5-RM polymorphism conferred varying degrees of sensitivity to 4-NQO in RM/BY hybrid progeny. The scientific literature contains numerous examples in which an allele confers a more severe phenotype in one genetic background relative to another (e.g. [9],[14],[43]). In addition, environmental and background effects have been shown to affect the penetrance of many cancers (e.g. [11],[12]). Such effects are thought to be due to DNA sequence differences at multiple genetic loci that lead to molecular incompatibilities between gene products, between gene products and cis-acting sequences that function in specific pathways, negative epistatic interactions uncovered by haploinsufficiency, or as shown here, additive effects involving multiple QTL. Identifying such complex traits in a genetically tractable system is of great interest because they provide testable models to study disease penetrance (e.g. [3],[8],[17]).
Materials and Methods
Strains and Plasmids
S. cerevisiae parental strains, BY and RM, and BY/RM hybrid segregants (Table 1) were tested in this study [9]. Additional strains used in this study are listed in Table 2. Yeast strains were grown in yeast extract/peptone/dextrose (YPD), minimal complete or minimal selective media [44]. When required, nourseothricin (Werner Bioagents) or G418 sulfate (Cellgro) were included in YPD at 200 mg/l [44],[45]. Sporulation plates and procedures were as described previously [43],[46]. EAY253 (rad52Δ::LEU2, ura3-52, leu2Δ1, his3Δ200) was used as a control strain in the 4-NQO, MMS, bleomycin, and caffeine plating assays.
Plasmids used in this study are shown in Table 3. All of the plasmids are derived from the pRS vector series [47]. pRS317 was modified to contain the Gateway cloning cassette (Invitrogen). Each gene was amplified from BY or RM genomic DNA [44] using Pfu turbo polymerase (Stratagene). Primer sequences used to amplify these genes are available upon request. Each PCR product, which contained the entire open reading frame and at least 250 bp of upstream and downstream sequence, was gel purified and cloned into pENTR/D-TOPO entry vector (Invitrogen). The structure and sequence of all entry clones were verified by restriction endonuclease digestion followed by DNA sequencing. Subcloning of each gene from the pENTR/D-TOPO vector into pEAA403 (LYS2, ARSH4, CEN6, aatR1::CmR-ccdB::attR2) was performed via LR recombination (Invitrogen). All of the resulting constructs were expressed via their native promoters. Plasmids were transformed into each strain using standard methods [48] and were selected for on lysine minimal dropout plates.
The RAD5 integration vectors, pEAI209 (RAD5-BY::NatMX) and pEAI210 (RAD5-RM::NatMX) contain RAD5 amplified from BY and RM genomic DNA, respectively [44]. The sequences were amplified using Pfu turbo polymerase (Stratagene) and primers AO990 (5′CAGGACACTGACAACGAATTGC) and AO991 (5′GTTTGCGTTAGAGCAATTCC). The PCR amplified product containing the entire RAD5 open reading frame plus 450 bp upstream and 700 bp downstream sequence was digested with PstI and SalI and inserted into the corresponding sites of pUC19. The entire PCR fragment was DNA sequenced. Using overlapping PCR and subcloning, BamHI and NotI sites were added 30 bp downstream of the RAD5 stop codon using AO946 (5′GAGAAAGAGCTAACTCATACTT), AO1023 (5′CGACTAGTGCGGCCGCTAGTCGGGATCCAAAGTCTTTATATATGAGTATG), AO1024 (5′CGACTAGTGGATCCCGACTAGCGGCCGCATTTATTATTATTTTCAACC) and AO616 (5′CGCCATTCAGGCTGCGCAACT). The NatMX gene from pAG25 [49] was then inserted into these BamH1 and NotI sites. Integration plasmids were also made that contained KanMX downstream of RAD5, pEAI207 (RAD5-BY::KanMX) and pEAI208 (RAD5-RM::KanMX), using the same procedure. All RAD5 point mutations were made in pEAI207 using the QuickChange XL Site-Directed Mutagenesis protocol (Stratagene, USA). A fragment containing the point mutation was then subcloned into unmutagenized pEAI207 and sequenced to determine that only the desired mutation was created.
For homologous replacement of RAD5, integration plasmids pEAI209, pEAI210, pEAI213, and pEAI214 were digested with XbaI and NheI and the fragments were transformed into BY and RM using standard methods [48]. Integrations were selected on YPD media containing G418 sulfate or nourseothricin [45]. Each allele was PCR amplified and sequenced to determine that only the desired mutations were created.
