Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2008 May 16;190(14):5137–5141. doi: 10.1128/JB.00246-08

The Burkholderia mallei BmaR3-BmaI3 Quorum-Sensing System Produces and Responds to N-3-Hydroxy-Octanoyl Homoserine Lactone▿

Breck A Duerkop 1, Jake P Herman 2, Ricky L Ulrich 3, Mair E A Churchill 2, E Peter Greenberg 1,*
PMCID: PMC2447019  PMID: 18487338

Abstract

Burkholderia mallei has two acyl-homoserine lactone (acyl-HSL) signal generator-receptor pairs and two additional signal receptors, all of which contribute to virulence. We show that B. mallei produces N-3-hydroxy-octanoyl HSL (3OHC8-HSL) but a bmaI3 mutant does not. Recombinant Escherichia coli expressing BmaI3 produces hydroxylated acyl-HSLs, with 3OHC8-HSL being the most abundant compound. In recombinant E. coli, BmaR3 responds to 3OHC8-HSL but not to other acyl-HSLs. These data indicate that the signal for BmaR3-BmaI3 quorum sensing is 3OHC8-HSL.


Many bacterial species regulate gene expression in a cell density-dependent fashion. This type of coordinated group behavior has been termed quorum sensing. In Proteobacteria, acyl-homoserine lactones (acyl-HSLs) serve as quorum-sensing signals (8, 10). These molecules can diffuse into and out of cells and, upon reaching a critical concentration, activate transcriptional regulators that control distinct sets of genes. Acyl-HSL quorum sensing was first described to occur in the marine bacterium Vibrio fischeri, where it controls luminescence (6, 21) and other factors (1, 3). V. fischeri quorum sensing requires two proteins, LuxI and LuxR (7). The LuxI protein is an N-3-oxo-hexanoyl-HSL (3OC6-HSL) synthase, and LuxR is a 3OC6-HSL responsive transcription factor, which activates luminescence gene expression. Many Proteobacteria have acyl-HSL quorum-sensing systems with LuxI homologs that catalyze the synthesis of acyl-HSLs that differ in length, third carbon substitution, and the degree of saturation of the acyl side group (9). The acyl-HSLs bind to their cognate LuxR homologs, which act as transcription factors controlling diverse cellular functions, including virulence factor production, symbiosis, DNA transfer, and extracellular antibiotic production (10, 14, 29).

Burkholderia mallei, the etiologic agent of the disease glanders, is a rod-shaped proteobacterium that exists as an obligate animal pathogen (28, 30). Solipeds (including horses, mules, and donkeys) are the natural hosts and reservoirs of B. mallei, but this pathogen can also infect other mammals, including humans (20). The B. mallei genome contains two luxI and four luxR homologs, and each of these putative quorum-sensing genes has been established as a virulence factor (27). The genes controlled by quorum sensing and the contributions that they make to B. mallei pathogenesis remain to be determined. To better understand the role of quorum sensing during B. mallei pathogenesis, it is important to first identify the acyl-HSL signals produced by the LuxI homologs and to determine which LuxR homologs respond to these acyl-HSLs. One B. mallei quorum-sensing pair has been analyzed in detail (5). The BmaR1-BmaI1 system produces N-octanoyl-HSL (C8-HSL), which binds to BmaR1, and in recombinant Escherichia coli, C8-HSL and BmaR1 positively autoregulate the bmaI1 promoter. This system is analogous to the BpsR-BpsI quorum-sensing system of the related bacterium Burkholderia pseudomallei, which uses C8-HSL to control siderophore production, phospholipase C production, and the oxidative stress response (19, 26). It is currently unknown whether B. mallei uses the BmaR1-BmaI1 quorum-sensing system to control similar functions. The second LuxR-LuxI homolog pair of B. mallei, BmaR3-BmaI3, and the orphan LuxR receptors BmaR4 and BmaR5 remain uncharacterized. In this study, we have used LuxR homolog-dependent bioassays, a radiotracer assay, and mass spectrometry to show that BmaI3 produces N-3-hydroxy-hexanoyl-HSL (3OHC6-HSL), N-3-hydroxy-octanoyl-HSL (3OHC8-HSL), and N-3-hydroxy-decanoyl-HSL (3OHC10-HSL), with 3OHC8-HSL as the most abundant of these compounds. By using a reporter in recombinant E. coli, we show that BmaR3 responds preferentially to the most abundant BmaI3 product, 3OHC8-HSL.

