Abstract
The haloarchaeon Haloferax mediterranei has shown promise for the economical production of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV), a desirable bioplastic. However, little is known at present about the genes involved in PHBV synthesis in the domain Archaea. In this study, we cloned the gene cluster (phaECHme) encoding a polyhydroxyalkanoate (PHA) synthase in H. mediterranei CGMCC 1.2087 via thermal asymmetric interlaced PCR. Western blotting revealed that the phaEHme and phaCHme genes were constitutively expressed, and both the PhaEHme and PhaCHme proteins were strongly bound to the PHBV granules. Interestingly, CGMCC 1.2087 could synthesize PHBV in either nutrient-limited medium (supplemented with 1% starch) or nutrient-rich medium, up to 24 or 18% (wt/wt) in shaking flasks. Knockout of the phaECHme genes in CGMCC 1.2087 led to a complete loss of PHBV synthesis, and only complementation with the phaECHme genes together (but not either one alone) could restore to this mutant the capability for PHBV accumulation. The known haloarchaeal PhaC subunits are much longer at their C termini than their bacterial counterparts, and the C-terminal extension of PhaCHme was proven to be indispensable for its function in vivo. Moreover, the mixture of purified PhaEHme/PhaCHme (1:1) showed significant activity of PHA synthase in vitro. Taken together, our results indicated that a novel member of the class III PHA synthases, composed of PhaCHme and PhaEHme, accounted for the PHBV synthesis in H. mediterranei.
Polyhydroxyalkanoates (PHAs) are a broad class of polyesters of various hydroxyalkanoates that are accumulated as carbon and energy storage materials in many bacteria and archaea under nutrient-limiting conditions with excess carbon source (31). Due to their excellent biodegradability, biocompatibility, and mechanical properties, PHAs have been drawing much attention as promising substitutes for petroleum-derived plastics (30). However, the high production cost of PHAs is still an obstacle to their widespread use, and therefore, much effort should be devoted to bringing down the production costs, such as using inexpensive carbon sources or developing more economical fermentation and separation processes (17, 42). Indeed, several haloarchaeal strains in the genera Haloferax, Halobacterium, Haloarcula, and Haloquadratum can synthesize PHAs from cheap carbon sources, and isolation of PHAs from these haloarchaea is much easier than from bacteria (8, 11, 12, 16, 20, 23). Therefore, haloarchaea provide a novel opportunity to produce PHAs economically.
Due to its high growth rate, metabolic versatility, and genetic stability, Haloferax mediterranei has become an interesting archaeon for investigating metabolites, including PHAs (3, 8, 14, 23, 26). The PHA accumulated by H. mediterranei was reported to be poly(3-hydroxybutyrate) (PHB) originally (8, 23) but has been reevaluated as poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) recently (5, 17). PHBV has much better mechanical properties than PHB and hence is more promising for commercial production and application (1, 19). Unlike PHBV production in bacteria, where costly and cellular toxic carbons, such as propionic acid or valeric acid, would be provided as the precursors of the 3-hydroxyvalerate (3HV) unit (36), H. mediterranei can accumulate PHBV up to ∼60% (wt/wt) from starch, glucose, or other cheaper carbon sources, including industrial by-products (17, 23). Thus, H. mediterranei has become one of the most promising candidate organisms for industrial PHA production.
In bacteria, extensive research over several decades has accumulated much information on the pathways of PHA synthesis and degradation (38). PHA synthases, the key enzymes catalyzing the polymerization of 3-hydroxyacyl-coenzyme A (CoA) into PHAs, are generally grouped into four classes in bacteria according to their substrate specificities and the subunit compositions (37). Class III and IV synthases are composed of two subunits; one is PhaC, and the other is PhaE (∼40 kDa) (10, 21, 22) or PhaR (∼22 kDa) (28). In the domain Archaea, however, little was known about the genes and enzymes involved in PHA synthesis until recently, when the first archaeal-type phaEC genes encoding a putative class III PHA synthase were identified and characterized in Haloarcula marismortui and Haloarcula hispanica (11). For PHBV biosynthesis in H. mediterranei, although much preliminary work has been performed (17), the molecular and genetic information for PHBV metabolism in this halophilic archaeon remains unknown.
In the present study, we report for the first time the gene cloning and molecular characterization of the PHBV synthase in H. mediterranei. Both genetic and biochemical evidence demonstrated that the PHBV synthase in H. mediterranei is actually composed of two subunits, PhaEHme and PhaCHme. Taking these data together with our previous studies (11) and phylogenetic analysis, we report that the class III PHA synthase is widespread in the domain Archaea.
MATERIALS AND METHODS
Strains, plasmids, and oligonucleotides.
The strains and plasmids used in this study are listed in Table 1. The oligonucleotides are listed in Table 2. Escherichia coli JM109, used as a host for cloning experiments, was grown in Luria-Bertani medium at 37°C (35). When required, ampicillin was added to a final concentration of 100 mg/liter. Generally, H. mediterranei and H. hispanica strains were cultivated at 37°C in nutrient-rich AS-168 medium (per liter, 200 g NaCl, 20 g MgSO4·7H2O, 2 g KCl, 3 g trisodium citrate, 1 g sodium glutamate, 50 mg FeSO4·4H2O, 0.36 mg MnCl2·4H2O, 5 g Bacto Casamino Acids, 5 g yeast extract, pH 7.2). For PHA accumulation analysis, H. mediterranei and H. hispanica cells were first grown at 37°C for 48 h in AS-168 medium, and then 5% inocula were transferred to 100 ml nutrient-limited MST (per liter, 200 g NaCl, 20 g MgSO4·7H2O, 2 g KCl, 1 g sodium glutamate, 37.5 mg KH2PO4, 50 mg FeSO4·7H2O, 0.36 mg MnCl2·4H2O, 1 g yeast extract, 10 g starch, pH 7.2) or MG medium (the same composition as MST except for glucose as a substitute for starch) in shaking flasks and cultivated for an additional 72 h. The pH was manually adjusted to be maintained at about 7.2 in the media. The haloarchaeal expression plasmids derived from pWL102 (Table 1) were usually first constructed in E. coli JM109 and then transformed into H. mediterranei or H. hispanica by a polyethylene glycol-mediated transformation method (4). When needed, mevinolin was added to a final concentration of 3 mg/liter or 5 mg/liter for H. mediterranei or H. hispanica transformants.
TABLE 1.
Strains and plasmids used in this study
| Strain or plasmid | Relevant characteristics | Source or reference |
|---|---|---|
| Strains | ||
| H. mediterranei CGMCC 1.2087 | Wild-type strain = ATCC 33500 | CGMCC |
| H. hispanica ATCC 33960 | Wild-type strain | ATCC |
| H. mediterranei ΔphaECHme | phaECHme-deleted mutant of H. mediterranei | This study |
| H. hispanica PHB-1 | phaECHh-deleted mutant of H. hispanica | 11 |
| E. coli JM109 | recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi | 35 |
| Plasmids | ||
| pGEM-T | 3.0-kb vector for PCR product cloning; Ampr | Promega |
| pWL102 | 10.5-kb shuttle vector; Ampr Mevr | 18 |
| pWL3E | 11.2 kb; phaEHme and its native promoter | This study |
| pWL3C | 12.1 kb; phaCHme and promoter of phaEHme | This study |
| pWL3EC | 12.6 kb; phaECHme and its native promoter | This study |
| pWL3ECS-1 | 12.3 kb; 3′-truncated phaECHme and its native promoter | This study |
| pUBP | 6.6 kb; derivative of pUBP2 by removing the pHH9-ori region | 11 |
| pLHC | 7.9 kb; integration vector for knockout of phaECHme of H. mediterranei CGMCC 1.2087 | This study |
| pWLEhis | 11.2 kb; shuttle vector for His-tag-fused PhaE | This study |
| pWLChis | 12.1 kb; shuttle vector for His-tag-fused PhaC | This study |
| pWLEC | 12.6 kb; phaECHm and its native promoter | 11 |
TABLE 2.
Oligonucleotides used in this study as primers for PCR
| Primer | 5′-3′ sequencea |
|---|---|
| P1 | CTCATCGTTTACGCGCTCATCAAC |
| P2 | GGCCTCCGGCGGGATGAGGTGGTC |
| AD1 | NGTCGASWGANAWGAA |
| AD2 | AGWGNAGWANCAWAGG |
| AD3 | NTCGASTWTSGWGTT |
| dp1 | TACGTCCGGTTGTTCGAG |
| dp2 | GCAGTTCTTGGAGGACGT |
| dp3 | CCAGATTGTCGGGGAGTA |
| up1 | CCATGCAGTACCCGAGAA |
| up2 | CGTGAGGTGGGTGTCGAG |
| up3 | GGTTGGAGGTCGAGAATG |
| KF1 | AGCCTGCAGCGGGTACGGGTGTTTCAG |
| KR1 | ATAGGATCCACAGACTACTCCGGCGTG |
| KF2 | ATAGGATCCGGCGAGTAAACCGTTCAA |
| KR2 | ATAGGTACCATCGGGAGCTGTACGGAC |
| phaEF1 | AGACGCCATGGACGAAAT |
| phaER1 | ATAGGATCCTCATCCCTCCACGTCCAT |
| phaCR1 | ATAGGATCCATCGGGAGCTGTACGGAC |
| phaCF1 | ATAGGATCCATGACACCAGTAACCTTCGC |
| phaCR2 | TCGGAGTTCCAGGTACCA |
| PER | ATAGGATCCGGGCATATACTCTCGGGC |
| phaCRS1 | ATAGGATCCTTATGAACGTTCGGCGAACCA |
| phaEFH | CCGACATATGTCACAACAAAAAGGGGA |
| phaERH | TTAGGTACCTTAGTGGTGGTGGTGGTGGTGTCCCTCCACGTCCATCGC |
| phaCFH | CCGACATATGACACCAGTAACCTTCGC |
| phaCRH | TTAGGTACCTTAGTGGTGGTGGTGGTGGTGGTCGGTGCGGTCGGATGC |
| PL | CGGGTACGGGTGTTTCAG |
| PR | ATCGGGAGCTGTACGGAC |
Sequences representing restriction sites are underlined.
Preparation and analysis of PHA granules.
The cellular PHA content and its composition were analyzed by gas chromatography (GC) (11). Briefly, 70 to 80 mg of lyophilized haloarchaeal cells was subjected to methanolysis in a mixture of chloroform and methanol containing 3% (vol/vol) sulfuric acid at 100°C for 4 h. The resulting hydroxyacyl methylesters were then analyzed with Agilent GC-6820. PHBV (Sigma) was used as the standard sample, with benzoic acid as the inner standard. To obtain PHA granules, H. mediterranei cells cultivated in MST medium were harvested by centrifugation, washed, and resuspended in TBS buffer (per liter, 20 mmol Tris-HCl [pH 7.5], 200 g NaCl, 20 g KCl, 5 g MgSO4·7H2O). Crude extracts were prepared by ultrasonic treatment of these cells, and the intact cells and debris were pelleted by centrifugation (15 min; 8,000 × g; 4°C). The PHA granules were purified by subsequent ultracentrifugation as described previously (11).
TEM analysis.
