Abstract
Purpose
To identify mutations in the LIM2 gene in families with hereditary congenital or juvenile-onset cataract.
Methods
Forty families (total of 100 affected and 84 unaffected individuals) were recruited for the study. Probands were screened for pathogenic alterations in 10 different candidate genes including the lens intrinsic membrane protein-2 (LIM2) gene. Exons and flanking regions were screened by polymerase chain reaction (PCR) amplification, single-strand conformation polymorphism, and sequencing. Sequence changes were evaluated in 75 unrelated normal controls.
Results
A missense mutation, Gly154Glu, was found in LIM2 in one family with four individuals diagnosed with autosomal recessive cataract from two generations. An evaluation of seven individuals (four affected and three unaffected) showed that the mutation was homozygous in the affected members and heterozygous in unaffected members tested. It was absent in 75 unrelated ethnically matched normal controls. All affected individuals had a severe phenotype of congenital cataracts and visual impairment.
Conclusions
The Gly154Glu mutation involves a non-conservative change that presumably results in loss of function of the MP19 protein. This study shows the involvement of LIM2 in human congenital cataract.
Introduction
Blindness due to cataract represents a major cause of treatable blindness in different parts of the world [1-3]. Cataract in infants and children carries the risk of irreversible visual loss or amblyopia due to improper visual inputs to the brain, and cataract-related amblyopia accounts for 8% of blindness in children in southern India [4]. Loss of transparency of the lens can be a result of multiple factors that cause changes in the cellular or macromolecular organization in the lens, which result in light scattering and opacification. Hereditary cataracts arising from single gene mutations have provided insights into some of the structural and functional requirements for lens transparency. So far, 16 genes are identified to cause autosomal dominant congenital cataract [5], and eight genes are identified for autosomal recessive cataract [5-8].
The lens intrinsic membrane protein-2 gene (LIM2) encodes an abundant integral lens membrane protein of 19 kDa, MP19 (alternatively known as MP17/MP18/MP20). The function of MP19 is not clearly understood as yet. It localizes to junctional regions of the lens fiber cell membrane as well as throughout fiber cell membranes, suggesting a role in lens junctional communication [9,10]. MP19 has been shown to be absent from proliferating epithelial cells in the lens with expression becoming prominent in differentiating cells as well as in mature lens fiber cells [11,12]. It binds calmodulin [13,14] as well as galectin, a protein associated with lens cell membranes [15]. While various models have been proposed for MP19 topology, it is predicted to have four transmembrane segments and two extracellular [16,17] with NH2- and COOH-termini in the cytoplasm or with the NH2-terminus integrated into the membrane [18].
Evidence for the role of LIM2 in cataract came initially from the To3 mouse, an ENU (ethyl nitroso-urea)-induced mutant that demonstrated a semi-dominant cataract that mapped to the same region as Lim2 on mouse chromosome 7 [19]. While both heterozygous and homozygous mutants had dense cataracts, homozygotes also had microphthalmia, disorganization of lens fibers, and rupture of the lens capsule [19,20]. The To3 mutation was identified as a Gly15Val change in Lim2 [20]. A similar cataract phenotype was also reproduced in transgenic mice carrying the Lim2 transgene with the same mutation [21]. Lim2 homozygous knockout mice were found to have pulverulent nuclear opacities and altered refractive properties of the lens whereas heterozygotes had normal lenses [22], suggesting that loss of function of Lim2 is responsible for the phenotype. To date, there has been one report of human hereditary cataract arising from a mutation in LIM2 in a family with autosomal recessive presenile cortical cataract with a missense mutation, Phe105Val [23].
Here, we report a homozygous missense mutation in LIM2 in a family with autosomal recessive cataract of congenital onset.
Methods
Patients and sample collection
Probands presenting at the pediatric ophthalmology clinic of our institution with a diagnosis of congenital or developmental cataract were recruited for the study based on an ophthalmic evaluation by slit lamp biomicroscopy of probands and available family members by two independent ophthalmologists. Inclusion criteria were the presence of a bilateral cataract of congenital or developmental type based on history and/or examination. Exclusion criteria were a history of trauma, unilateral (non-familial) cataract, co-existing ocular disease, mental retardation, microcephaly, cerebral palsy, systemic syndromes, and maternal history of intrauterine infections or antenatal steroid use. After prior approval of the protocol by the Institutional Review Board of the L.V. Prasad Eye Institute (Hyderabad, India), informed consent was obtained from participants, blood samples (2-8 ml) from the probands and family members were collected in heparin-coated vacutainers by venipuncture, and family history, pedigree, and clinical data were recorded. Forty families were recruited as part of the study. They consisted of 30 families with dominant cataracts and 10 families with recessive cataracts with a total of 100 affected and 84 unaffected individuals.