We used Escherichia coli DH5α, B. mallei ATCC 23344 and RJ17, and Pseudomonas fluorescens 1855 (Table 1). The gentamicin-resistant (Gmr) B. mallei strain RJ17 was constructed before the Centers for Disease Control Select Agent Program (CDC-SAP) determined that the use of Gmr in B. mallei requires prior CDC-SAP authorization. This strain has been destroyed. The genome sequence of B. mallei ATCC 23344 can be found at http://pathema.tigr.org/Burkholderia/beta/. E. coli was grown in Luria-Bertani (LB) broth at 37°C, and B. mallei was grown in LB containing glycerol (4%, vol/vol) at 37°C. P. fluorescens was grown at 30°C in modified A medium, which consisted of 60 mM KH2PO4, 33 mM K2HPO4, 7.5 mM (NH4)2SO4, 1.7 mM sodium citrate, 1 mM MgSO4, 0.05% yeast extract, and 0.4% glucose. When appropriate, the following antibiotics were included in the growth medium (per ml): ampicillin (100 μg), gentamicin (15 μg for E. coli and 5 μg for B. mallei), kanamycin (100 μg), and streptomycin (100 μg). For BmaI3 expression in E. coli, we PCR amplified the bmaI3 gene (BMA_A 1577) by using the primers bmaI3F and bmaI3R (Table 1). The product extends from position +1 to +608 with respect to the predicted bmaI3 translational start site. We introduced this product into EcoRI-XbaI-digested pBAD24 by standard procedures (13). The resulting plasmid, pBAD24.bmaI3, contains an arabinose promoter-driven bmaI3. For expression of BmaR3 in E. coli, it was necessary to use a fusion protein of BmaR3 with an N-terminal histidine affinity tag to obtain soluble protein. We first PCR amplified the bmaR3 (BMA_A 1576) coding region (positions +1 to + 692 in relation to the predicted translational start site) as an NdeI-BamHI fragment by using the primers bmaR3F and bmaR3R (Table 1). The PCR product was ligated to NdeI-BamHI-digested pJLQHis plasmid (17), creating pQF5016b.bmaR3, a bmaR3 N-terminal histidine fusion vector. To place His-tagged bmaR3 under the control of the arabinose promoter in plasmid pJN105 (22), pQF5016b.bmaR3 was used as the template for the PCR amplification of the His fusion-bmaR3, using primers HisR3F and HisR3R (Table 1). This PCR product was ligated to EcoRI-SacI-digested pJN105, creating pJN105.HisR3. We transformed E. coli carrying pJN105.HisR3 with pBD5, which carries a bmaI1-lacZ fusion (5). This transformant was used in subsequent BmaR3-dependent acyl-HSL dose response experiments. PCR-generated clones were confirmed by DNA sequencing. The medium for all arabinose induction experiments contained 0.2% l-arabinose. We measured β-galactosidase activity with a Tropix Galacto-Light Plus chemiluminescence kit according to the manufacturer's protocol (Applied Biosystems, Foster City, CA).

TABLE 1.

Bacterial strains, plasmids, and primers used in this study

Bacterial strain, plasmid, or primer Genotype, phenotype, or primer sequencea (5′-3′) Reference, source, or description
B. mallei strains
    ATCC 23344 Wild-type strain 23
    RJ17 bmaI3 mutant of ATCC 23344; bmaI3::pRUI3; Gmr 27
E. coli DH5α F− φ80lacZΔM15 Δ(lacZYA-argF)U169 hsdR17(rK− mK+) recA1 endA1 phoA supE44 thi-1 gyrA96 relA1 λ− Invitrogen
P. fluorescens 1855 bioassay strain Wild-type strain carrying the phzR expression plasmid pSF105 and the phzR-phzA intergenic region fused to lacZ on pSF107; Kmr Smr 16
Plasmids
    pBAD24 araC-PBAD cloned into pDHB60; optimized SDb; Apr 13
    pJN105 araC-PBAD cloned into pBBR1MCS-5; Gmr 22
    pJLQHis N-terminal histidine fusion vector containing the qscR gene; Apr 17
    pBAD24.bmaI3 pBAD24 containing the bmaI3 gene; Apr This study
    pQF5016b.bmaR3 N-terminal histidine fusion vector pJLQHis containing the bmaR3 gene; Apr This study
    pJN105.HisR3 pJN105 containing the N-terminal histidine fusion of bmaR3; Gmr This study
    pBD5 bmaI1 promoter-lacZ fusion vector; Apr 5
Primers
    bmaI3F AAGAATTCAAAATGTCATACATCATCGCGGGCC bmaI3 forward primer
    bmaI3R TTTCTAGATCAATGCATCGCCAGGC bmaI3 reverse primer
    bmaR3F NNNNNNCATATGCTCTCCGCCGCGTGGCC bmaR3 forward primer
    bmaR3R NGGATCCTCATGGAAAGATGAGCC bmaR3 reverse primer
    HisR3F NGAATTCTATAACCATGGGCCATCATC HisbmaR3 forward primer
    HisR3R NNGAGCTCTCATGGAAAGATGAGCCC HisbmaR3 reverse primer
a

Endonuclease restriction sites are underlined.

b

SD, Shine-Dalgarno sequence.

BmaI3 is a 3OHC8-HSL synthase.

We extracted acyl-HSLs from culture fluid of both wild-type B. mallei and the bmaI3 mutant with ethyl acetate when the cultures reached the late logarithmic phase of growth (optical density at 600 nm of 2.0) as described previously (5). Extracts from 10-ml cultures were concentrated by evaporation under a constant stream of nitrogen gas and separated by C18 reverse-phase high-performance liquid chromatography (HPLC). Twenty percent of the material from each HPLC fraction was tested for acyl-HSL activity by using P. fluorescens 1855 carrying pSF105 and pSF107 as a reporter. This reporter is particularly sensitive to hydroxylated acyl-HSLs (16). Wild-type B. mallei extracts showed three peaks of acyl-HSL activity (Fig. 1A). These peaks coeluted with synthetic N-hexanoyl-HSL (C6-HSL), C8-HSL, and 3OHC8-HSL. Under conditions where C6-HSL, C8-HSL, and 3OHC8-HSL were produced in the parent strain, the profile obtained from the bmaI3 mutant extract was devoid of detectable 3OHC8-HSL but retained the C6-HSL and C8-HSL peaks. We previously showed that the other B. mallei acyl-HSL synthase, BmaI1, is responsible for production of C8-HSL (5). We attribute the production of C6-HSL to BmaI1 because both the wild type and the bmaI3 mutant produced this acyl-HSL. We next tested whether the primary product of BmaI3 is 3OHC8-HSL by using E. coli containing pBAD24.bmaI3 to ectopically express BmaI3. We assessed BmaI3-dependent acyl-HSL production in E. coli by using a radiotracer assay (24). The radiotracer assay provides an advantage over LuxR homolog-dependent bioassays because it allows an indiscriminant view of all acyl-HSLs produced by a LuxI homolog irrespective of acyl side chain length and substitution and because all acyl-HSLs are equally labeled using this method. A 50-ml culture of E. coli expressing BmaI3 was grown to an optical density at 600 nm of 0.8 at 37°C, the cells were pelleted by centrifugation and resuspended in 1 ml of phosphate-buffered saline, and 5 μCi of [14C]methionine (American Radiolabeled Chemicals, St. Louis, MO) was added. After 3 hours at 37°C with shaking, the culture was extracted with two equal volumes of ethyl acetate. The extract was separated by HPLC, each fraction was mixed with 4 ml of complete counting cocktail (Research Products International, Mt. Prospect, IL), and radioactivity was measured using a Beckman LS6500 liquid scintillation counter. The radiotracer assay revealed several hydroxylated acyl-HSL molecules in extracts of E. coli expressing BmaI3. The most abundant species was eluted in fractions where synthetic 3OHC8-HSL is eluted (Fig. 1B). Two minor products eluted where synthetic 3OHC6-HSL and 3OHC10-HSL elute. To confirm the molecular structure of these acyl-HSLs, we extracted E. coli pBAD24.bmaI3 culture fluid (10 ml) with ethyl acetate and subjected the extract to liquid chromatography-electrospray ionization-tandem mass spectrometry (LC MS/MS) (11, 15). Retention time analysis, comparisons to synthetic standards, and the fragmentation patterns in MS/MS identified both 3OHC8-HSL and 3OHC10-HSL in the ethyl acetate extract (Fig. 2). We were unable to detect the minor product 3OHC6-HSL by LC MS/MS for reasons that are unclear. These data show that BmaI3 is capable of synthesizing hydroxylated acyl-HSLs, it produces 3OHC8-HSL in the greatest abundance, and in B. mallei, 3OHC8-HSL synthesis is BmaI3 dependent.

FIG. 1.

FIG. 1.

Methanol-gradient HPLC separation of acyl-HSLs from B. mallei and recombinant E. coli containing bmaI3. (A) HPLC separation of ethyl acetate-extracted culture fluid from B. mallei (•) or the bmaI3 mutant strain RJ17 (○). Fractions containing acyl-HSLs were identified by using a P. fluorescens 1855 reporter. Peak size does not correlate with overall abundance of an acyl-HSL product, and although this bioassay has broad acyl-HSL specificity, it does not detect all acyl-HSLs. The arrow indicates where synthetic 3OHC8-HSL was eluted. Activity of β-galactosidase is reported in relative light units (RLU). (B) HPLC profile of ethyl acetate extract of culture fluid from E. coli containing pBAD24.bmaI3. This analysis involved a radiotracer assay as described elsewhere (24). The radiotracer assay shows the relative abundances of all acyl-HSLs produced, regardless of differences in the side chain moiety. The numbered arrows show where synthetic acyl-HSLs eluted: 1, 3OHC6-HSL; 2, C6-HSL; 3, 3OHC8-HSL; 4, C8-HSL; and 5, 3OHC10-HSL. The dashed line indicates the percent methanol.

FIG. 2.

FIG. 2.

LC MS/MS analysis of ethyl acetate-extracted acyl-HSLs from E. coli overexpressing BmaI3. (A) Reverse-phase chromatographic profile of an ethyl acetate extract from E. coli pBAD24.bmaI3. Acyl-HSLs were identified by retention time analysis and by comparison to synthetic standards. Deuterated forms of C6-HSL (D3-C6-HSL) and C12-HSL (D3-C12-HSL) were included as internal standards. The molecular structures of 3OHC8-HSL (B) and 3OHC10-HSL (C) were confirmed by their MS/MS fragmentation patterns.

BmaR3 is the cognate receptor for 3OHC8-HSL.

luxR homologs that reside next to luxI homologs encode proteins that respond to the acyl-HSL produced by the adjacent luxI homolog. Thus, the linked genes are said to encode a cognate quorum-sensing signal generator-receptor pair (2, 4, 18, 25). The B. mallei bmaR3 and bmaI3 genes are adjacent. Therefore, it is likely that BmaR3 responds specifically to the 3OHC8-HSL signal produced by BmaI3. Unfortunately, we do not know of any BmaR3-dependent B. mallei genes, and several genes tested in recombinant E. coli, including bmaI3, did not show BmaR3 dependence (data not shown). Therefore, we created a BmaR3-specific E. coli reporter carrying a plasmid with the bmaI1 acyl-HSL synthase promoter fused to β-galactosidase and a BmaR3 expression plasmid. The bmaI1 promoter is activated by BmaR1 and its cognate signal C8-HSL (5). We used this strain because there is precedence for cross-specificity of LuxR homologs (12). BmaR3 was expressed as an N-terminal His-tagged protein, and bmaI1-lacZ induction by various acyl-HSLs was measured as β-galactosidase activity. In the presence of 3OHC8-HSL, activation of the bmaI1 promoter showed dependence on both BmaR3 and 3OHC8-HSL (Fig. 3). The other acyl-HSLs tested did not substitute for 3OHC8-HSL. These signals included 3OHC6-HSL and 3OHC10-HSL, which are both synthesized by BmaI3 in relatively small proportions compared to 3OHC8-HSL (Fig. 3 and data not shown). Thus, we believe that BmaR3 and BmaI3 are a cognate quorum-sensing pair and that 3OHC8-HSL is the relevant signal.

FIG. 3.

FIG. 3.

BmaR3 responds to 3OHC8-HSL and activates transcription from the bmaI1 promoter. Shown is an acyl-HSL dose response analysis of the bmaI1 promoter in E. coli expressing BmaR3 from pJN105.HisR3. Increasing concentrations of 3OHC8-HSL (▪), 3OHC6-HSL (♦), C8-HSL (•), C10-HSL (▴), 3OC6-HSL (□), 3OC8-HSL (○), and 3OC12-HSL (▵) were added to the E. coli cultures. “+” represents a control showing the 3OHC8-HSL response in the absence of the BmaR3 expression vector. The concentration of 3OHC8-HSL needed to achieve half-maximal activation of the bmaI1 promoter was 48 nM. β-Galactosidase activity is in relative light units (RLU). Values are the means ± the standard errors of the mean for three independent experiments.

Conclusions.

It was recently shown that B. mallei produces an array of acyl-HSL molecules, including C8-HSL, 3OHC8-HSL, and N-decanoyl-HSL (C10-HSL) (27). However, it was unclear which acyl-HSL synthase produced which acyl-HSL(s) and in what relative abundances the acyl-HSLs were produced. We previously reported that C8-HSL is the primary product of BmaI1 and BmaR1 is a C8-HSL receptor. Conversely, 3OHC8-HSL production was not BmaI1 dependent. This indicated that 3OHC8-HSL was produced by a different acyl-HSL synthase (5). The other acyl-HSL synthase gene revealed by whole-genome sequencing is bmaI3 (27). A comparison of the acyl-HSL profiles of wild-type B. mallei and a bmaI3 mutant revealed that 3OHC8-HSL production depended on bmaI3 at least under the conditions of our experiments. Wild-type B. mallei produced both C8-HSL and 3OHC8-HSL. Our data on signal production are consistent with our previous data, except that we detected greater quantities of C8-HSL and 3OHC8-HSL in our current study. Wild-type culture fluid contained 250 nM C8-HSL and 30 nM 3OHC8-HSL. This is 5- and 15-fold more of each signal than for our previous publication (5). We attribute this discrepancy to the addition of MOPS (morpholinepropanesulfonic acid) buffer to the LB-glycerol medium to maintain a culture pH of 7.0. This reduces base hydrolysis of the homoserine-lactone ring during growth. Using both C18 reverse-phase HPLC and mass spectrometry, we were able to identify three hydroxylated acyl-HSL products of BmaI3. Our evidence indicates that the most abundant species and the ligand for BmaR3 is 3OHC8-HSL. In recombinant E. coli, BmaI3 produced two minor products, 3OHC6-HSL and 3OHC10-HSL, in addition to 3OHC8-HSL. However, we did not detect any 3OHC6-HSL or 3OHC10-HSL in extracts of B. mallei cultures with the P. fluorescens bioassay (Fig. 1A), which is quite sensitive to concentrations of 3OHC6-HSL (16). All of the data taken together indicate that although recombinant E. coli expressing BmaI3 makes 3OHC6-HSL, this molecule is not likely to be a signal for the BmaR3-I3 system.

We now have a deeper understanding of acyl-HSL signal generators and receptors in B. mallei. The two acyl-HSL synthases BmaI1 and BmaI3 produce as signals C8-HSL and 3OHC8-HSL, respectively, and the LuxR homologs BmaR1 and BmaR3 respond to the acyl-HSLs produced by their synthase partners (5). With this baseline of information, we are now in a position to systematically identify the genes regulated by BmaR1-I1 and BmaR3-I3. The identification of quorum-sensing regulated genes will reveal information concerning the role of quorum sensing during B. mallei pathogenesis.

Acknowledgments

This work was funded by an NIAID award from the Northwest Regional Center of Excellence for Biodefense and Emerging Infectious Diseases (U54AI057141) to E.P.G. and in part by NIH RO1-AI48660 to M.E.A.C. and the Lipid Maps Large Scale Collaborative Grant to R. C. Murphy (NIH GM069338). B.A.D. was supported in part by the National Institute of General Medical Sciences (NSRA T32 GM07270).

We thank Steve Farrand for the gift of P. fluorescens 1855.

The opinions, interpretations, conclusions, and recommendations within this paper are those of the authors and are not necessarily reflected by the U.S. Army.

Footnotes

▿

Published ahead of print on 16 May 2008.

REFERENCES

  • 1.Antunes, L. C., A. L. Schaefer, R. B. Ferreira, N. Qin, A. M. Stevens, E. G. Ruby, and E. P. Greenberg. 2007. Transcriptome analysis of the Vibrio fischeri LuxR-LuxI regulon. J. Bacteriol. 1898387-8391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Brint, J. M., and D. E. Ohman. 1995. Synthesis of multiple exoproducts in Pseudomonas aeruginosa is under the control of RhlR-RhlI, another set of regulators in strain PAO1 with homology to the autoinducer-responsive LuxR-LuxI family. J. Bacteriol. 1777155-7163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Callahan, S. M., and P. V. Dunlap. 2000. LuxR- and acyl-homoserine-lactone-controlled non-lux genes define a quorum-sensing regulon in Vibrio fischeri. J. Bacteriol. 1822811-2822. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Devine, J. H., G. S. Shadel, and T. O. Baldwin. 1989. Identification of the operator of the lux regulon from the Vibrio fischeri strain ATCC7744. Proc. Natl. Acad. Sci. USA 865688-5692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Duerkop, B. A., R. L. Ulrich, and E. P. Greenberg. 2007. Octanoyl-homoserine lactone is the cognate signal for Burkholderia mallei BmaR1-BmaI1 quorum sensing. J. Bacteriol. 1895034-5040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Eberhard, A. 1972. Inhibition and activation of bacterial luciferase synthesis. J. Bacteriol. 1091101-1105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Engebrecht, J., and M. Silverman. 1984. Identification of genes and gene products necessary for bacterial bioluminescence. Proc. Natl. Acad. Sci. USA 814154-4158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Fuqua, C., and E. P. Greenberg. 2002. Listening in on bacteria: acyl-homoserine lactone signalling. Nat. Rev. Mol. Cell Biol. 3685-695. [DOI] [PubMed] [Google Scholar]
  • 9.Fuqua, C., M. R. Parsek, and E. P. Greenberg. 2001. Regulation of gene expression by cell-to-cell communication: acyl-homoserine lactone quorum sensing. Annu. Rev. Genet. 35439-468. [DOI] [PubMed] [Google Scholar]
  • 10.Fuqua, C., S. C. Winans, and E. P. Greenberg. 1996. Census and consensus in bacterial ecosystems: the LuxR-LuxI family of quorum-sensing transcriptional regulators. Annu. Rev. Microbiol. 50727-751. [DOI] [PubMed] [Google Scholar]
  • 11.Gould, T. A., J. Herman, J. Krank, R. C. Murphy, and M. E. Churchill. 2006. Specificity of acyl-homoserine lactone synthases examined by mass spectrometry. J. Bacteriol. 188773-783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gray, K. M., L. Passador, B. H. Iglewski, and E. P. Greenberg. 1994. Interchangeability and specificity of components from the quorum-sensing regulatory systems of Vibrio fischeri and Pseudomonas aeruginosa. J. Bacteriol. 1763076-3080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Guzman, L. M., D. Belin, M. J. Carson, and J. Beckwith. 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 1774121-4130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hardman, A. M., G. S. Stewart, and P. Williams. 1998. Quorum sensing and the cell-cell communication dependent regulation of gene expression in pathogenic and non-pathogenic bacteria. Antonie van Leeuwenhoek 74199-210. [DOI] [PubMed] [Google Scholar]
  • 15.Khan, S. R., J. Herman, J. Krank, N. J. Serkova, M. E. Churchill, H. Suga, and S. K. Farrand. 2007. N-(3-hydroxyhexanoyl)-l-homoserine lactone is the biologically relevant quormone that regulates the phz operon of Pseudomonas chlororaphis strain 30-84. Appl. Environ. Microbiol. 737443-7455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Khan, S. R., D. V. Mavrodi, G. J. Jog, H. Suga, L. S. Thomashow, and S. K. Farrand. 2005. Activation of the phz operon of Pseudomonas fluorescens 2-79 requires the LuxR homolog PhzR, N-(3-OH-hexanoyl)-l-homoserine lactone produced by the LuxI homolog PhzI, and a cis-acting phz box. J. Bacteriol. 1876517-6527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lee, J. H., Y. Lequette, and E. P. Greenberg. 2006. Activity of purified QscR, a Pseudomonas aeruginosa orphan quorum-sensing transcription factor. Mol. Microbiol. 59602-609. [DOI] [PubMed] [Google Scholar]
  • 18.Lewenza, S., and P. A. Sokol. 2001. Regulation of ornibactin biosynthesis and N-acyl-l-homoserine lactone production by CepR in Burkholderia cepacia. J. Bacteriol. 1832212-2218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lumjiaktase, P., S. P. Diggle, S. Loprasert, S. Tungpradabkul, M. Daykin, M. Camara, P. Williams, and M. Kunakorn. 2006. Quorum sensing regulates dpsA and the oxidative stress response in Burkholderia pseudomallei. Microbiology 1523651-3659. [DOI] [PubMed] [Google Scholar]
  • 20.Miller, W. R., L. Pannell, L. Cravitz, W. A. Tanner, and T. Rosebury. 1948. Studies on certain biological characteristics of Malleomyces mallei and Malleomyces pseudomallei. II. Virulence and infectivity for animals. J. Bacteriol. 55127-135. [PMC free article] [PubMed] [Google Scholar]
  • 21.Nealson, K. H., T. Platt, and C. Hastings. 1970. Cellular control of the synthesis and activity of the bacterial luminescent system. J. Bacteriol. 104313-322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Newman, J. R., and C. Fuqua. 1999. Broad-host-range expression vectors that carry the L-arabinose-inducible Escherichia coli araBAD promoter and the araC regulator. Gene 227197-203. [DOI] [PubMed] [Google Scholar]
  • 23.Nierman, W. C., D. DeShazer, H. S. Kim, H. Tettelin, K. E. Nelson, T. Feldblyum, R. L. Ulrich, C. M. Ronning, L. M. Brinkac, S. C. Daugherty, T. D. Davidsen, R. T. Deboy, G. Dimitrov, R. J. Dodson, A. S. Durkin, M. L. Gwinn, D. H. Haft, H. Khouri, J. F. Kolonay, R. Madupu, Y. Mohammoud, W. C. Nelson, D. Radune, C. M. Romero, S. Sarria, J. Selengut, C. Shamblin, S. A. Sullivan, O. White, Y. Yu, N. Zafar, L. Zhou, and C. M. Fraser. 2004. Structural flexibility in the Burkholderia mallei genome. Proc. Natl. Acad. Sci. USA 10114246-14251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Schaefer, A. L., E. P. Greenberg, and M. R. Parsek. 2001. Acylated homoserine lactone detection in Pseudomonas aeruginosa biofilms by radiolabel assay. Methods Enzymol. 33641-47. [DOI] [PubMed] [Google Scholar]
  • 25.Seed, P. C., L. Passador, and B. H. Iglewski. 1995. Activation of the Pseudomonas aeruginosa lasI gene by LasR and the Pseudomonas autoinducer PAI: an autoinduction regulatory hierarchy. J. Bacteriol. 177654-659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Song, Y., C. Xie, Y. M. Ong, Y. H. Gan, and K. L. Chua. 2005. The BpsIR quorum-sensing system of Burkholderia pseudomallei. J. Bacteriol. 187785-790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ulrich, R. L., D. Deshazer, H. B. Hines, and J. A. Jeddeloh. 2004. Quorum sensing: a transcriptional regulatory system involved in the pathogenicity of Burkholderia mallei. Infect. Immun. 726589-6596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Waag, D., and D. DeShazer. 2005. Glanders: new insights into an old disease, p. 209-237. In L. E. Lindler, F. J. Lebeda, and G. W. Korch (ed.), Biological weapons defense: infectious diseases and counterbioterrorism. Humana Press, Totowa, NJ.
  • 29.Whitehead, N. A., A. M. Barnard, H. Slater, N. J. Simpson, and G. P. Salmond. 2001. Quorum-sensing in Gram-negative bacteria. FEMS Microbiol. Rev. 25365-404. [DOI] [PubMed] [Google Scholar]
  • 30.Whitlock, G. C., D. M. Estes, and A. G. Torres. 2007. Glanders: off to the races with Burkholderia mallei. FEMS Microbiol. Lett. 277115-122. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES