Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2008 Apr 28;52(7):2683–2685. doi: 10.1128/AAC.00272-08

Species Distribution and In Vitro Antifungal Susceptibility Patterns of 75 Clinical Isolates of Fusarium spp. from Northern Italy▿

Anna Maria Tortorano 1,*, Anna Prigitano 1, Giovanna Dho 1, Maria Carmela Esposto 1, Claudia Gianni 2, Anna Grancini 3, Cristina Ossi 4, Maria Anna Viviani 1
PMCID: PMC2443921  PMID: 18443107

Abstract

Fusarium isolates from 75 Italian patients were identified by molecular methods, and their susceptibilities to antifungals were tested in vitro. Fusarium verticillioides was the species most frequently isolated from deep-seated infections, and F. solani was the species most frequently isolated from superficial infections. F. solani isolates showed high azole MICs, while F. verticillioides isolates showed low posaconazole MICs.


Fusarium species are hyaline filamentous fungi that cause a broad spectrum of infections in humans, including superficial, locally invasive, and disseminated infections. The clinical presentation of fusariosis largely depends on the immune status of the host and the fungal portal of entry (7). Superficial infections, such as keratitis and onychomycosis, are usually observed in immunocompetent individuals, whereas invasive infections occur in immunocompromised patients, mainly in association with prolonged and profound neutropenia or severe T-cell immunodeficiency (6).

In immunocompromised patients, the mortality rate exceeds 70% (6, 12). The antifungal therapy of choice is amphotericin B; other treatment options include voriconazole and posaconazole (12).

Among the more than 50 Fusarium species identified, 12 have been described as causes of human infection. Traditional identification is based on morphological methods, is cumbersome, and requires adequate training. As a consequence, the identification of 33 to 50% of Fusarium isolates is erroneous or missed (3, 7). Fusarium solani is the most frequently reported species and causes approximately 50% of infections; the next most prevalent species are F. oxysporum (20%), F. verticillioides (10%), and Fusarium moniliforme (now classified as F. verticillioides; 10%) (7, 13).

Fusarium species are relatively resistant to most antifungals. However, different species have different susceptibility patterns (7). Therefore, reliable species identification is important for epidemiologic and clinical purposes.

The aim of the current study was to identify Fusarium isolates from cases occurring in northern Italy by molecular methods and to determine their in vitro susceptibilities to antifungals.

Isolates sequentially collected from 1985 to 2007 from 75 patients with Fusarium infections diagnosed in two hospital laboratories were studied. The isolates were maintained in a freeze-dried state in the Igiene Università Milano collection at the Department of Public Health—Microbiology—Virology, University of Milan, Milan, Italy.

Genomic DNA was extracted with an UltraClean microbial DNA isolation kit (Mo Bio Laboratories, Inc., Carlsbad, CA) and amplified with primers specific for F. proliferatum, F. verticillioides, and F. subglutinans (4). Samples that had negative results were reamplified with universal fungus-specific primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) (14). The amplicons were purified with a Microcon centrifugal filter device (Millipore Corporation, Bedford, MA) and sequenced with BigDye terminators (Applera, Foster City, CA) in a 310 ABI Prism sequencer (Applera). Nucleotide sequences were analyzed by the use of Finch TV software (version 1.4.0) and a search of the GenBank database with the BLAST program. Further amplification and sequencing of the alpha-elongation gene (8) was performed for the strains presenting an ambiguous BLAST result for internal transcribed spacer (ITS) sequences.

In vitro susceptibility testing was performed by a broth microdilution assay following the Clinical and Laboratory Standards Institute (formerly NCCLS) guidelines for filamentous fungi (5). Amphotericin B (Sigma, Milan, Italy), itraconazole (Janssen Research Foundation, Bersee, Belgium), voriconazole (Molekula, Wimborne Dorset, United Kingdom), and posaconazole (Schering-Plough Research Institute, Kenilworth, NJ) were tested at final concentrations ranging from 0.03 to 16 μg/ml. Tests were performed in duplicate. Reference strains Candida parapsilosis ATCC 22019 and Candida krusei ATCC 6258 were used as quality controls.

Overall, F. verticillioides represented 41% of the isolates, followed by F. solani (25%), F. proliferatum (13%), and F. oxysporum (12%) (Table 1). However, the distribution of the isolated species differed among the patients with various clinical presentations: F. verticillioides accounted for 57% of the isolates from immunocompromised patients, whereas F. solani accounted for 46% of those from patients with superficial infections. Among the 17 onychomycosis cases, F. solani and F. oxysporum were responsible for 7 cases each, whereas 2 of 3 keratitis cases were caused by F. verticillioides.

TABLE 1.

Identification of 75 Fusarium isolates causing deep and superficial infections

Fusarium species No. (%) of Fusarium isolates
Deep infections Superficial infectionsa Total
Total 49 26 75
F. dimerum 1 (2.0) 0 1 (1.3)
F. oxysporum 2 (4.1) 7 (26.9) 9 (12.0)
F. proliferatum 8 (16.3) 2 (7.7) 10 (13.3)
F. solani 7 (14.3) 12 (46.2) 19 (25.3)
F. subglutinans 1 (2.0) 2 (7.7) 3 (4.0)
F. verticillioides 28 (57.1) 3 (11.5) 31 (41.3)
Fusarium spp. 2 (4.1) 0 2 (2.7)
a

Onychomycosis (n = 17), cutaneous infections (n = 6), and keratitis (n = 3).

The results of antifungal susceptibility testing (Table 2) showed different patterns of susceptibility among the species. The majority of F. solani isolates exhibited high azole MICs. In contrast, all F. verticillioides isolates were inhibited by ≤1 μg/ml posaconazole, and 90% and 84% of the isolates were inhibited by ≤2 μg/ml voriconazole and itraconazole, respectively. F. proliferatum and F. oxysporum isolates showed a broad range of MICs when they were tested against posaconazole and voriconazole. Amphotericin B was active at ≤2 μg/ml against 70 of the 75 isolates tested.

TABLE 2.

In vitro susceptibility to antifungal drugs of 75 Fusarium isolates by species

Fusarium species (no. of isolates) Test agent G-MICb (μg/ml) Cumulative no. of isolates with MICa (μg/ml) of:
0.25 0.50 1.00 2.00 4.00 8.00 ≥16.0
F. verticillioides (31) Amphotericin B 1.53 1 14 31
Itraconazole 3.33 15 21 26 31
Posaconazole 0.46 9 29 31
Voriconazole 1.74 10 30 31
F. solani (19) Amphotericin B 1.25 1 2 13 19
Itraconazole >16 19
Posaconazole 15.21 1 19
Voriconazole 9.21 1 2 5 13 19
F. proliferatum (10) Amphotericin B 1.7 5 9 10
Itraconazole >16 10
Posaconazole 6.4 2 5 7 10
Voriconazole 4.2 2 4 7 10
F. oxysporum (9) Amphotericin B 2.3 1 7 9
Itraconazole >16 9
Posaconazole 2.7 6 9
Voriconazole 4.0 2 8 9
F. subglutinans (3) Amphotericin B 3.3 1 3
Itraconazole 10.8 1 3
Posaconazole 10.75 1 3
Voriconazole 5.6 1 3
F. dimerum (1) Amphotericin B 1
Itraconazole 1
Posaconazole 1
Voriconazole 1
Fusarium spp. (2) Amphotericin B 2
Itraconazole 1 2
Posaconazole 1 2
Voriconazole 2
a

The MIC was defined as the lowest concentration that produced a 100% reduction in growth compared with the growth of the control under drug-free conditions after 48 h of incubation at 35°C.

b

G-MIC, geometric mean MIC.

Other investigators have reported on the poor in vitro activities of different antifungals against Fusarium species, with F. solani being more resistant than other members of the genus (1, 2, 7, 9). According to our results, amphotericin B was the most active drug against F. solani, while voriconazole and posaconazole were active against other Fusarium species, and their use in the treatment of infections caused by these species is promising. These observations are consistent with the favorable outcome observed in some patients with fusariosis treated with lipid-based amphotericin B or triazoles (10, 11, 12).

The difficulties in correlating in vitro susceptibility data with the results of clinical trials or the outcomes described in case reports are well known and have been related to several factors, including the low numbers of patients treated, the critical role of immune reconstitution in the outcome of fusariosis, delays in the initiation of antifungal treatment, and bias in patient selection in salvage therapy trials. In addition, the causative isolates are not identified to species level in the majority of reports. This lack of identification further hinders correlation of the data, given the different susceptibility patterns among different Fusarium species.

The distribution of Fusarium species reported in the current analysis is different from that reported in the literature (7). In our series from northern Italy, more than 50% of the cases of deep infection were caused by F. verticillioides, whereas F. solani accounted for most of the superficial infections. This may be due to the various geographic distributions of the species or may be a result of the more accurate identification obtained by molecular methods.