Mutational analysis
Genomic DNA was extracted from blood leukocytes by the standard phenol-chloroform method. Ten candidate genes (six crystallin genes, two connexin genes, LIM2, and the heat shock factor 4 (HSF4) gene) were screened for mutations in probands from all families. The gene sequences were retrieved from the Ensembl database. Suitable primers for polymerase chain reaction (PCR) amplification of exons and flanking sequences of LIM2 were designed using primer design software. Primer sequences used are as shown in Table1. PCR was performed by using 50 ng of DNA template, 5 pmol each of forward and reverse primers, 1 unit of Taq DNA polymerase (Bangalore Genei, Bangalore, India), and 0.2 mM dNTPs in a total volume of 25 μl. Cycling conditions were as follows: initial denaturation at 94 °C for 2 min and 35 cycles of denaturation at 94 °C for 30 s, annealing at 51–53 °C for 30 s, and elongation at 72 °C for 45 s followed by one cycle of final extension at 72 °C for 8 min.
Table 1. Details of polymerase chain reaction primers for LIM2 amplification.
Exon |
Primer name |
Primer sequence (5′-3′) |
Product size (bp) |
Annealing Temp (°C) |
I |
LIM 1F |
CCATTGTGTAGGGAGGCTTA |
213 |
52 |
LIM 1R |
AGGTCCTGGGAGAAGAAGG |
|||
II |
LIM 2AF |
CAGTTCCTCCCTTCAAGTCC |
159 |
53 |
LIM 2AR |
ACTGCATCCAGTGGTCTGTT |
|||
LIM 2BF |
TGTACAGCTTCATGGGTGGT |
255 |
52 |
|
LIM 2BR |
TGGAATACAGGTGTCCTTGG |
|||
LIM 2CF |
TACCTGCAGACAGACAGCAT |
238 |
52 |
|
LIM 2CR |
CCCAACTTAACCTTCAAACC |
|||
III |
LIM 3F |
TCATCTCAGAGGTAGCAGCA |
279 |
52 |
LIM 3R |
ATTGGGGTTTGAGATGAGAG |
|||
IV |
LIM 4F |
AAAATCACACCCAGCCTTAG |
248 |
51 |
LIM 4R |
ACTCTATCTGCTGCCCACTC |
|||
V |
LIM 5F |
GGTGTTGGGCTCTCTTG |
231 |
51 |
LIM 5R | CTAGGAACCAGGATTTCA |
Sequences of forward (F) and reverse (R) primers used for amplification of LIM2 exons are shown above along with sizes of PCR products for each primer pair. Exon 2 was amplified in three fragments using primer sets denoted 2A-2C.
PCR products were mixed with two volumes of formamide. Samples were denatured by heating at 95 °C for 5 min and then snap chilled. The products were then subjected to electrophoresis on 8% polyacrylamide gels containing 5% glycerol. All samples were electrophoresed at room temperature and at 4 °C. The variants observed on single-strand conformation polymorphism (SSCP) analysis were identified by bi-directional dideoxy sequencing of the relevant PCR products using fluorescent automated methods. Screening for the observed mutation or variation was performed on DNA from 75 ethnically matched, unrelated normal controls using SSCP. Family members of the proband were tested to check for cosegregation of the sequence change with disease. Designation of sequence changes is according to the cDNA sequence of human LIM2. Human LIM2 sequences were obtained from the Vega genome browser; human transcript ID OTTHUMT00000151603 and gene ID OTTHUMG00000071186. The mouse Lim2 genomic sequence (gene ID ENSMUSG000000046134) was from Ensembl.
To assess the probable effect of an amino acid substitution on the protein, SIFT (Sorting Intolerant from Tolerant) scores were obtained by using SIFT software. SIFT aligns sequences homologous to the protein of interest from the databases and predicts whether a specific amino acid substitution will be tolerated by calculating normalized probabilities (range from 0 to 1) for each substitution at a particular position. Scores below a threshold of 0.05 are predicted to be deleterious and those above the threshold are predicted as tolerated [24,25].