H. mediterranei cells cultivated in AS-168 or MST medium for 48 h were harvested by centrifugation and then subjected to transmission electron microscopy (TEM) analysis. Briefly, the cells were washed twice with sodium phosphate buffer (10% NaCl, 0.1 M sodium phosphate buffer [pH 7.2]) and then suspended in a solution (2.5% [vol/vol] glutaraldehyde, 10% NaCl, and 0.1 M sodium phosphate buffer [pH 7.2]) for primary fixation. After 2 h of fixation, the cells were pelleted and washed with sodium phosphate buffer three times. The cell pellets were then used for secondary fixation with 1.0% osmium tetroxide (OsO4) in 10% NaCl overnight. After three washes with sodium phosphate buffer, TEM analysis was performed according to the protocol described by Tian et al. (40). Micrographs were recorded using a Tecnai 20 electron microscope (FEI, The Netherlands).
Cloning of PHA synthase genes from H. mediterranei.
To screen PHA synthase genes in H. mediterranei, two PCR primers (P1 and P2) (Table 2) were designed based on highly conserved regions of known haloarchaeal PHA synthases (84-LIVYALIN-93 and 317-DHLIPPE-325; the numbering corresponds to H. marismortui PhaC (PhaCHm), GenBank accession no. AY596297). The resulting PCR fragment was ligated into the pGEM-T vector (Promega) and sequenced. To clone the full-length PHA synthase genes and the adjacent regions, a thermal asymmetric interlaced (TAIL) PCR (25) was performed. For this, three arbitrary degenerate (AD1 to -3) primers and three interlaced specific forward (dp1 to -3) and reverse (up1 to -3) primers complementary to the known partial phaCHme nucleotide sequence were designed (Table 2). The TAIL-PCR was performed according to the protocol developed by Liu et al. (24). The secondary and tertiary PCR products were separated by electrophoresis on a 1.0% agarose gel, and the different sizes of the two PCR products consistent with primer positions were used as the criteria for selection of correct TAIL-PCR products. The correct tertiary PCR product was purified and cloned into the pGEM-T vector, and its nucleotide sequence was determined by sequencing.
DNA and protein sequence analysis and phylogenetic tree construction.
DNA and deduced amino acid sequences were analyzed with DNASTAR software (2). Sequence homology analysis was performed using the BLAST service (http://www.ncbi.nlm.nih.gov/BLAST/BLAST.cgi) and the GeneDoc program (http://www.nrbsc.org/gfx/genedoc/index.html). The phylogenetic trees for PhaC and PhaE/R were constructed using the neighbor-joining method (34) with MEGA4 (39). The topology of the phylogenetic tree was evaluated by bootstrap analysis on the basis of 1,000 replications (7).
Western blot analysis.
For Western blot analysis, crude extracts from H. mediterranei cells were obtained by disrupting the cells with ultrasonication as described above. The concentrations of cellular proteins and PHA granule proteins were determined with a bicinchoninic acid protein assay kit (Pierce). One hundred micrograms of proteins from cellular extracts or PHA granules was then subjected to Western analysis with the anti-PhaEHm-His6 or anti-PhaCHm-His6 antiserum as described previously (11).
Disruption of the phaECHme genes in H. mediterranei.
The strategy for phaECHme gene disruption in H. mediterranei CGMCC (China General Microbiological Culture Collection Center) 1.2087 was based on a two-step procedure as described by Tu et al. (41). Briefly, a 677-bp DNA fragment located immediately upstream of the phaECHme operon and a 641-bp fragment in the 3′ region of the phaCHme gene were amplified by primer pairs KF1/KR1 and KF2/KR2 (Table 2), respectively. These two PCR products were sequenced and inserted into the plasmid pUBP (Table 1). The resulting plasmid, pLHC (Table 1), was then transformed into H. mediterranei to disrupt the phaECHme genes by homologous recombination, generating a phaECHme-deleted strain called ΔphaECHme.
Complementation analysis of the phaECHme functions in H. mediterranei ΔphaECHme and H. hispanica PHB-1.
To determine the functions of the phaECHme genes in the PHA-negative mutants, the complementation plasmids of the phaEHme and/or phaCHme gene were constructed as follows. Plasmids pWL3E and pWL3EC were constructed by, respectively, cloning of phaEHme (amplified with primers phaEF1 and phaER1) and phaECHme (amplified with primers phaEF1 and phaCR1) into pWL102, with the native promoter of phaECHme. For the phaCHme gene alone, the promoter sequence of the phaECHme genes (amplified with primers phaEF1 and PER) and the coding sequence of phaCHme (amplified with primers phaCF1 and phaCR2) were joined and inserted into pWL102, resulting in pWL3C. To investigate the function of the C terminus of PhaCHme, the DNA fragment of phaECHme with the truncated 3′ region of phaCHme was amplified with phaEF1 and phaCRS1 primers and inserted into pWL102, resulting in the plasmid pWL3ECS-1 (Table 1). Each construct was confirmed by sequencing and transformed into H. mediterranei ΔphaECHme or H. hispanica PHB-1 (11) to check if the capability for PHA accumulation had been restored.
Overexpression and purification of PhaEHme and PhaCHme.
For expression of PhaEHme and PhaCHme in H. hispanica PHB-1, the coding sequences of phaEHme and phaCHme were amplified with primer pairs phaEFH/phaERH and phaCFH/phaCRH (Table 2), respectively. With primers phaERH and phaCRH, six histidine codons (His6) were added to the 3′ end of phaEHme and phaCHme, respectively. These two PCR products were digested by NdeI and NcoI and cloned into the plasmid pWL102 under the strong promoter of a haloarchaeal heat shock gene (hsp5; GenBank accession no. AE004438), resulting in the plasmids pWLEhis and pWLChis (Table 1). The constructs were sequenced and then transformed into H. hispanica PHB-1. For isolation of PhaEHme-His6 and PhaCHme-His6 proteins, the PHB-1 transformants were cultivated at 37°C in 1-liter flasks in 500 ml AS-168 medium to the stationary growth phase and then were collected by centrifugation. The protein purification steps were performed according to the method described by Plößer and Pfeifer (29), except that phenylmethylsulfonyl fluoride (PMSF) was not added to the lysis buffer.