Two strains from the third backcross of RM×BY-RAD5-RM, 3DBK3-12 (EAY2295) and 3DBK3-52 (EAY2298), were transformed with a mkt1Δ::NatMX DNA fragment to create EAY2317 and EAY2323, respectively (Table 2). This fragment contains NatMX flanked by 50 bp of MKT1 sequence upstream of the MKT1 ATG and 50 bp of MKT1 sequence downstream of the MKT1 stop codon. It was created by PCR amplifying pAG25 with primers AO2014 (5′TGAACTATAAAGTACTAAAGGCAGAAAAATTAATAGCAAATTAAGCGATGCGTACGCTGCAGGTCGAC) and AO2015 (5′TGCTTTTTAAATAGTTCCACTATTTCCATCATA CTCATTCTCACGCTTCAA TCGATGAATTCGAGCTCG). Integrations were selected for on YPD media containing nourseothricin and the mkt1Δ::NatMX mutation was confirmed by PCR.
Plating Assays
RM, BY, and hybrid segregants were grown to saturation in YPD liquid media. The cultures were then diluted in water and spotted in 10-fold serial dilutions (undiluted to 10−5) onto YPD media containing 0.03% MMS (vol/vol) (Sigma), 0.25 µg/ml or 0.30 µg/ml 4-NQO (Sigma), 10 mM caffeine (Sigma), or 10 µg/ml bleomycin (Sigma) [22]. Plates were photographed after a 2-day incubation at 30 C. Each segregant was scored according to growth on non-treatment and treatment plates and were tested at least three independent times for each phenotype reported in Table 1. Phenotypes were scored for linkage analysis using a semi-quantitative method based on the phenotypes reported in Table 1 in which each phenotype group was assigned a unique category (below).
Linkage Analysis
Linkage analysis on 121 segregants with genotype information was performed in R/qtl [50] using the non-parametric model. Genotypes were previously generated by DNA hybridization to Affymetrix 25-mer arrays [20]. Permutations (4000x per phenotype) were performed to obtain a significance cutoff where p = 0.0125 (0.05/the number of traits: 4). This corresponded to LOD scores of 3.9, 3.8, 3.8, and 3.7 for MMS-, 4-NQO-, bleomycin-, and caffeine-sensitivity, respectively (Figure 2). Support intervals defined by a 1.5 drop in LOD score from the peak were calculated using the lodint function in R/qtl.
Tiling Array Analysis
DNA samples were prepared by pooling 5 ml YPD overnight cultures from 40 backcrossed individuals that were resistant and 40 that were sensitive to 4-NQO. Genomic DNA was prepared separately from the resistant and sensitive pooled cultures using the QIAGEN Genomic-tip 500/G kit (Qiagen). The pooled gDNA samples were hybridized to Affymetrix tiling arrays containing Watson strand 25-mers tiled every 4 bp (BY reference genome). The log10 ratio of intensity values was calculated for every probe that was considered to contain a sequence variant between BY and RM by SNPscanner [51]. The log10 (intensity difference) was plotted along the chromosome and smoothed using the smooth.spline function in the stats package of R. Regions where the smoothed value exceeded +/−1 were further investigated.
Supporting Information
Acknowledgments
We are grateful to Doug Ruderfer for assistance with the tiling array analysis, and Chip Aquadro, Dan Barbash, David Botstein, and Sarah Zanders for intellectual contributions.
Footnotes
The authors have declared that no competing interests exist.
This work was supported by NIH grants GM53085 (EA) and MH059520 (LK), a James S. McDonnell Foundation Centennial Fellowship (LK), NIH grant GM071508 to the Lewis-Sigler Institute (ES, LK) and a Cornell Center for Advanced Technologies Innovation Award (AD, EA).