Results
Screening of probands from 40 families for pathogenic mutations revealed one mutation in LIM2 in one family (pedigree in Figure 1). There were four affected individuals from two generations (IV:2, IV:3, V:5, and V:6 in Figure 1). All four individuals were offspring of consanguineous marriages. In addition to the four affected members, three other unaffected relatives-the mother (IV:5), the father (III:8), and the maternal grandfather (II:4) of the proband-were evaluated.
Sequence analysis showed a change of c.587G>A in human LIM2 cDNA (Figure 2) involving a codon change of GGG>GAG, which leads to a predicted glycine-154 to glutamic acid substitution (Gly154Glu). All four affected individuals in the family were homozygous for the mutant allele (Figure 2, bottom), and the three unaffected individuals tested were heterozygous (Figure 2, top). The change was absent in 75 ethnically matched normal controls.
The clinical features of the members analyzed are presented in Table 2. The proband presented to us at six years of age and was pseudophakic in both eyes with dense amblyopia. He had reportedly been affected since the age of three years, at which time he had cataract surgery. His visual acuity was 6/60 (20/200) in the right eye and counting fingers at 1 m in the left eye. His affected sibling was reported to have cataract since he was two years old. He was four years old at presentation and when he had cataract surgery. The proband’s maternal aunt and uncle also had congenital and developmental cataract respectively and were operated for cataract removal within the first decade of their lives (Table 2). All affected individuals had nystagmus and dense amblyopia.
Table 2. Mutational and clinical status of individuals from family with the LIM2 mutation.
Individual |
Relation with proband |
Age at presentation |
Age at onset |
Genotype |
Clinical status |
V:5 |
Proband |
6 years |
3 years |
GGG>GAG (homozygous) |
Total cataract, surgery at 3 years, amblyopia |
V:6 |
Sibling |
4 years |
1.5 years |
GGG>GAG (homozygous) |
Total cataract, surgery at 4 years, poor fixation, amblyopia |
IV:2 |
Maternal aunt |
35 years |
Birth |
GGG>GAG (homozygous) |
Surgery at 3 years, nystagmus, amblyopia |
IV:3 |
Maternal uncle |
29 years |
<8 years |
GGG>GAG (homozygous) |
Surgery at 10 years, nystagmus, amblyopia |
III:8 |
Father |
35 years |
- |
GGG>GAG (heterozygous) |
Normal |
IV:5 |
Mother |
27 years |
- |
GGG>GAG (heterozygous) |
Normal |
II:4 | Maternal grandfather | 55 years | - | GGG>GAG (heterozygous) | Normal |
Pedigree of the family is shown in Figure 1. The numbers for each individual in the left column are according to the pedigree drawing.
Discussion
The mutation described here is the second known human mutation in LIM2 causing hereditary cataract. It differs from the Phe105Val mutation reported by Pras and coworkers [23] in that the associated phenotype reported in their study was relatively mild with a late-onset of cataract, pulverulent cortical opacities, and mild or moderate visual loss. All affected individuals in the family studied by us had congenital cataracts evident at or shortly after birth with severe visual impairment as indicated by the presence of nystagmus and amblyopia. The absence of a phenotype in heterozygous carriers points to a loss of function of the Gly154Glu mutant MP19 protein as a possible cause of the disease. A substantial impact of the Gly154Glu mutation on protein structure is suggested by the non-conservative nature of the substitution, involving the replacement of a neutral, polar small amino acid (glycine) by a charged, larger amino acid (glutamic acid). Further, introduction of a charged amino acid into this position, which is predicted to be located within the fourth transmembrane segment of MP19 [16], would be presumably incompatible with the structure and topology of the protein in its wild type form. It is possible that the mutant may not be targeted to the membrane thus resulting in loss of function.
We used the SIFT tool [25] to assess the probable impact of the Gly154Glu substitution as compared with the Phe105Val found in human cataract [23] and the Gly15Val in To3 mouse [20]. This action yielded a score of 0 for the Gly154Glu mutation, thereby interpreting it as deleterious to protein function. A deleterious effect is also predicted for the mouse Gly15Val mutation, which gave a score of 0.03. On the other hand, the Phe105Val substitution has a SIFT score of 0.24, predicting that it would be tolerated. The predicted low impact of the Phe105Val mutation on the protein is compatible with the mild cataract observed in the individuals carrying the mutation [23]. However, the dominant effect of the To3 (Gly15Val) mutant is not explainable from existing data. A dominant negative effect of the To3 mutation was also suggested in studies on the Lim2 To3 transgenic mice, which demonstrated severe cataracts despite the amount of transgenic Lim2 mRNA present being much lower than wild type Lim2 mRNA [21]. Chen and coworkers [26] have shown that the MP19 To3 protein accumulates within the cytoplasm of transfected cells while the wild type MP19 localizes to the plasma membrane. They proposed that MP19 To3 is a deleterious gain of function mutant that might be cytotoxic in lens fibers. In contrast, homozygous Lim2 knockout mice had relatively mild changes consisting of pulverulent central opacities and changes in refractive properties of the lens [22]. Comparison of these latter observations with the recessive mutation identified in our study may imply a different role for MP19 in mice and humans. The effect of these mutations on the MP19 protein cannot be gauged fully until its function and physiological effects are understood.
The location of the Gly154 codon spans two exons including bases at the 3′ boundary of exon 4 and 5′ boundary of exon 5. The second base of the codon, which is the site of the G>A mutation, is located at the 5′ end of exon 5 next to the splice acceptor site. This raises the possibility that this mutation might have an additional effect on mRNA splicing, which needs to be investigated further.
The present study provides further evidence for the importance of LIM2 in maintaining the normal structure and function of the lens and demonstrates for the first time that a mutation in LIM2 results in human autosomal recessive congenital cataract.
Acknowledgments
The authors thank all the patients and their family members for participating in the project. Thanks are also due to Dr. Archana Bhargava and Dr. Sheik Fazal Hussain for systemic evaluation of patients. This study was supported by a grant from the Council for Scientific and Industrial Research (CSIR), Government of India, and by Hyderabad Eye Research Foundation. S.P.G. Ponnam was supported by a senior research fellowship from the CSIR.
References
- 1.Dandona L, Dandona R, Srinivas M, Giridhar P, Vilas K, Prasad MN, John RK, McCarty CA, Rao GN. Blindness in the Indian state of Andhra Pradesh. Invest Ophthalmol Vis Sci. 2001;42:908–16. [PubMed] [Google Scholar]
- 2.Wu M, Yip JL, Kuper H. Rapid Assessment of Avoidable Blindness in Kunming, China. Ophthalmology. 2008;115:969–74. doi: 10.1016/j.ophtha.2007.08.002. [DOI] [PubMed] [Google Scholar]
- 3.Congdon N, O'Colmain B, Klaver CC, Klein R, Munoz B, Friedman DS, Kempen J, Taylor HR, Mitchell P, Eye Diseases Prevalence Research Group. Causes and prevalence of visual impairment among adults in the United States. Arch Ophthalmol. 2004;122:477–85. doi: 10.1001/archopht.122.4.477. [DOI] [PubMed] [Google Scholar]
- 4.Dandona R, Dandona L. Childhood blindness in India: a population based perspective. Br J Ophthalmol. 2003;87:263–5. doi: 10.1136/bjo.87.3.263. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Shiels A, Hejtmancik JF. Genetic origins of cataract. Arch Ophthalmol. 2007;125:165–73. doi: 10.1001/archopht.125.2.165. [DOI] [PubMed] [Google Scholar]
- 6.Ponnam SP, Ramesha K, Tejwani S, Ramamurthy B, Kannabiran C. Mutation of the gap junction protein alpha 8 (GJA8) gene causes autosomal recessive cataract. J Med Genet. 2007;44:e85. doi: 10.1136/jmg.2007.050138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Ramachandran RD, Perumalsamy V, Hejtmancik JF. Autosomal recessive juvenile onset cataract associated with mutation in BFSP1. Hum Genet. 2007;121:475–82. doi: 10.1007/s00439-006-0319-6. [DOI] [PubMed] [Google Scholar]
- 8.Cohen D, Bar-Yosef U, Levy J, Gradstein L, Belfair N, Ofir R, Joshua S, Lifshitz T, Carmi R, Birk OS. Homozygous CRYBB1 deletion mutation underlies autosomal recessive congenital cataract. Invest Ophthalmol Vis Sci. 2007;48:2208–13. doi: 10.1167/iovs.06-1019. [DOI] [PubMed] [Google Scholar]
- 9.Louis CF, Hur KC, Galvan AC, TenBroek EM, Jarvis LJ, Eccleston ED, Howard JB. Identification of an 18,000-dalton protein in mammalian lens fiber cell membranes. J Biol Chem. 1989;264:19967–73. [PubMed] [Google Scholar]
- 10.Tenbroek E, Arneson M, Jarvis L, Louis C. The distribution of the fiber cell intrinsic membrane proteins MP20 and connexin46 in the bovine lens. J Cell Sci. 1992;103:245–57. doi: 10.1242/jcs.103.1.245. [DOI] [PubMed] [Google Scholar]
- 11.TenBroek EM, Johnson R, Louis CF. Cell-to-cell communication in a differentiating ovine lens culture system. Invest Ophthalmol Vis Sci. 1994;35:215–28. [PubMed] [Google Scholar]
- 12.Voorter CE, Kistler J, Gruijters WT, Mulders JW, Christie D, de Jong WW. Distribution of MP17 in isolated lens fibre membranes. Curr Eye Res. 1989;8:697–706. doi: 10.3109/02713688909025804. [DOI] [PubMed] [Google Scholar]
- 13.Louis CF, Hogan P, Visco L, Strasburg G. Identity of the calmodulin-binding proteins in bovine lens plasma membranes. Exp Eye Res. 1990;50:495–503. doi: 10.1016/0014-4835(90)90038-v. [DOI] [PubMed] [Google Scholar]
- 14.Louis CF, Johnson R, Turnquist J. Identification of the calmodulin-binding components in bovine lens plasma membranes. Eur J Biochem. 1985;150:271–8. doi: 10.1111/j.1432-1033.1985.tb09017.x. [DOI] [PubMed] [Google Scholar]
- 15.Gonen T, Grey AC, Jacobs MD, Donaldson PJ, Kistler J. MP20, the second most abundant lens membrane protein and member of the tetraspanin superfamily, joins the list of ligands of galectin-3. BMC Cell Biol. 2001;2:17. doi: 10.1186/1471-2121-2-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Kumar NM, Jarvis LJ, Tenbroek E, Louis CF. Cloning and expression of a major rat lens membrane protein, MP20. Exp Eye Res. 1993;56:35–43. doi: 10.1006/exer.1993.1006. [DOI] [PubMed] [Google Scholar]
- 17.Arneson ML, Louis CF. Structural arrangement of lens fiber cell plasma membrane protein MP20. Exp Eye Res. 1998;66:495–509. doi: 10.1006/exer.1998.0477. [DOI] [PubMed] [Google Scholar]
- 18.Chen T, Li X, Yang Y, Erdene AG, Church RL. Does lens intrinsic membrane protein MP19 contain a membrane-targeting signal? Mol Vis. 2003;9:735–46. [PubMed] [Google Scholar]
- 19.Kerscher S, Glenister PH, Favor J, Lyon MF. Two new cataract loci, Ccw and To3, and further mapping of the Npp and Opj cataracts in the mouse. Genomics. 1996;36:17–21. doi: 10.1006/geno.1996.0420. [DOI] [PubMed] [Google Scholar]
- 20.Steele EC, Jr, Kerscher S, Lyon MF, Glenister PH, Favor J, Wang J, Church RL. Identification of a mutation in the MP19 gene, Lim2, in the cataractous mouse mutant To3. Mol Vis. 1997;3:5. [PubMed] [Google Scholar]
- 21.Steele EC, Jr, Wang JH, Lo WK, Saperstein DA, Li X, Church RL. Lim2(To3) transgenic mice establish a causative relationship between the mutation identified in the lim2 gene and cataractogenesis in the To3 mouse mutant. Mol Vis. 2000;6:85–94. [PubMed] [Google Scholar]
- 22.Shiels A, King JM, Mackay DS, Bassnett S. Refractive defects and cataracts in mice lacking lens intrinsic membrane protein-2. Invest Ophthalmol Vis Sci. 2007;48:500–8. doi: 10.1167/iovs.06-0947. [DOI] [PubMed] [Google Scholar]
- 23.Pras E, Levy-Nissenbaum E, Bakhan T, Lahat H, Assia E, Geffen-Carmi N, Frydman M, Goldman B, Pras E. A missense mutation in the LIM2 gene is associated with autosomal recessive presenile cataract in an inbred Iraqi Jewish family. Am J Hum Genet. 2002;70:1363–7. doi: 10.1086/340318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Ng PC, Henikoff S. Accounting for human polymorphisms predicted to affect protein function. Genome Res. 2002;12:436–46. doi: 10.1101/gr.212802. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ng PC, Henikoff S. Predicting deleterious amino acid substitutions. Genome Res. 2001;11:863–74. doi: 10.1101/gr.176601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Chen T, Li X, Yang Y, Church RL. Localization of lens intrinsic membrane protein MP19 and mutant protein MP19To3 using fluorescent expression vectors. Mol Vis. 2002;8:372–88. [PubMed] [Google Scholar]