PHA synthase activity assay.
PHA synthase activity was measured spectrophotometrically by recording the release of CoA during the polymerization of 3-hydroxybutyryl-CoA. All assays were carried out at 37°C in a final volume of 1 ml containing 20 mM Tris-HCl (pH 7.5), 1 mM 5,5′-dithiobis-(2-nitrobenzoic acid), 3.4 M KCl, 100 μM Mg(CH3COO)2, 100 μM 3-hydroxybutyryl-CoA, 1 g/liter bovine serum albumin, and 10 μg of the mixed PhaEHme-His6 and PhaCHme-His6 (1:1) proteins. The mixture of PhaEHme-His6 and PhaCHme-His6 was stored at 4°C for about 3 h before the activity assay was performed. The absorbance at 412 nm was measured at defined time points. The concentration of CoA was determined using a molar absorption coefficient of 13,600 M−1 cm−1 (6). One unit was defined as the amount of enzyme that catalyzed the generation of 1 μmol CoA per min.
Nucleotide sequence accession number.
The DNA sequences of the phaECHme genes of H. mediterranei CGMCC 1.2087 reported in this study were deposited in GenBank under accession number EU374220.
RESULTS
PHA accumulation in H. mediterranei CGMCC 1.2087.
The capability of H. mediterranei CGMCC 1.2087 for PHA synthesis in shake flask cultures was investigated in both nutrient-rich AS-168 and nutrient-limited MST media. Interestingly, the strain was capable of synthesizing considerable PHA when cultivated under both growth conditions (Fig. 1). The typical PHA granules accounted for a significant fraction of the cell volume, with shapes and sizes (0.1 to 0.5 μm in diameter) similar to those in bacteria. These PHA granules were further identified as PHBV, as revealed by GC analysis (Table 3). H. mediterranei grown in AS-168 and MST media in shaking flasks accumulated PHBV up to 18.21% and 24.85% of the cell dry weight, containing 9.33 mol% and 13.37 mol% 3HV fraction, respectively (Table 3). These results were different from those of most PHA-accumulating microorganisms, which can synthesize detectable PHAs only under nutrient-limiting conditions with excess carbon source (11, 13, 38).
FIG. 1.
Electron micrographs of ultrathin sections of H. mediterranei demonstrating the accumulation of PHBV granules. The cells were cultured at 37°C for 48 h in AS-168 medium (A) and MST medium (B). The scale bars represent 0.5 μm.
TABLE 3.
PHA accumulation in H. mediterranei and H. hispanica strainsa
| Strain | Medium | Cell dry wt (g/liter) | PHBV content (% [wt/wt]) | 3HV fraction (mol%) | PHBV concn (g/liter) |
|---|---|---|---|---|---|
| H. mediterranei | AS-168 | 7.33 ± 0.51 | 18.21 ± 1.88 | 9.33 ± 0.13 | 1.33 ± 0.05 |
| H. mediterranei | MST | 7.01 ± 0.35 | 24.88 ± 1.27 | 13.37 ± 0.73 | 1.74 ± 0.04 |
| ΔphaECHme(pWL3E) | MST | 9.03 ± 0.14 | ND | ND | ND |
| ΔphaECHme(pWL3C) | MST | 9.27 ± 0.15 | ND | ND | ND |
| ΔphaECHme(pWL3EC) | MST | 9.02 ± 0.15 | 14.94 ± 0.24 | 11.85 ± 0.16 | 1.35 ± 0.04 |
| ΔphaECHme(pWLEC) | MST | 8.43 ± 0.31 | 17.26 ± 0.08 | 11.78 ± 0.44 | 1.38 ± 0.17 |
| H. hispanica | MG | 4.70 ± 0.23 | 12.26 ± 0.52 | 3.18 ± 0.35 | 0.58 ± 0.03 |
| PHB-1(pWL3E) | MG | 4.14 ± 0.10 | ND | ND | ND |
| PHB-1(pWL3C) | MG | 4.20 ± 0.21 | ND | ND | ND |
| PHB-1(pWL3EC) | MG | 5.27 ± 0.61 | 17.33 ± 0.04 | 3.14 ± 0.13 | 0.99 ± 0.11 |
| PHB-1(pWL3ECS-1) | MG | 6.39 ± 0.43 | 0.41 ± 0.02 | ND | 0.03 ± 0.00 |
The cells were cultured at 37°C for 72 h. The data are shown as mean ± standard deviation; n = 3. ND, not detectable.
Cloning and identification of PHA synthesis genes in H. mediterranei.
To clone the PHA biosynthesis genes in H. mediterranei, we first amplified a DNA fragment (∼700 bp) with two primers (P1 and P2) (Table 2) designed according to the highly conserved regions of known PhaC subunits of haloarchaea. The deduced amino acid sequence encoded by this PCR-amplified DNA showed high homology to PhaC subunits of haloarchaea and some bacteria, indicating that a partial sequence of the H. mediterranei PHA synthase gene (phaCHme) was obtained. In order to acquire the entire phaCHme gene and its adjacent genes, a TAIL-PCR was performed to clone the upstream (∼1,100-bp) and downstream (∼1,700-bp) sequences (Fig. 2A), and a 3,459-bp DNA fragment was cloned and sequenced (Fig. 2B). This DNA region consisted of four open reading frames (ORFs), ORF1 to -4.
FIG. 2.
Cloning and organization of the PHA synthase genes in H. mediterranei. (A) Cloning of the PHA synthase genes by TAIL-PCR. The left and right gels represent the second- and third-round (II and III) PCR products, upstream and downstream of the known partial phaC sequence, respectively. The interlaced specific primers (dp1 to -3 and up1 to -3) (Table 2) were designed based on the obtained partial phaC sequence (black box). AD, arbitrary degenerate primers (AD1 to -3) (Table 2). (B) Gene organization of the cloned DNA region. ORF1 encodes an unknown protein; ORF2 and ORF3 encode PhaEHme and PhaCHme, respectively; ORF4 encodes a universal stress protein (COG0589).
ORF2 and ORF3 encode proteins sharing 60% and 57% identity with PhaE and PhaC of Haloarcula (11); hence, they were designated phaEHme and phaCHme, respectively. The initiation codon (ATG) of phaEHme overlapped the termination condon (TGA) of phaCHme, sharing the two bases T and G, and the phaECHme genes were under the control of a single promoter upstream of phaEHme (see Fig. S1 in the supplemental material). Therefore, these two genes most likely constitute an operon, as observed in Haloarcula (11). PhaCHme (54,765 Da) contained a highly conserved “lipase box-like” sequence (Gly-X-Cys-X-Gly-Gly), which was believed to be an active site of PHA synthase (37). Moreover, the conserved class III PHA synthase box (10) and putative catalytic residues were also found in PhaCHme (Fig. 3). Interestingly, PhaCHme and other known haloarchaeal PhaC subunits had longer C termini than the bacterial class III PhaC subunits (Fig. 3), while the haloarchaeal PhaEs are much smaller than their counterparts in bacteria (11), suggesting that these haloarchaeal PHA synthases might constitute a new subgroup of class III PHA synthase.
FIG. 3.
Multiple alignments of partial amino acid sequences of PhaC subunits from H. mediterranei CGMCC 1.2087 (Hme), H. marismortui ATCC 43049 (Hm), H. hispanica ATCC 33960 (Hh), H. walsbyi DSM 16790 (Hw), Allochromatium vinosum (Av), Thiocystis violacea (Tv), Ectothiorhodospira shaposhnikovii (Es), Synechococcus sp. strain MA19 (MA19), and Synechocystis sp. strain PCC 6803 (6803). Amino acids are given in standard one-letter abbreviations, and the numbers indicate the positions of the amino acids within the respective proteins. The “lipase-like box” and the highly conserved motif of class III synthase are boxed. The conserved catalytic triad residues are shown with asterisks. The vertical arrow indicates the truncated site of the PhaC subunit encoded in pWL3ECS-1. Black shading indicates identical residues, and gray shading indicates similar residues. GenBank accession numbers are as follows: PhaCHme, EU374220; PhaCHm, YP_137339; PhaCHh, ABV71394; PhaCHw, YP_658052; PhaCAv, S29274; PhaCTv, AAC60430; PhaCEs, AAG30259; PhaCMA19, AAK38139; PhaC6803, BAA17430.
Upstream and downstream of the phaECHme genes there are ORF1, encoding an unknown protein, and ORF4, oriented in the opposite direction to the other three genes, encoding a putative universal stress protein (Fig. 2B). Both ORF1 and ORF4 had their own promoters (data not shown), and their relevance to PHA synthesis remains to be investigated.
Genetic determination of phaECHme function in PHBV synthesis.
Sequence analysis of the phaEHme and phaCHme genes suggested that they might encode the PHA synthase in H. mediterranei. To confirm this predication, the phaECHme genes in H. mediterranei were disrupted with a double-crossover homologous-recombination strategy, which resulted in a phaECHme-deleted strain called H. mediterranei ΔphaECHme. The successful deletion of the complete phaEHme gene, as well as the 5′ region of phaCHme, in H. mediterranei ΔphaECHme was proven by PCR analysis. As expected, GC analysis revealed that PHBV accumulation was completely abolished in the ΔphaECHme cells, while the PHA synthase activity of the crude extracts was also totally lost (data not shown). These results confirmed that the phaECHme genes are indeed involved in PHBV synthesis in H. mediterranei. To further analyze the functions of PhaEHme and PhaCHme during PHBV synthesis, the plasmids pWL3E, pWL3C, and pWL3EC were transformed into the ΔphaECHme strain. It was revealed that only the strain harboring pWL3EC exhibited PHA synthase activity in vitro. Consistently, only coexpression of the phaECHme genes in H. mediterranei ΔphaECHme restored the ability for PHBV accumulation (Table 3). Expression of either phaEHme or phaCHme alone in the ΔphaECHme strain could not lead to any detectable PHA synthesis (Table 3). Therefore, our results confirmed that the phaECHme genes encoded the PHA synthase in H. mediterranei. Intriguingly, when phaECHm genes (in pWLEC) from Haloarcula (11) were coexpressed in H. mediterranei ΔphaECHme, the ability for PHBV synthesis in this strain was also fully restored (Table 3), indicating that PhaECHme and PhaECHm have similar substrate specificities and enzyme activities.
The plasmids pWL3E, pWL3C, pWL3EC, and pWL3ECS-1, harboring a truncated phaCHme gene (Fig. 3), were also transformed into a PHA-negative archaeon, H. hispanica PHB-1 (11). As shown in Table 3, only coexpression of the phaECHme genes in H. hispanica PHB-1 could restore to this mutant the ability to accumulate PHA to the same level as the wild-type strain. Moreover, H. hispanica PHB-1 harboring pWL3ECS-1 accumulated much less PHA than the transformants harboring pWL3EC (Table 3). These results demonstrated that the phaECHme genes encoded a PHA synthase that also functioned in Haloarcula, and the longer C-terminal sequence of PhaCHme was indispensable for this functional PHA synthase. The PHA synthesized in H. hispanica has been previously recognized as PHB (11) due to the much lower 3HV content. Interestingly, although transformation of H. hispanica PHB-1 with the phaECHme genes restored the ability to produce PHA, the 3HV content was not elevated (Table 3), suggesting that the different 3HV contents in PHAs of H. hispanica and H. mediterranei were probably due to the precursor (3HV-CoA) synthesized and not the substrate specificities of the PHA synthases.
Expression and location of PhaCHme and PhaEHme in H. mediterranei.
To further demonstrate the functions of PhaCHme and PhaEHme in PHBV synthesis in H. mediterranei, Western blotting was performed to analyze the expression profiles of the two proteins and their association with the PHBV granules. Both PhaEHme and PhaCHme were detected in cellular extracts and PHBV granules, in either AS-168 or MST medium, in H. mediterranei, but not in the phaECHme-deleted strain ΔphaECHme (Fig. 4). This result suggested that both PhaEHme and PhaCHme were constitutively expressed and were stably attached to the PHA granules during PHA synthesis. The protein levels of PhaEHme and PhaCHme were influenced little by growth conditions, which might explain the PHBV accumulation of H. mediterranei in both nutrient-limited and -rich media (Fig. 1 and Table 3).
FIG. 4.
Western blot analysis of cellular extracts and PHA granules extracted from H. mediterranei with antisera against PhaEHm (A) and PhaCHm (B). Lanes 1, crude extracts of ΔphaECHme; lanes 2, crude extracts of ΔphaECHme harboring pWL3EC; lanes 3 and 4, crude extracts of the H. mediterranei wild-type strain grown in AS-168 medium for 48 and 72 h, respectively; lanes 5 and 6, crude extracts of the H. mediterranei wild-type strain grown in MST medium for 48 and 72 h, respectively; lanes 7, proteins from PHBV granules of H. mediterranei. Equal amounts (100 μg) of proteins were loaded on each lane.
H. mediterranei PHA synthase is composed of PhaC and PhaE subunits.
To determine that H. mediterranei PHA synthase was indeed a two-subunit enzyme, both PhaCHme and PhaEHme proteins with His6 tags, expressed under the control of a strong haloarchaeal promoter, were purified from the respective PHB-1 transformants and were subjected to PHA synthase activity assays. Significantly, neither PhaCHme nor PhaEHme alone could lead to a detectable PHA synthase activity in vitro, but a 1:1 mixture of the two proteins showed significant activity (∼50 U/mg).
Taken together, our genetic and biochemical evidence presented here established that the PHA synthase from H. mediterranei was composed of two subunits, PhaEHme and PhaCHme, and was responsible for PHBV biosynthesis in H. mediterranei.
DISCUSSION
PHA accumulation usually occurs under conditions with a limitation of an essential nutrient but in the presence of excess carbon resources (27). However, it has been reported that Cupriavidus necator (formerly Ralstonia eutropha) can accumulate 2.6% (wt/wt) PHB in a nutrient-rich medium (43), and the PHB content was as high as 35% (wt/wt) transiently in the early growth phase and then decreased gradually (33). In the present study, H. mediterranei was revealed to synthesize up to 18% (wt/wt) PHBV at 72 h in nutrient-rich AS-168 medium (Fig. 1A and Table 3), which is different from many bacteria, whose PHA contents were relatively low in nutrient-rich media, and was also distinct from H. marismortui, which could accumulate only trace amounts of PHB when cultured in AS-168 medium (11). Consistently, it has been reported that limitation of the nitrogen source has little stimulating effect on PHA production in H. mediterranei (23). This is likely because H. mediterranei could also synthesize PHBV from amino acids, but the detailed pathway of PHA biosynthesis in H. mediterranei remains to be investigated.
Recently, the class III PHA synthase from Haloarcula was genetically identified for the first time in the domain Archaea in our laboratory (11). However, direct biochemical proofs supporting the notion that this synthase consists of only two subunits are still lacking. In our current study, investigation of the enzyme activities of purified PhaEHme and PhaCHme directly proved that the H. mediterranei PHBV synthase was indeed composed of two subunits, PhaE and PhaC. Further analysis of the complete genome sequences of Haloquadratum walsbyi also suggests that it harbors a locus of PHA synthase genes; one gene is annotated as phaC, and the other one in the same operon encodes a homologue of the PhaE subunit. Therefore, the class III PHA synthase is likely widespread in haloarchaea. Phylogenetic trees of PhaC and PhaE/R subunits from some representative bacteria and haloarchaea further suggested that the PHA synthase from haloarchaea belongs to a novel subgroup of the class III family (Fig. 5). Due to the limitation of our knowledge about haloarchaeal PHA biosynthesis, it is still unclear whether other types of PHA synthases also exist in haloarchaea. Interestingly, PHA biosynthesis genes are often clustered in PHA-accumulating bacteria (32), whereas all the known haloarchaeal PHA synthase genes are not clustered with other PHA biosynthesis genes (e.g., phaAB), except that H. walsbyi harbors a phaB gene upstream of the phaEC genes. It has been proposed that the PHA biosynthesis genes in haloarchaea might have been acquired from bacteria through horizontal gene transfer (15), and the genes involved in supplying PHA monomer may have been separated from the PHA synthase genes when gene transposition occurred.
FIG. 5.
Phylogenetic trees of four classes of PHA synthases from prokaryotes, including bacteria and haloarchaea (boldface). (A) PhaE or PhaR subunits. (B) PhaC subunits. The phylogenetic trees were constructed based on the amino acid sequence of each protein; the GenBank accession number is given after the microorganism name. The trees were obtained using the neighbor-joining algorithm with MEGA software version 4.0. The numbers next to the nodes indicate the bootstrap values based on 1,000 replications (expressed as percentages). Scale bar = 0.2 substitution per site.
While the PhaC subunit probably represents the catalytic subunit of PHA synthase, the detailed function of PhaE remains unclear. The H. mediterranei PhaCHme subunit contains the catalytic domain and conserved residues but has a longer C terminus than its bacterial counterparts (Fig. 3). Deletion of this region in PhaCHme sharply reduces PHA synthesis ability (Table 3), suggesting the important function of the C-terminal part of this haloarchaeal-type PhaC. Interestingly, all of the known haloarchaeal PhaE subunits (∼20 kDa) are much smaller than their bacterial counterparts (∼40 kDa). The PhaEHme subunit has been revealed to be bound to PHA granules like the bacterial PhaE subunits (Fig. 4), but it lacks the conserved domains of bacterial PhaEs, e.g., the PhaE box (9). While the PhaE subunits in Haloarcula harbor a PhaE box (11), the putative PhaE in H. walsbyi also lacks this motif (data not shown). These results further suggest that haloarchaeal PHA synthases constitute a novel subgroup of the class III PHA synthase, and it is imperative to clarify the actual functions of the haloarchaeal-type PhaE subunits in the future.
Supplementary Material
Acknowledgments
This work was supported in part by grants from the Ministry of Science and Technology of China (2004CB719603 and 2006AA09Z401), the National Natural Science Foundation of China (30570029 and 30621005), and the Chinese Academy of Sciences (KSCX2-YW-G-023).
Footnotes
Published ahead of print on 11 April 2008.
Supplemental material for this article may be found at http://jb.asm.org/.
REFERENCES
- 1.Bauer, H., and A. J. Owen. 1988. Some structural and mechanical properties of bacterially produced poly-β-hydroxybutyrate-co-β-hydroxyvalerate. Colloid Polym. Sci. 266241-247. [Google Scholar]
- 2.Burland, T. G. 2000. DNASTAR's Lasergene sequence analysis software. Methods Mol. Biol. 13271-91. [DOI] [PubMed] [Google Scholar]
- 3.Cheung, J., K. J. Danna, E. M. O'Connor, L. B. Price, and R. F. Shand. 1997. Isolation, sequence, and expression of the gene encoding halocin H4, a bacteriocin from the halophilic archaeon Haloferax mediterranei R4. J. Bacteriol. 179548-551. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Cline, S. W., W. L. Lam, R. L. Charlebois, L. C. Schalkwyk, and W. F. Doolittle. 1989. Transformation methods for halophilic archaebacteria. Can. J. Microbiol. 35148-152. [DOI] [PubMed] [Google Scholar]
- 5.Don, T. M., C. W. Chen, and T. H. Chan. 2006. Preparation and characterization of poly(hydroxyalkanoate) from the fermentation of Haloferax mediterranei. J. Biomater. Sci. Polym. 171425-1438. [DOI] [PubMed] [Google Scholar]
- 6.Ellman, G. L. 1959. Tissue sulfhydryl groups. Arch. Biochem. Biophys. 8270-77. [DOI] [PubMed] [Google Scholar]
- 7.Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39783-791. [DOI] [PubMed] [Google Scholar]
- 8.Fernandez-Castillo, R., F. Rodriguez-Valera, J. Gonzalez-Ramos, and F. Ruiz-Berraquero. 1986. Accumulation of poly(beta-hydroxybutyrate) by halobacteria. Appl. Environ. Microbiol. 51214-216. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hai, T., S. Hein, and A. Steinbüchel. 2001. Multiple evidence for widespread and general occurrence of type-III PHA synthases in cyanobacteria and molecular characterization of the PHA synthases from two thermophilic cyanobacteria: Chlorogloeopsis fritschii PCC 6912 and Synechococcus sp. strain MA19. Microbiology 1473047-3060. [DOI] [PubMed] [Google Scholar]
- 10.Hai, T., D. Lange, R. Rabus, and A. Steinbüchel. 2004. Polyhydroxyalkanoate (PHA) accumulation in sulfate-reducing bacteria and identification of a class III PHA synthase (PhaEC) in Desulfococcus multivorans. Appl. Environ. Microbiol. 704440-4448. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Han, J., Q. Lu, L. Zhou, J. Zhou, and H. Xiang. 2007. Molecular characterization of the phaECHm genes, required for biosynthesis of poly(3-hydroxybutyrate) in the extremely halophilic archaeon Haloarcula marismortui. Appl. Environ. Microbiol. 736058-6065. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Hezayen, F. F., B. H. Rehm, R. Eberhardt, and A. Steinbüchel. 2000. Polymer production by two newly isolated extremely halophilic archaea: application of a novel corrosion-resistant bioreactor. Appl. Microbiol. Biotechnol. 54319-325. [DOI] [PubMed] [Google Scholar]
- 13.Hezayen, F. F., A. Steinbüchel, and B. H. Rehm. 2002. Biochemical and enzymological properties of the polyhydroxybutyrate synthase from the extremely halophilic archaeon strain 56. Arch. Biochem. Biophys. 403284-291. [DOI] [PubMed] [Google Scholar]
- 14.Huang, T. Y., K. J. Duan, S. Y. Huang, and C. W. Chen. 2006. Production of polyhydroxyalkanoates from inexpensive extruded rice bran and starch by Haloferax mediterranei. J. Ind. Microbiol. Biotechnol. 33701-706. [DOI] [PubMed] [Google Scholar]
- 15.Kalia, V. C., S. Lal, and S. Cheema. 2007. Insight into the phylogeny of polyhydroxyalkanoate biosynthesis: horizontal gene transfer. Gene 38919-26. [DOI] [PubMed] [Google Scholar]
- 16.Kirk, R. G., and M. Ginzburg. 1972. Ultrastructure of two species of halobacterium. J. Ultrastruct. Res. 4180-94. [DOI] [PubMed] [Google Scholar]
- 17.Koller, M., P. Hesse, R. Bona, C. Kutschera, A. Atlić, and G. Braunegg. 2007. Potential of various archae- and eubacterial strains as industrial polyhydroxyalkanoate producers from whey. Macromol. Biosci. 7218-226. [DOI] [PubMed] [Google Scholar]
- 18.Lam, W. L., and W. F. Doolittle. 1989. Shuttle vectors for the archaebacterium Halobacterium volcanii. Proc. Natl. Acad. Sci. USA 865478-5482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Lee, S. Y. 1996. Progress and prospects for polyhydroxyalkanoate production in bacteria. Trends Biotechnol. 14431-438. [Google Scholar]
- 20.Legault, B. A., A. Lopez-Lopez, J. C. Alba-Casado, W. F. Doolittle, H. Bolhuis, F. Rodriguez-Valera, and R. T. Papke. 2006. Environmental genomics of “Haloquadratum walsbyi” in a saltern crystallizer indicates a large pool of accessory genes in an otherwise coherent species. BMC Genom. 7171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Liebergesell, M., K. Sonomoto, M. Madkour, F. Mayer, and A. Steinbüchel. 1994. Purification and characterization of the poly(hydroxyalkanoic acid) synthase from Chromatium vinosum and localization of the enzyme at the surface of poly(hydroxyalkanoic acid) granules. Eur. J. Biochem. 22671-80. [DOI] [PubMed] [Google Scholar]
- 22.Liebergesell, M., and A. Steinbüchel. 1992. Cloning and nucleotide sequences of genes relevant for biosynthesis of poly(3-hydroxybutyric acid) in Chromatium vinosum strain D. Eur. J. Biochem. 209135-150. [DOI] [PubMed] [Google Scholar]
- 23.Lillo, J. G., and F. Rodriguez-Valera. 1990. Effects of Culture conditions on poly(beta-hydroxybutyric acid) production by Haloferax mediterranei. Appl. Environ. Microbiol. 562517-2521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Liu, Y. G., N. Mitsukawa, T. Oosumi, and R. F. Whittier. 1995. Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J. 8457-463. [DOI] [PubMed] [Google Scholar]
- 25.Liu, Y. G., and R. F. Whittier. 1995. Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25674-681. [DOI] [PubMed] [Google Scholar]
- 26.López-García, P., A. St. Jean, R. Amils, and R. L. Charlebois. 1995. Genomic stability in the archaeae Haloferax volcanii and Haloferax mediterranei. J. Bacteriol. 1771405-1408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Madison, L. L., and G. W. Huisman. 1999. Metabolic engineering of poly(3-hydroxyalkanoates): from DNA to plastic. Microbiol. Mol. Biol. Rev. 6321-53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.McCool, G. J., and M. C. Cannon. 2001. PhaC and PhaR are required for polyhydroxyalkanoic acid synthase activity in Bacillus megaterium. J. Bacteriol. 1834235-4243. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Plößer, P., and F. Pfeifer. 2002. A bZIP protein from halophilic archaea: structural features and dimer formation of cGvpE from Halobacterium salinarum. Mol. Microbiol. 45511-520. [DOI] [PubMed] [Google Scholar]
- 30.Rehm, B. H. 2007. Biogenesis of microbial polyhydroxyalkanoate granules: a platform technology for the production of tailor-made bioparticles. Curr. Issues Mol. Biol. 941-62. [PubMed] [Google Scholar]
- 31.Rehm, B. H. 2003. Polyester synthases: natural catalysts for plastics. Biochem. J. 37615-33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Rehm, B. H., and A. Steinbüchel. 1999. Biochemical and genetic analysis of PHA synthases and other proteins required for PHA synthesis. Int. J. Biol. Macromol. 253-19. [DOI] [PubMed] [Google Scholar]
- 33.Saegusa, H., M. Shiraki, C. Kanai, and T. Saito. 2001. Cloning of an intracellular poly[D(−)-3-hydroxybutyrate] depolymerase gene from Ralstonia eutropha H16 and characterization of the gene product. J. Bacteriol. 18394-100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4406-425. [DOI] [PubMed] [Google Scholar]
- 35.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- 36.Steinbüchel, A., and T. Lütke-Eversloh. 2003. Metabolic engineering and pathway construction for biotechnological production of relevant polyhydroxyalkanoates in microorganisms. Biochem. Eng. J. 1681-96. [Google Scholar]
- 37.Stubbe, J., and J. Tian. 2003. Polyhydroxyalkanoate (PHA) hemeostasis: the role of PHA synthase. Nat. Prod. Rep. 20445-457. [DOI] [PubMed] [Google Scholar]
- 38.Stubbe, J., J. Tian, A. He, A. J. Sinskey, A. G. Lawrence, and P. Liu. 2005. Nontemplate-dependent polymerization processes: polyhydroxyalkanoate synthases as a paradigm. Annu. Rev. Biochem. 74433-480. [DOI] [PubMed] [Google Scholar]
- 39.Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 241596-1599. [DOI] [PubMed] [Google Scholar]
- 40.Tian, J., A. J. Sinskey, and J. Stubbe. 2005. Kinetic studies of polyhydroxybutyrate granule formation in Wautersia eutropha H16 by transmission electron microscopy. J. Bacteriol. 1873814-3824. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Tu, D., G. Blaha, P. B. Moore, and T. A. Steitz. 2005. Gene replacement in Haloarcula marismortui: construction of a strain with two of its three chromosomal rRNA operons deleted. Extremophiles 9427-435. [DOI] [PubMed] [Google Scholar]
- 42.Valappil, S. P., A. R. Boccaccini, C. Bucke, and I. Roy. 2007. Polyhydroxyalkanoates in Gram-positive bacteria: insights from the genera Bacillus and Streptomyces. Antonie van Leeuwenhoek 911-17. [DOI] [PubMed] [Google Scholar]
- 43.York, G. M., J. Stubbe, and A. J. Sinskey. 2001. New insight into the role of the PhaP phasin of Ralstonia eutropha in promoting synthesis of polyhydroxybutyrate. J. Bacteriol. 1832394-2397. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.