In conclusion, because of the different patterns of antifungal activity against different species, accurate identification to the species level of the causative agent of Fusarium infections can greatly aid in the choice of an appropriate antifungal therapy. Amphotericin B, particularly in lipid formulations, seems to be the most effective against F. solani infections, whereas voriconazole and posaconazole may be effective against the other species, with posaconazole showing activity against F. verticillioides. In addition, the peculiar distribution of Fusarium species causing deep and superficial infections that was observed in this study supports the need for local epidemiologic surveys that include molecular identification of the infecting species.

Acknowledgments

Financial support for this study was provided by the Schering-Plough Corporation.

Footnotes

▿

Published ahead of print on 28 April 2008.

REFERENCES

  • 1.Arikan, S., M. Lozano-Chiu, V. Paetznick, S. Nangia, and J. H. Rex. 1999. Microdilution susceptibility testing of amphotericin B, itraconazole, and voriconazole against clinical isolates of Aspergillus and Fusarium species. J. Clin. Microbiol. 37:3946-3951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Azor, M., J. Gené, J. Cano, and J. Guarro. 2007. Universal in vitro antifungal resistance of genetic clades of the Fusarium solani species complex. Antimicrob. Agents Chemother. 51:1500-1503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Healy, M., K. Reece, D. Walton, J. Huong, S. Frye, I. I. Raad, and D. P. Kontoyiannis. 2005. Use of the Diversi Lab system for species and strain differentiation of Fusarium species isolates. J. Clin. Microbiol. 43:5278-5280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Mulè, G., A. Susca, G. Stea, and A. Moretti. 2004. A species-specific PCR assay based on the calmodulin partial gene for identification of Fusarium verticillioides, F. proliferatum, and F. subglutinans. Eur. J. Plant Pathol. 110:495-502. [Google Scholar]
  • 5.National Committee for Clinical Laboratory Standards. 2002. Reference method for broth dilution antifungal susceptibility testing of filamentous fungi. Approved standard. NCCLS document M38-A. National Committee for Clinical Laboratory Standards, Wayne, PA.
  • 6.Nucci, M., and E. Anaissie. 2002. Cutaneous infection by Fusarium species in healthy and immunocompromised hosts: implications for diagnosis and management. Clin. Infect. Dis. 35:909-920. [DOI] [PubMed] [Google Scholar]
  • 7.Nucci, M., and E. Anaissie. 2007. Fusarium infections in immunocompromised patients. Clin. Microbiol. Rev. 20:695-704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.O'Donnell, K., H. C. Kistler, E. Cigelnik, and R. C. Ploetz. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 95:2044-2049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Paphitou, N. I., L. Ostrosky-Zeichner, V. L. Paetznick, J. R. Rodriguez, E. Chen, and J. H. Rex. 2002. In vitro activities of investigational triazoles against Fusarium species: effects of inoculum size and incubation time on broth microdilution susceptibility test results. Antimicrob. Agents Chemother. 46:3298-3300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Perfect, J. R. 2005. Treatment of non-Aspergillus moulds in immunocompromised patients, with amphotericin B lipid complex. Clin. Infect. Dis. 40(Suppl. 6):S401-S408. [DOI] [PubMed] [Google Scholar]
  • 11.Perfect, J. R., K. A. Marr, T. J. Walsh, R. N. Greenberg, B. DuPont, J. de la Torre-Cisneros, G. Just-Nubling, H. T. Schlamm, I. Lutsar, A. Espinel-Ingroff, and E. Johnson. 2003. Voriconazole treatment for less-common, emerging, or refractory fungal infections. Clin. Infect. Dis. 36:1122-1131. [DOI] [PubMed] [Google Scholar]
  • 12.Raad, I. I., R. Y. Hachem, R. Herbrecht, J. R. Graybill, R. Hare, G. Corcoran, and D. P. Kontoyiannis. 2006. Posaconazole as salvage treatment for invasive fusariosis in patients with underlying hematologic malignancy and other conditions. Clin. Infect. Dis. 42:1398-1403. [DOI] [PubMed] [Google Scholar]
  • 13.Seifert, K. A., T. Aoki, R. P. Baayen, D. Brayford, L. W. Burgess, S. Chulze, W. Gams, D. Geiger, J. De Gruyter, J. F. Leslie, A. Logrieco, W. F. O. Marasas, H. I. Nirenberg, K. O'Donnell, J. Rheeder, G. J. Samuels, B. A. Summerell, U. Thrane, and C. Waalwijk. 2003. The name Fusarium moniliforme should no longer be used. Mycol. Res. 107:643-644. [Google Scholar]
  • 14.White, T. J., T. Burns, S. Lee, and J. W. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315-322. In M. A. Innis, D. H. Gelfald, J. J. Sninsky, and T. J. White (ed.), PCR protocol: a guide to methods and applications. Academic Press, Inc., New York, NY.

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES