Skip to main content
Journal of Zhejiang University. Science. B logoLink to Journal of Zhejiang University. Science. B
. 2008 Jul;9(7):527–535. doi: 10.1631/jzus.B0820019

Construction of recombinant industrial Saccharomyces cerevisiae strain with bglS gene insertion into PEP4 locus by homologous recombination*

Qiang Zhang 1, Qi-he Chen 1,†, Ming-liang Fu 1, Jin-ling Wang 1, Hong-bo Zhang 1, Guo-qing He 1,†,‡
PMCID: PMC2443348  PMID: 18600782

Abstract

The bglS gene encoding endo-l,3-1,4-β-glucanase from Bacillus subtilis was cloned and sequenced in this study. The bglS expression cassette, including PGK1 promoter, bglS gene fused to the signal sequence of the yeast mating pheromone α-factor (MFα1S), and ADH1 terminator with G418-resistance as the selected marker, was constructed. Then one of the PEP4 allele of Saccharomyces cerevisiae WZ65 strain was replaced by bglS expression cassette using chromosomal integration of polymerase chain reaction (PCR)-mediated homologous recombination, and the bglS gene was expressed simultaneously. The recombinant strain S. cerevisiae (SC-βG) was preliminarily screened by the clearing hydrolysis zone formed after the barley β-glucan was hydrolyzed in the plate and no proteinase A (PrA) activity was measured in fermenting liquor. The results of PCR analysis of genome DNA showed that one of the PEP4 allele had been replaced and bglS gene had been inserted into the locus of PEP4 gene in recombinant strains. Different endo-l,3-1,4-β-glucanase assay methods showed that the recombinant strain SC-βG had high endo-l,3-1,4-β-glucanase expression level with the maximum of 69.3 U/(h·ml) after 60 h of incubation. Meanwhile, the Congo Red method was suitable for the determination of endo-l,3-1,4-β-glucanase activity during the actual brewing process. The current research implies that the constructed yeast strain could be utilized to improve the industrial brewing property of beer.

Keywords: Endo-l,3-1,4-β-glucanase (bglS); Gene replacement; Homologous recombination; Bacillus subtilis; PEP4 gene; Saccharomyces cerevisiae

INTRODUCTION

Barley β-glucans (1,3-1,4-β-D-glucans) are the principal constituent (70%) of barley endosperm cell walls (Palmer, 1989). β-glucan polymers originating from barley endosperm cell walls are one of the major concerns in the brewing industry. The amount and molecular weight of β-glucan in malt affect brewing house extract yield and wort and beer viscosities, as well as lautering, diatomaceous earth, and membrane filtrations. Barley β-glucans are also associated with beer hazes. The partially degraded β-glucans are particularly troublesome during brewing due to the sticky spent grains which retard wort separation at a lower permeability level, reduce beer filtration rate, and induce beer hazes (Palmer, 1989). And also the high viscosities (Saccharomyces cerevisiae cannot cleave the β-1,4 linkages of β-glucans) impede beer filtration in the presence of β-glucans. Therefore, an addition of commercial enzyme preparations is necessary. Alternatively, a heterologous gene encoding β-glucanase could be introduced into brewer’s yeast. The latter option serves as an obvious task for metabolic engineering whereby the substrate range is extended to include β-glucans, and consequently the process performance of beer production may be improved (Jin et al., 2004).

Microbial β-glucanases have been used to improve filtration, increase extract yield, and prevent β-glucan hazes. Endo-l,3-1,4-β-glucanases from barley and Bacillus subtilis have identical substrate specificities (Müller et al., 1998). Microbial endo-l,3-1,4-β-glucanase can be added during malting, mashing or fermentation procedures (Grujic, 1998; Jin et al., 2004), which can efficiently lower HMW (high molecular weight) β-glucan content in wort and beer (Todo et al., 1989; Kettunen et al., 1996), leading to improved beer filterability. The addition of 20×10−6 of β-glucanase at 0~2 °C for 2 d increases sevenfold the membrane filterability of bright beer (Sudarmana et al., 1996). The bacterial endo-l,3-1,4-β-glucanase hydrolyzes linear β-glucans containing β-1,3 and β-1,4 linkages such as cereal β-glucans and lichenan, with a strict cleavage specificity for β-1,4 glycosidic bonds on 3-O-substituted glucosyl residues (Gaiser et al., 2006) (Fig.1), playing an important biotechnological role in the brewing and animal feedstuff industries.

Fig. 1.