References
- 1.Glazier AM, Nadeau JH, Aitman TJ. Finding genes that underlie complex traits. Science. 2002;298:2345–2349. doi: 10.1126/science.1076641. [DOI] [PubMed] [Google Scholar]
- 2.Wu R, Lin M. Functional mapping-how to map and study the genetic architecture of dynamic complex traits. Nat Rev Genet. 2006;7:229–237. doi: 10.1038/nrg1804. [DOI] [PubMed] [Google Scholar]
- 3.Sinha H, Nicholson BP, Steinmetz LM, McCusker JH. Complex genetic interactions in a quantitative trait locus. PLoS Genet. 2006;2:e13. doi: 10.1371/journal.pgen.0020013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Gerke JP, Chen CT, Cohen BA. Natural isolates of Saccharomyces cerevisiae display complex genetic variation in sporulation efficiency. Genetics. 2006;174:985–997. doi: 10.1534/genetics.106.058453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Witten JT, Chen CT, Cohen BA. Complex genetic changes in strains of Saccharomyces cerevisiae derived by selection in the laboratory. Genetics. 2007;177:449–456. doi: 10.1534/genetics.107.077859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Kim HS, Fay JC. Genetic variation in the cysteine biosynthesis pathway causes sensitivity to pharmacological compounds. Proc Natl Acad Sci USA. 2007;104:19387–19391. doi: 10.1073/pnas.0708194104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Abiola O, Angel JM, Avner P, Bachmanov AA, Belknap JK, et al. The nature and identification of quantitative trait loci: a community's view. Nat Rev Genet. 2003;4:911–916. doi: 10.1038/nrg1206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Steinmetz LM, Sinha H, Richards DR, Spiegelman JI, Oefner PJ, et al. Dissecting the architecture of a quantitative trait locus in yeast. Nature. 2002;416:326–330. doi: 10.1038/416326a. [DOI] [PubMed] [Google Scholar]
- 9.Brem RB, Yvert G, Clinton R, Kruglyak L. Genetic dissection of transcriptional regulation in budding yeast. Science. 2002;296:752–755. doi: 10.1126/science.1069516. [DOI] [PubMed] [Google Scholar]
- 10.Perlstein EO, Ruderfer DM, Roberts DC, Schreiber SL, Kruglyak L. Genetic basis of individual differences in the response to small-molecule drugs in yeast. Nat Genet. 2007;39:496–502. doi: 10.1038/ng1991. [DOI] [PubMed] [Google Scholar]
- 11.Gillanders EM, Xu J, Chang BL, Lange EM, Wiklund F, et al. Combined genome-wide scan for prostate cancer susceptibility genes. J Natl Cancer Inst. 2004;96:1240–1247. doi: 10.1093/jnci/djh228. [DOI] [PubMed] [Google Scholar]
- 12.Fijneman RJ. Genetic predisposition to sporadic cancer: how to handle major effects of minor genes? Cell Oncol. 2005;27:281–292. doi: 10.1155/2005/737191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kariola R, Otway R, Lonnqvist KE, Raevaara TE, Macrae F, et al. Two mismatch repair gene mutations found in a colon cancer patient–which one is pathogenic? Hum Genet. 2003;112:105–109. doi: 10.1007/s00439-002-0866-4. [DOI] [PubMed] [Google Scholar]
- 14.Heck JA, Argueso JL, Gemici Z, Reeves RG, Bernard A, et al. Negative epistasis between natural variants of the Saccharomyces cerevisiae MLH1 and PMS1 genes results in a defect in mismatch repair. Proc Natl Acad Sci USA. 2006;103:3256–3261. doi: 10.1073/pnas.0510998103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hoeijmakers JH. Genome maintenance mechanisms for preventing cancer. Nature. 2001;411:366–374. doi: 10.1038/35077232. [DOI] [PubMed] [Google Scholar]
- 16.Loeb LA, Loeb KR, Anderson JP. Multiple mutations and cancer. Proc Natl Acad Sci USA. 2003;100:776–81. doi: 10.1073/pnas.0334858100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lipkin SM, Rozek LS, Rennert G, Yang W, Chen PC, et al. The MLH1 D132H variant is associated with susceptibility to sporadic colorectal cancer. Nat Genet. 2004;36:694–699. doi: 10.1038/ng1374. [DOI] [PubMed] [Google Scholar]
- 18.Mortimer RK, Romano P, Suzzi G, Polsinelli M. Genome renewal: a new phenomenon revealed from a genetic study of 43 strains of Saccharomyces cerevisiae derived from natural fermentation of grape musts. Yeast. 1994;10:1543–1552. doi: 10.1002/yea.320101203. [DOI] [PubMed] [Google Scholar]
- 19.Yvert G, Brem RB, Whittle J, Akey JM, Foss E, et al. Trans-acting regulatory variation in Saccharomyces cerevisiae and the role of transcription factors. Nat Genet. 2003;35:57–64. doi: 10.1038/ng1222. [DOI] [PubMed] [Google Scholar]
- 20.Brem RB, Kruglyak L. The landscape of genetic complexity across 5,700 gene expression traits in yeast. Proc Natl Acad Sci USA. 2005;102:1572–1577. doi: 10.1073/pnas.0408709102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Winzeler EA, Richards DR, Conway AR, Goldstein AL, Kalman S, et al. Direct allelic variation scanning of the yeast genome. Science. 1998;281:1194–1197. doi: 10.1126/science.281.5380.1194. [DOI] [PubMed] [Google Scholar]
- 22.Hampsey M. A review of phenotypes in Saccharomyces cerevisiae. Yeast. 1997;13:1099–1133. doi: 10.1002/(SICI)1097-0061(19970930)13:12<1099::AID-YEA177>3.0.CO;2-7. [DOI] [PubMed] [Google Scholar]
- 23.Johnson RE, Henderson ST, Petes TD, Prakash S, Bankmann M, et al. Saccharomyces cerevisiae RAD5-encoded DNA repair protein contains DNA helicase and zinc-binding sequence motifs and affects the stability of simple repetitive sequences in the genome. Mol Cell Biol. 1992;12:3807–3818. doi: 10.1128/mcb.12.9.3807. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Birrell GW, Giaever G, Chu AM, Davis RW, Brown JM. A genome-wide screen in Saccharomyces cerevisiae for genes affecting UV radiation sensitivity. Proc Natl Acad Sci USA. 2001;98:12608–12613. doi: 10.1073/pnas.231366398. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Chang M, Bellaoui M, Boone C, Brown GW. A genome-wide screen for methyl methanesulfonate-sensitive mutants reveals genes required for S phase progression in the presence of DNA damage. Proc Natl Acad Sci USA. 2002;99:16934–16939. doi: 10.1073/pnas.262669299. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Verleur N, Elgersma Y, Van Roermund CW, Tabak HF, Wanders RJ. Cytosolic aspartate aminotransferase encoded by the AAT2 gene is targeted to the peroxisomes in oleate-grown Saccharomyces cerevisiae. Eur J Biochem. 1997;247:972–980. doi: 10.1111/j.1432-1033.1997.00972.x. [DOI] [PubMed] [Google Scholar]
- 27.Fan HY, Cheng KK, Klein HL. Mutations in the RNA polymerase II transcription machinery suppress the hyperrecombination mutant hpr1 delta of Saccharomyces cerevisiae. . Genetics. 1996;142:749–759. doi: 10.1093/genetics/142.3.749. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Hoege C, Pfander B, Moldovan GL, Pyrowolakis G, Jentsch S. RAD6-dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature. 2002;419:135–141. doi: 10.1038/nature00991. [DOI] [PubMed] [Google Scholar]
- 29.Ulrich HD, Jentsch S. Two RING finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair. EMBO J. 2000;19:3388–3397. doi: 10.1093/emboj/19.13.3388. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Tong AH, Lesage G, Bader GD, Ding H, Xu H, et al. Global mapping of the yeast genetic interaction network. Science. 2004;303:808–813. doi: 10.1126/science.1091317. [DOI] [PubMed] [Google Scholar]
- 31.Brauer MJ, Christianson CM, Pai DA, Dunham MJ. Mapping novel traits by array-assisted bulk segregant analysis in Saccharomyces cerevisiae. Genetics. 2006;173:1813–1816. doi: 10.1534/genetics.106.057927. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Segrè AV, Murray AW, Leu JY. High-resolution mutation mapping reveals parallel experimental evolution in yeast. PLoS Biol. 2006;4:e256. doi: 10.1371/journal.pbio.0040256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Titov AA, Blobel G. The karyopherin Kap122p/Pdr6p imports both subunits of the transcription factor IIA into the nucleus. J Cell Biol. 1999;147:235–246. doi: 10.1083/jcb.147.2.235. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Akache B, MacPherson S, Sylvain MA, Turcotte B. Complex interplay among regulators of drug resistance genes in Saccharomyces cerevisiae. J Biol Chem. 2004;279:27855–27860. doi: 10.1074/jbc.M403487200. [DOI] [PubMed] [Google Scholar]
- 35.Wickner RB. MKT1, a nonessential Saccharomyces cerevisiae gene with a temperature-dependent effect on replication of M2 double-stranded RNA. J Bacteriol. 1987;169:4941–4945. doi: 10.1128/jb.169.11.4941-4945.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Tadauchi T, Inada T, Matsumoto K, Irie K. Posttranscriptional regulation of HO expression by the Mkt1-Pbp1 complex. Mol Cell Biol. 2004;24:3670–3681. doi: 10.1128/MCB.24.9.3670-3681.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Ben-Ari G, Zenvirth D, Sherman A, David L, Klutstein M, et al. Four linked genes participate in controlling sporulation efficiency in budding yeast. PLoS Genet. 2006;2:e195. doi: 10.1371/journal.pgen.0020195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Deutschbauer AM, Davis RW. Quantitative trait loci mapped to single-nucleotide resolution in yeast. Nat Genet. 2005;37:1333–1340. doi: 10.1038/ng1674. [DOI] [PubMed] [Google Scholar]
- 39.Zhu J, Zhang B, Smith EN, Drees B, Brem R, Kruglyak L, Bumgarner R, Schadt EE. Integrating large-scale functional genomic data to dissect the complexity of yeast regulatory networks. Nat Genet in press. 2008 doi: 10.1038/ng.167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Gasch AP, Huang M, Metzner S, Botstein D, Elledge SJ, et al. Genomic expression responses to DNA-damaging agents and the regulatory role of the yeast ATR homolog Mec1p. Mol Biol Cell. 2001;12:2987–3003. doi: 10.1091/mbc.12.10.2987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Lee MW, Kim BJ, Choi HK, Ryu MJ, Kim SB, et al. Global protein expression profiling of budding yeast in response to DNA damage. Yeast. 2007;24:145–154. doi: 10.1002/yea.1446. [DOI] [PubMed] [Google Scholar]
- 42.Workman CT, Mak HC, McCuine S, Tagne JB, Agarwal M, et al. A systems approach to mapping DNA damage response pathways. Science. 2006;312:1054–1059. doi: 10.1126/science.1122088. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Argueso JL, Kijas AW, Sarin S, Heck J, Waase M, Alani E. Systematic mutagenesis of the Saccharomyces cerevisiae MLH1 gene reveals distinct roles for Mlh1p in meiotic crossing over and in vegetative and meiotic mismatch repair. Mol Cell Biol. 2003;23:873–886. doi: 10.1128/MCB.23.3.873-886.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Rose MD, Winston FM, Hieter P. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press; 1990. Methods in yeast genetics : a laboratory course manual. [Google Scholar]
- 45.Wach A, Brachat A, Pohlmann R, Philippsen P. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast. 1994;10:1793–1808. doi: 10.1002/yea.320101310. [DOI] [PubMed] [Google Scholar]
- 46.Pang Q, Prolla TA, Liskay RM. Functional domains of the Saccharomyces cerevisiae Mlh1p and Pms1p DNA mismatch repair proteins and their relevance to human hereditary nonpolyposis colorectal cancer-associated mutations. Mol Cell Biol. 1997;17:4465–4473. doi: 10.1128/mcb.17.8.4465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Sikorski RS, Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 1989;122:19–27. doi: 10.1093/genetics/122.1.19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Gietz RD, Schiestl RH. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat Protoc. 2007;2:31–34. doi: 10.1038/nprot.2007.13. [DOI] [PubMed] [Google Scholar]
- 49.Goldstein AL, McCusker JH. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 1999;15:1541–1553. doi: 10.1002/(SICI)1097-0061(199910)15:14<1541::AID-YEA476>3.0.CO;2-K. [DOI] [PubMed] [Google Scholar]
- 50.Broman KW, Wu H, Sen S, Churchill GA. R/qtl: QTL mapping in experimental crosses. Bioinformatics. 2003;19:889–890. doi: 10.1093/bioinformatics/btg112. [DOI] [PubMed] [Google Scholar]
- 51.Gresham D, Ruderfer DM, Pratt SC, Schacherer J, Dunham MJ, et al. Genome-wide detection of polymorphisms at nucleotide resolution with a single DNA microarray. Science. 2006;311:1932–1936. doi: 10.1126/science.1123726. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.