Fig. 1

The degradation process of barley by endo-l,3-1,4-β-glucanase (Antoni, 2000)

Although the introduction of flocculence to brewer’s yeast is a convenient method to separate the yeast from the brewing, beer filtration is still an important separation technique in the brewing industry. Endo-l,3-1,4-β-glucanases from B. subtilis (Cantwell et al., 1986), Trichoderma reesei (Panttilä et al., 1987a; 1987b), and barley (Olsen and Thomsen, 1989) have successfully been expressed in S. cerevisiae, and active enzymes were secreted. The production of β-glucanase did not affect beer quality, and furthermore, the β-glucans were efficiently degraded, resulting in an improved filterability (Panttilä et al., 1987a).

The appearance of a stable head of foam is a major consideration in beer quality assessment. As a consequence, many researchers have focused on foam-positive species, in particular, beer proteins, which have been implicated to present in the production and stabilization of foam. The decrease in foam stability caused by yeast proteinase A (PrA) in unpasteurized beer has been reported by several researchers (Muldbjerg et al., 1993; Yokoi et al., 1996; Cooper et al., 2000; Wang et al., 2005; He et al., 2006). PrA is coded by PEP4 gene; construction of PEP4 yeast strains would be helpful to keep foam stability (Wang et al., 2007a). Industrial brewing yeast is wild-type original strain in general and it cannot be replaced by laboratorial yeast in beer brewing; however, other researchers have not constructed industrial brewing yeast with PEP4 gene deletion (Akada, 2002). In our previous research, it was reported that the PrA-deficient recombinant of industrial brewing yeast (WZ65/a) was constructed using polymerase chain reaction (PCR)-mediated gene disruption (Wang et al., 2007a), and self-cloning industrial brewer’s yeast strains were constructed in the following study, in which the coding sequence of PEP4 gene was deleted by CUP1 gene and GSH1 gene’s replacement (Wang et al., 2007b).

MATERIALS AND METHODS

Microbial strains and plasmids

The host industrial brewing yeast, WZ65, was provided by China Lion Brewery Group. B. subtilis mutant ZJF-1A5 was isolated and bred to produce thermal stable endo-l,3-1,4-β-glucanase. Escherichia coli DH5α was preserved in the laboratory. Vectors, pUC18 and pUG6 (KanMX), were preserved in the laboratory.

Media and cultivation conditions

Escherichia coli was grown at 37 °C in Luria-Bertani medium supplemented with ampicillin (100 mg/L) when necessary. Yeast strains were grown at 28 °C in YEPD medium (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) glucose). For selection for geneticin (G418) after yeast transformation, the YEPD plate was supplemented with G418 (200 mg/L).

Cloning of Bacillus subtilis bglS gene

Thermostable bglS gene from B. subtilis ZJF-1A5 was cloned by PCR with designed primers (forward primer, bg-F: 5′-GGGGGATCCATGCCTTATCTGAAACG-3′; reverse primer, bg-D: 5′-GGGAAGCTTATTTACAGAGGGGAGAA-3′). Amplification conditions were 94 °C for 4 min followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min, and finally 72 °C for 10 min. The PCR product was purified and sequenced by Shanghai Sangon Co., China.

Construction of recombinant pUC18-KPMBT vector

PGK1 promoter, the signal sequence of the yeast mating pheromone α-factor (MFα1S) and ADH1 terminator (ADH1T) fragments were amplified by PCR using S. cerevisiae WZ65 genome as the template with P1 & P2, P3 & P4 and P7 & P8 primers, respectively, adding relevant recognition sites to the 5′-end and 3′-end (Table 1). And the bglS gene for construction of the recombinant plasmid was amplified by PCR with P5 & P6 primers and B. subtilis as the template. Amplification conditions for the four fragments were 94 °C for 4 min followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min, and finally 72 °C for 10 min.

Table 1.

Oligonucleotides used in PCR-mediated gene disruption and verification

Primer Sequence (5′→3′) Primer site Restriction site
P1 CCCCCGGGCTTCAACTCAAGACGCACAG PGK1P upstream SmaI
P1′ CCGGATCCCATATGCTTCAACTCAAGACGCACAG PGK1P upstream BamHI, NdeI
P2 GGTCTAGATGTTTTATATTTGTTGTAAAAAGTAG PGK1P downstream XbaI
P3 GGTCTAGAAGAATGAGATTTCCTTC MFα1S upstream XbaI
P4 GGCCAAGCTTCAGCCTCTCTTTTATC MFα1S downstream HindIII
P5 GGAAGCTTCGGCTCAAACAGGTGGATCGTTTTTTG bglS upstream HindIII
P6 GGGGTACCGCATTATTTTTTTGTATAGCGCACCC bglS downstream KpnI
P7 GGGGTACCGCGAATTTCTTATG ADH1T upstream KpnI
P8 GGGAATTCGCATATCTACAATTGGG ADH1T downstream EcoRI
P9 GGGGATCCCAGCTGAAGCTTCGTACGC KanMX upstream BamHI
P10 CCCCCGGGGCATAGGCCACTAGTGGATCTG KanMX downstream SmaI
P11 AGTAAAGAAGTTTGGGTAATTCGCT Verification upstream −
P12 AGTGTTCTATGTTTGCCTTGATTTC Verification downstream −
P13 5′-gtatttaatccaaataaaattcaaacaaaaaccaaaactaacatgCAGCTGAAGCTTCGTACGC-3′ Gene replacement upstream −
P14 5′-atggcagaaaaggatagggcggagaagtaagaaaagtttagctcaGCATATCTACAATTGGG-3′ Gene replacement downstream −

PGK1P: PGK1 promoter; MFα1S: Signal sequence of the yeast mating pheromone α-factor; ADH1T: ADH1 terminator

PGK1 promoter digested with BamHI and XbaI was inserted into MCS (multiple clone site) of pUC18, generating pUC18-P. Then the MFα1S was digested with XbaI and HindIII and ligated with the XbaI- and HindIII-cleaved pUC18-P, and the resulting plasmid was named pUC18-PM. The bglS gene fragment was cloned into pUC18 after both digested with HindIII and KpnI, resulting in pUC18-B. Then pUC18-B was ligated with KpnI- and EcoRI-digested ADH1 terminator fragment and was designated as pUC18-BT. Fragment containing PGK1 promoter/the signal sequence of MFα1 factor fusion gene excised with NdeI and HindIII from the pUC18-PM was inserted into the same sites of pUC18-BT, and then pUC18-PMBT1 containing NdeI-EcoRI fragment of bglS expression cassette was constructed. The pUC18-PMBT1 was used as a template in PCR with P1 & P8 primers to amply PMBT fragment, and the PCR products were digested with SmaI and EcoRI and inserted into pUC18 to construct pUC18-PMBT. Finally, the KanMX cassette amplified by PCR using pUG6 as a template with P9 and P10 primers was cloned into the pUC18-PMBT at its BamH and SmaI sites to produce final plasmid (pUC18-KPMBT).

Electro-transformation and screening of the recombinants

Using recombinant plasmid pUC18-KPMBT as the template, the fragment for replacement was PCR amplified with designed primers, P13 & P14 (Table 1). At their 3′-ends the oligonucleotides (majuscule) are homologous to the recombinant plasmid pUC18-KPMBT, while the oligonucleotides (lowercase) of the 5′-ends are homologous to the sequence of the left and right of the PEP4 gene, respectively. The PCR product was purified and electro-transformed into industrial yeast S. cerevisiae WZ65. The electro-transformation conditions were: 7.5 kV/cm, capacitance 25 μF, parallel resistor 200 Ω, pulse lengths 5 ms. The transformants were selected on YEPD medium containing 200 mg/L G418. After incubation at 30 °C for 72 h, the recombinants were detected and identified.

The two-layer detection plate was used to isolate the transformed strains. The growth YEPD plate with the transformed strains was covered with 5 ml of 0.5% (w/v) agar solution including 0.1% (w/v) lichenan after the transformed colonies were inoculated onto a new YEPD plate to preserve. After incubated at 30 °C for 6 h, the agar-lichenan layer was stained with 0.1% (w/v) Congo Red solution for 30 min. The recombinants were preserved on YEPD slant after the clearing zone formed around the transformed colony in the stained plate.

Identification of the recombinant by PCR amplification

Using the genome of the recombinant as the template, three pairs of primers, P11 & P10, P12 & P5 and P11 & P12, were designed to verify the recombinant strains, with P11 & P12 located in the flanking region of the PEP4 ORF (open reading frame), upstream 266 bp and downstream 321 bp, respectively (Table 1).

Determination of endo-l,3-1,4-β-glucanase activity

After the recombinant SC-βG was incubated in 10 ml YEPD medium at 30 °C for 24 h, 0.5 ml of culturing liquor was inoculated to 50 ml new YEPD medium. Samples were collected at different time points after inoculation. The culture supernatant of recombinant S. cerevisiae WZ65 strain was used as crude enzyme to assay the enzyme activity.

1. Congo Red method

The enzyme activity was assayed with barley β-glucan as substrate at 50 °C. Appropriate dilution of the supernatant was done using 0.05 mol/L citrate-phosphate buffer (pH 6.2). For every 900 μl substrate 100 μl supernatant was added. Aliquots (1 ml) were removed in duplicate at intervals, heated (100 °C) for 15 min and cooled to room temperature. Subsequently, 200 μl Congo Red (100 μg/ml) was added and the mixture diluted with buffer to 2 ml. Absorbency was measured at 540 nm (Wood et al., 1988). One unit of β-1,3-1,4-glucanase activity is defined as the amount of enzyme required to hydrolyze 1 μg β-glucan per minute in 1 ml fermenting liquor.

2. DNS (3,5-dinitrosalicylic acid) method

The activity of endo-l,3-1,4-β-glucanase was measured by a modified method described by Cantwell and McConnell (1983). The enzyme was appropriately diluted with phosphate buffered saline (PBS) (0.2 mol/L, pH 6.0). An aliquot of 0.1 ml enzyme solution prepared was added to 0.9 ml substrate solution (2 mg/ml lichenin) that was pre-incubated at 50 °C for 10 min, and then the mixture was incubated at 50 °C exactly for 10 min. The reaction was stopped by adding 1.5 ml dinitrosalicylic acid solution and boiling for 5 min. Then, the mixture was cooled immediately with cold water and added to 25 ml with distilled water. Absorbency was measured at 540 nm. The amount of reducing sugar was calculated by the absorption value at 540 nm. One unit of activity was defined as the amount of enzyme capable of producing 1 nmol reducing sugar per minute (using glucose as reference) in 1 ml fermenting liquor under the above conditions.

Proteinase A (PrA) activity assay

PrA activity was assayed using 1% (w/v) casein (pH 2.0) as the substrate and detecting products with modified Bradford (1976) method. One unit of PrA will hydrolyze 1 mg of insulin chain B (oxidized) per minute at pH 6.0 (25 °C) (Wang et al., 2005).

RESULTS

bglS gene cloning by PCR amplification

To obtain the coding sequence of bglS gene, PCR amplification was performed with the designed pair of primers bg-F/bg-D. The PCR fragment was cloned and then sequenced by Shanghai Sangon. The amplified 849 bp fragment contained a single ORF 729 bp bglS gene (Fig.2). The putative protein consisted of 242 amino acids (AA), of which the first 28 AA were predicted to be the signal sequence for the secretion of the protein to the extracellular medium and the rest 214 AA were the mature protein. The first 26 AA of the signal sequence region were deleted, and the rest of the sequence were fused to the signal sequence of MFα1 factor to construct the bglS expression cassette in S. cerevisiae.

Fig. 2.

Fig. 2

Nucleotide and deduced amino acid sequences of the bglS gene

The stop codon “TAA” was shown by asterisk at the end of the sequence

PCR amplification of bglS gene, PGK1 promoter, MFα1S, ADH1 terminator and the KanMX cassette

The PCR products of the PGK1 promoter, MFα1S, ADH1 terminator and the mature bglS coding sequence were 778, 285, 259 and 654 bp, respectively. KanMX cassette was 1652 bp in length (Fig.3).

Fig. 3.

Fig. 3

Agarose gel electrophoresis of PCR products

Lane 1: PGK1 promoter; Lane 2: The signal sequence of the yeast mating pheromone α-factor (MFα1S); Lane 3: bglS gene; Lane 4: ADH1 terminator; Lane 5: KanMX cassette

Construction and identification of the recombinant vector pUC18-KPMBT

The five PCR-amplified fragments were cloned into pUC18 cloning vector to construct recombinant plasmid pUC18-KPMBT (KanMX-PGK1P-MFα1S-bglS-ADH1T) according to the process described in the above section. The recombinant plasmid pUC18-KPMBT was shown in Fig.4.

Fig. 4.

Fig. 4

The recombinant plasmid pUC18-KPMBT

BamHI and EcoRI were selected to digest the recombinant pUC18-KPMBT plasmid in order to identify the recombinant vector. The digestion results, the 2667 and 3614 bp fragments, were expected. The recombinant plasmid pUC18-KPMBT was also confirmed through PCR verification with P1 & P8 and P9 & P8 primers, resulting in 1976 and 3642 bp products, respectively (Fig.5). Sequencing analysis of the recombinant plasmid by Shanghai Sangon Co. indicated that the constructed plasmid was correct.

Fig. 5.

Fig. 5

Identification of the recombinant plasmid

Lane 1: PCR product with P1 & P8 primers; Lane 2: PCR product with P8 & P9 primers; Lane 3: Recombinant plasmid pUC18-KPMBT digested with BamHI and EcoRI

Yeast transformation and screening of the recombinants

PCR amplification of the fragment for gene replacement was pooled using P13 & P14 as primers and the recombinant plasmid pUC18-KPMBT as template in 50 μl volume containing 5 μl 10×PCR buffer, 1.2 mmol/L MgCl2, 200 μmol/L dNTP, 20 ng of template plasmid, 0.2 μmol/L primers and 2.5 U Taq polymerase. The cycle conditions were 94 °C for 5 min followed by 30 cycles of 94 °C for 40 s, 58 °C for 1 min and 72 °C for 3 min, and finally 72 °C for 10 min. The purified PCR product (~5 μg) was electro-transformed into S. cerevisiae WZ65 strain. The transformation conditions and screening method for the recombinants were described in the previous section. The S. cerevisiae recombinants expressing endo-l,3-1,4-β-glucanase were detected by a clearing zone surrounding the yeast colonies after staining the lichenan-agar upper layer with Congo Red (Fig.6). The endo-l,3-1,4-β-glucanase activity was also detected in the supernatant of YEPD liquid cultures. PrA activity was also determined to be zero.

Fig. 6.

Fig. 6

Detection of endo-l,3-1,4-β-glucanase activity in S. cerevisiae recombinants by cleavage of lichenan. The plate was then stained with Congo Red

The recombinant S. cerevisiae WZ65 strain expressing endo-l,3-1,4-β-glucanase was identified by PCR amplification. Using the recombinant yeast genomic DNA as the template and P11 & P10, P5 & P12, P11 & P12 as primers, PCR amplification was used to verify the recombinant strains, resulting in 1914 and 1273 bp fragments with P11 & P10 and P5 & P12, respectively. The products with P11 & P12 were two fragments, the 4229-bp one for the KMBT and the 1830-bp one for the PEP4 ORF (Fig.7). PCR analysis of the bglS-expressed yeast strain showed that the host strain was diploid, and one of the PEP4 alleles was disrupted with the bglS expression cassette and the other was intact. The culture supernatant of recombinant S. cerevisiae WZ65 strain was also used as crude enzyme to determine PrA activity and endo-l,3-1,4-β-glucanase activity. The screened positive transformant was named as SC-βG.

Fig. 7.

Fig. 7

PCR verification of recombinant strain SC-βG

Lane 1: PCR product with P11 & P10 primers; Lane 2: PCR product with P5 & P12 primers; Lane 3: PCR product with P11 & P12 primers

In considering of high thermostability of endo-1,3-1,4-β-glucanase from B. subtilis compared with that from barley, the cloned Bacillus bglS gene was expressed in S. cerevisiae WZ65 strain to construct the recombinant brewing yeast with the capacity to hydrolyze β-glucans. The Bacillus bglS gene was very lowly expressed in yeast under the control of its own promoter (Hinchliffe and Box, 1984) and increased when it was expressed and secreted under the control of ADH1P (ADH1 promoter), PGK1P and signal peptides from yeast (Cantwell et al., 1986). In the current research, the ADH1P and MFα1S were selected to improve the B. subtilis endo-1,3-1,4-β-glucanase expression efficiency in S. cerevisiae.

Endo-l,3-1,4-β-glucanase activity measurement of the recombinant

The activity of endo-l,3-1,4-β-glucanase secreted by S. cerevisiae WZ65 was determined by Congo Red method (Fig.8a). The glucanase activity of the recombinant strain increased quickly after cultivation for 24 h and reached the maximum of 69.3 U at 60 h. After then, endo-l,3-1,4-β-glucanase activity decreased slowly and was maintained around 50 U after incubation for 72 h. It was supposed that endo-l,3-1,4-β-glucanase expression was inhibited by metabolites (including alcohol, organic acids and other compounds) of SC-βG as cultivation period lasted; however, the deep reason underlined needs to be further investigated in the future research.

Fig. 8.

Fig. 8

Fig. 8

Endo-l,3-1,4-β-glucanase activity of the recombinant strain SC-βG assayed by Congo Red method (a) and DNS method (b)

Furthermore, the β-1,3-1,4-glucanase activity was assayed by DNS method and the same trend as that of Congo Red method was observed (Fig.8b). It is relatively difficult to assay endo-1,3-1,4-β-glucanase activity by measuring the amount of reducing sugars. The problem arises due to the fact that there are only a few 1,4- linkages next to 1,3- linkages in barley β-glucan, allowing only a few sites where the enzyme can cut the glucan chain. This results in the production of only a few reducing sugar ends and if measured by the DNS method no effect was detected. Interestingly, although only were a few reducing sugar ends formed, a large clearing zone was formed during the plate assay with Congo Red. Results of the plate assays clearly show that the endo-1,3-1,4-β-glucanase only utilized barley β-glucan and lichenan, but not CMC (carboxymethyl cellulose), whereas the endo-1,4-β-lucanase hydrolyzed all three substrates (van Rensburg et al., 1997). Current results confirm that endo-1,3-1,4-β-glucanase only hydrolyzes β-1,4 linkages adjacent to β-1,3 linkages (Wolf et al., 1995), because CMC contains no 1,4- linkages next to 1,3- linkages. The two assay methods generated almost the same change curve for the enzyme activity (Fig.8).

DISCUSSION

In the current study, the recombinant industrial brewing yeast strain SC-βG with one of the PEP4 alleles replaced with bglS expression cassette was constructed by PCR-mediated gene disruption and homologous recombination. The recombinant strain may have advantages in beer brewing, maintaining the beer foam performance especially to keep the foam stable in unpasteurized beer, improving beer filterability of brewing and increasing the stability of beer product.

PrA plays an essential role among vacuolar hydrolases (Rothman et al., 1986; Jones, 1991) in processing the mature forms of proteinases B (PrB) and carboxypeptidase Y (CPY) among proteases, alkaline phosphatase and RNase. An initial self-activation process of proteinase yscA is necessary for the activation of vacuolar zymogens (Rupp and Wolf, 1995). The inactive precursor molecules produced from the PEP4 gene self-activate and subsequently activate other vacuolar hydrolases (Woolford et al., 1986; Ammerer et al., 1986). And PEP4 is important for protein turnover after oxidative damage (Marques et al., 2006).

These roles of PrA are supported by the facts that the deletion of the structural gene of PrA certainly leads to the accumulation of the pro-forms of vacuolar proteases including proPrB and proCPY in the vacuole (Stevens et al., 1982). Mutations at the PEP4 locus exhibit a dosage effect on the levels of some, but not all, of the enzymes whose expression requires the function of the gene. The pep4 mutation results in a 90%~95% reduction in the levels of several vacuolar hydrolases in yeast, including PrA and PrB, CPY, RNase(s) and the repressible alkaline phosphatase (Jones et al., 1982; Zubenko et al., 1983; Stevens et al., 1982).

In the current work, the recombinant strain SC-βG was constructed for industrial production. Although the recombinant SC-βG yeast would secrete less PrA during beer brewing, the expressed glucanase would hydrolyze β-glucan theoretically. However, the effect of assumed reduction of expressed PrA on foam retention, the growth traits, the fermentative properties of the recombinant S. cerevisiae, and the hydrolytic capability of the recombinant β-glucanase to the β-glucan in the process of beer brewing need to be further investigated.

To improve the large-scale production of biotechnological products, it is very important to concentrate on engineering disciplines dealing with bioreactor design and optimization of fermentation technology, which may lead to an improved process performance, giving higher overall yields and productivities (Court et al., 2002). The focus on S. cerevisiae to fulfill several biotechnological purposes is still increasing. Since the sequence of the complete yeast genome is available, targeted genetic changes are easily obtained by recombinant DNA technology, which facilitates and accelerates metabolic engineering.

Footnotes

*

Project supported by the National Hi-Tech Research and Development Program (863) of China (No. 2007AA10Z315) and the Natural Science Foundation of Zhejiang Province, China (No. Z304076)

References

  • 1.Akada R. Genetically modified industrial yeast ready for application. J Biosci Bioeng. 2002;94(6):536–544. doi: 10.1016/S1389-1723(02)80192-X. [DOI] [PubMed] [Google Scholar]
  • 2.Ammerer G, Hunter CP, Rothman JH, Saari GC, Valls LA, Stevens TH. PEP4 gene of Saccharomyces cerevisiae encodes proteinase A, a vacuolar enzyme required for processing of vacuolar precursors. Mol Cell Biol. 1986;6(7):2490–2499. doi: 10.1128/mcb.6.7.2490-2499.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Antoni P. Bacterial 1,3-1,4-β-glucanases: structure, function and protein engineering. Biochimi Biophysica Acta. 2000;1543(2):361–382. doi: 10.1016/s0167-4838(00)00231-4. [DOI] [PubMed] [Google Scholar]
  • 4.Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72(1-2):248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 5.Cantwell BA, McConnell DJ. Molecular cloning and expression of a Bacillus subtilis β-glucanase gene in Escherichia coli . Gene. 1983;23(2):211–219. doi: 10.1016/0378-1119(83)90053-7. [DOI] [PubMed] [Google Scholar]
  • 6.Cantwell BA, Brazil G, Murphy N, McConnell DJ. Comparison of expression of the endo-β-1,3-1,4-glucanase gene from Bacillus subtilis in Saccharomyces cerevisiae from the CYC1 and ADH1 promoters. Curr Genet. 1986;11(1):65–70. doi: 10.1007/BF00389427. [DOI] [PubMed] [Google Scholar]
  • 7.Cooper DJ, Stewart GG, Bryce JH. Yeast proteolytic activity during high and low gravity wort fermentations and its effect on head retention. J Inst Brew. 2000;1066(4):197–201. [Google Scholar]
  • 8.Court DL, Sawitzke JA, Thomason LC. Genetic engineering using homologous recombination. Ann Rev Genet. 2002;36(1):361–388. doi: 10.1146/annurev.genet.36.061102.093104. [DOI] [PubMed] [Google Scholar]
  • 9.Gaiser OJ, Piotukh K, Ponnuswamy MN, Planas A, Borriss R, Heinemann U. Structural basis for the substrate specificity of a Bacillus 1,3-1,4-β-glucanase. J Mol Biol. 2006;357(4):1211–1225. doi: 10.1016/j.jmb.2006.01.014. [DOI] [PubMed] [Google Scholar]
  • 10.Grujic O. Application of a commercial enzyme preparation in the barley malting process. J Inst Brew. 1998;104(5):249–253. [Google Scholar]
  • 11.He GQ, Wang ZY, Liu ZS, Chen QH, Ruan H, Schwarz PB. Relationship of proteinase activity, foam proteins, and head retention in unpasteurized beer. J Am Soc Brew Chem. 2006;64(1):33–38. [Google Scholar]
  • 12.Hinchliffe E, Box WG. Expression of the cloned endo-1,3-1,4-β-glucanase gene of Bacillus subtilis in Saccharomyces cerevisiae . Curr Genet. 1984;8(6):471–475. doi: 10.1007/BF00433914. [DOI] [PubMed] [Google Scholar]
  • 13.Jin YL, Speers RA, Paulson AT, Stewart RJ. Barley β-glucans and their degradation during malting and brewing. Technical Quarterly-Master Brewers Association of the Americas. 2004;41(3):231–240. [Google Scholar]
  • 14.Jones EW. Tackling the protease problem in Saccharomyces cerevisiae . Methods Enzymol. 1991;194:429–453. doi: 10.1016/0076-6879(91)94034-a. [DOI] [PubMed] [Google Scholar]
  • 15.Jones EW, Zubenko GS, Parker RR. PEP4 gene function is required for expression of several vacuolar hydrolases in Sacchromyces cerevisiae . Genetics. 1982;102(4):665–677. doi: 10.1093/genetics/102.4.665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kettunen A, Hamalainen JJ, Stenholm K, Pietilä K. A model for the prediction of β-glucan concentration during mashing. J Food Eng. 1996;29(2):185–200. doi: 10.1016/0260-8774(95)00070-4. [DOI] [Google Scholar]
  • 17.Marques M, Mojzita D, Amorim MA, Almeida T, Hohmann S, Moradas FP, Costa V. The Pep4p vacuolar proteinase contributes to the turnover of oxidized proteins but PEP4 overexpression is not sufficient to increase chronological lifespan in Saccharomyces cerevisiae . Microbiology. 2006;152(12):3595–3605. doi: 10.1099/mic.0.29040-0. [DOI] [PubMed] [Google Scholar]
  • 18.Muldbjerg M, Meldal M, Breddam K, Sigsgaard P. Protease activity in beer and correlation of foam. Proc Congr Eur Brew Conv. 1993;25:357–364. [Google Scholar]
  • 19.Müller JJ, Thomsen KK, Heinemann U. Crystal structure of barley 1,3-1,4-β-glucanase at 2.0-Å resolution and comparison with Bacillus 1,3-1,4-β-glucanase. J Biol Chem. 1998;273(6):3438–3446. doi: 10.1074/jbc.273.6.3438. [DOI] [PubMed] [Google Scholar]
  • 20.Olsen O, Thomsen KK. Processing and secretion of barley (1-3,1-4)-β-glucanase in yeast. Carlsberg Res Commun. 1989;54(2):29–39. doi: 10.1007/BF02907583. [DOI] [PubMed] [Google Scholar]
  • 21.Palmer GH. Cereals in Malting and Brewing. In: Palmer GH, editor. Cereal Science and Technology. Aberdeen, UK: Aberdeen University Press; 1989. pp. 61–242. [Google Scholar]
  • 22.Panttilä ME, André L, Saloheimo M, Lehtovaara P, Knowles JK. Expression of two Trichoderma reesei endoglucanases in the yeast Saccharomyces cerevisiae . Yeast. 1987;3(3):175–185. doi: 10.1002/yea.320030305. [DOI] [PubMed] [Google Scholar]
  • 23.Panttilä ME, Suihko U, Lehtinen M, Nikkola M, Knowles JKC. Construction of brewer’s yeasts secreting fungal endo-β-glucanase. Curr Genet. 1987;12(6):413–420. doi: 10.1007/BF00434818. [DOI] [Google Scholar]
  • 24.Rothman JH, Hunter CP, Valls LA, Stevens TH. Overproduction-induced mislocalization of a yeast vacuolar protein allows isolation of its structural gene. Proc Natl Acad Sci USA. 1986;83(10):3248–3252. doi: 10.1073/pnas.83.10.3248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Rupp S, Wolf DH. The use of active-site mutants of proteinase yscA to determine the necessity of the enzyme for vacuolar proteinase maturation and proteinase yscB stability. Eur J Biochem. 1995;231(1):115–125. doi: 10.1111/j.1432-1033.1995.tb20677.x. [DOI] [PubMed] [Google Scholar]
  • 26.Stevens TH, Esmon B, Schekman R. Early stages in the yeast secretory pathway are required for transport of carboxypeptidase Y to the vacuole. Cell. 1982;30(2):439–448. doi: 10.1016/0092-8674(82)90241-0. [DOI] [PubMed] [Google Scholar]
  • 27.Sudarmana DL, Goldsmith MR, Hinh AH, Pecar MA, Hawthorne DB, Kavanagh TE. Microfiltration studies with a modified membrane filterability procedure. Technical Quarterly-Master Brewers Association of the Americas. 1996;33(1):63–72. [Google Scholar]
  • 28.Todo V, Carbonell JV, Sendra JM. Kinetics of β-glucan degradation in wort by exogenous β-glucanases treatment. J Inst Brew. 1989;95(6):419–422. [Google Scholar]
  • 29.van Rensburg P, van Zyl WH, Pretorius IS. Over-expression of the Saccharomyces cerevisiae exo-β-1,3-glucanase gene together with the Bacillus subtilis endo-β-1,3-1,4-glucanase gene and the Butyrivibrio fibrisolvens endo-β-1,4-glucanase gene in yeast. J Biotechnol. 1997;55(1):43–53. doi: 10.1016/S0168-1656(97)00059-X. [DOI] [PubMed] [Google Scholar]
  • 30.Wang ZY, He GQ, Liu ZS, Ruan H, Chen QH, Xiong HP. Purification of yeast proteinase A from fresh beer and its specificity on foam proteins. Int J Food Sci Tech. 2005;40(8):835–840. doi: 10.1111/j.1365-2621.2005.01000.x. [DOI] [Google Scholar]
  • 31.Wang ZY, He GQ, Ruan H, Liu ZS, Yang LF, Zhang BR. Construction of proteinase A deficient transformant of industrial brewing yeast. Eur Food Res Technol. 2007;225(5-6):831–835. doi: 10.1007/s00217-006-0488-5. [DOI] [Google Scholar]
  • 32.Wang ZY, He XP, Zhang BR. Over-expression of GSH1 gene and disruption of PEP4 gene in self-cloning industrial brewer’s yeast. Int J Food Microbiol. 2007;119(3):192–199. doi: 10.1016/j.ijfoodmicro.2007.07.015. [DOI] [PubMed] [Google Scholar]
  • 33.Wolf M, Attila G, Ortwin S, Rainer B. Genes encoding xylan and β-glucan hydrolyzing enzymes in Bacillus subtilis: characterization, mapping and construction of strain deficient in lichenase, cellulose and xylanase. Microbiology. 1995;141(2):281–290. doi: 10.1099/13500872-141-2-281. [DOI] [PubMed] [Google Scholar]
  • 34.Wood PJ, Erfle JD, Teather RM. Use of complex formation between Congo Red and polysaccharides hydrolases in detection and assay of polysaccharide hydrolases. Methods Enzymol. 1988;160:59–74. [Google Scholar]
  • 35.Woolford CA, Daniels LB, Park FJ, Jones EW, Arsdell JV, Innis MA. The PEP4 gene encodes an aspartyl protease implicated in the posttranslational regulation of Saccharomyces cerevisae vacuolar hydrolases. Mol Cell Biol. 1986;6(7):2500–2510. doi: 10.1128/mcb.6.7.2500-2510.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yokoi S, Shigyo T, Tamaki T. A fluorometric assay for proteinase A in beer and its application for investigation of enzymatic effects on foam stability. J Inst Brew. 1996;1022(1):33–37. [Google Scholar]
  • 37.Zubenko GS, Park FJ, Jones EW. Mutations in PEP4 locus of Saccharomyces cerevisiae block final step in maturation of two vacuolar hydrolases. Proc Natl Acad Sci USA. 1983;80(2):510–514. doi: 10.1073/pnas.80.2.510. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Zhejiang University. Science. B are provided here courtesy of Zhejiang University Press

RESOURCES