Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2008 Nov 15.
Published in final edited form as: Gene. 2007 Aug 19;403(1-2):60–69. doi: 10.1016/j.gene.2007.08.003

genome-wide analysis and expression profiling of the small heat shock proteins in zebrafish

kimberly s elicker 1, lara d hutson 1,*
PMCID: PMC2474744  NIHMSID: NIHMS32662  PMID: 17888590

Abstract

Small Heat Shock Proteins (sHSPs) have important roles in preventing disease and promoting resistance to environmental stressors. Mutations in any one of a number of sHSPs, including HSP27 (HSPB1), HSP22 (HSPB8), αA-crystallin (HSPB4), or αB-crystallin (HSPB5) can result in neuronal degeneration, myopathy, and/or cataract in humans. Ten sHSPs are known in humans, and thirteen have been identified in teleost fish. Here we report the identification of thirteen zebrafish sHSPs. Using a combination of phylogenetic analysis and analysis of synteny, we have determined that ten are likely orthologs of human sHSPs. We have used quantitative RT-PCR to determine the relative expression levels of all thirteen sHSPs during development and in response to heat shock. Our findings indicate that most of the zebrafish sHSPs are expressed during development, and five of these genes are transcriptionally upregulated by heat shock at one or more stages of development.

Keywords: sHSP, α-crystallin, synteny, real time PCR, development

1. Introduction

Many Heat Shock Proteins (HSPs) are molecular chaperones that bind to and prevent aggregation of proteins. Small HSPs (sHSPs) are low-molecular weight HSPs that are present in nearly every species (Narberhaus, 2002). They range in size from 12-43kD and are characterized by a single conserved domain of approximately 80 residues known as the α-crystallin domain. While the functions of sHSPs presumably have their evolutionary roots in chaperoning proteins, many have additional functions. For example, HspB1 (Hsp27) regulates actin filament dynamics, its precise role depending on its phosphorylation state (reviewed by Liang and MacRae, 1997; Mounier and Arrigo, 2002). Mutations in several members of the sHSP family cause degenerative diseases: axonal Charcot-Marie Tooth Disease (CMT) or Distal Hereditary Motor Neuropathy (dHMN) in the cases of HSPB1 (Evgrafov et al., 2004; Kijima et al., 2005; Tang et al., 2005a) and HSPB8 (Irobi et al., 2004; Tang et al., 2005b), and desmin-related myopathy in the case of HSPB5 (Vicart et al., 1998). In addition, mutations in HSPB4 (Litt et al., 1998) or HSPB5 (Berry et al., 2001) result in cataract formation.

While the evolution of the sHSP gene family has been described in some detail (Kappe et al., 2002; Narberhaus, 2002; Kappe et al., 2003; Franck et al., 2004), regulation of expression has been less well characterized. The tissue distributions of individual sHSPs has been analyzed somewhat systematically in adults of various species (e.g. (Bhat and Nagineni, 1989; Dubin et al., 1989; Gastmann et al., 1993; Lee et al., 1993; Iwaki et al., 1997; Plumier et al., 1997; Posner et al., 1999; Dean and Tytell, 2001; Kappe et al., 2001; Runkle et al., 2002), and while some studies have examined expression during organismal development (e.g. (Ali et al., 1993; Gernold et al., 1993; Tam and Heikkila, 1995; Lang et al., 1999; Loones et al., 2000; Armstrong et al., 2001; Tallot et al., 2003; Verschuure et al., 2003; Hawkes et al., 2004; Monastirli et al., 2005; Mao and Shelden, 2006; Tuttle et al., 2006), the majority of these have focussed on HspB1. A systematic characterization of the expression of the entire gene family in a single species is needed in order to better assess the relative importance of each of the family members during development and in response to stress.

The zebrafish (Danio rerio) is an ideal model vertebrate in which to analyze gene expression and function, in particular during developmental stages due to its external development, small size, transparency, and tractability to genetic manipulation. We are using zebrafish to perform a systematic characterization of the entire sHSP family during development. While humans have ten sHSPs (Fontaine et al., 2003; Kappe et al., 2003), it has recently been suggested that the common ancestor to tetrapods and teleosts had as many as fifteen (Franck et al., 2004). We have identified thirteen sHSPs in the zebrafish, ten of which are likely orthologs of human sHSPs, and each of which corresponds to one of the thirteen teleost sHSPs recently described (Franck et al., 2004). We have also used quantitative real time RT-PCR to perform a comprehensive characterization of the normal and heat shock-induced expression of all thirteen zebrafish sHSP genes during embryonic and larval development. Our results demonstrate that, though their expression levels differ widely, most of the zebrafish sHSPs are expressed during embryonic and/or larval development, and, in contrast to results from previous studies in other species, five are upregulated by heat shock.

2. Methods

2.1. Sequence, phylogenetic, and genomic analysis

We used one representative of each vertebrate sHSP or a consensus sequence derived from all vertebrate sHSPs to query Genbank using BlastX (http://ncbi.nlm.nih.gov/Blast). The finished and unfinished genome databases were searched using the provided Blast algorithm (http://Sanger.co.uk). ESTs for new sHSPs were obtained (hspb2 and hspb3 from Jinrong Peng of the Institute of Molecular and Cell Biology, Singapore; hspb6, hspb9, and hspb11 from Open Biosystems; and hspb7, hspb8, and hspb15 from the American Type Culture Collection) and sequenced completely in both directions. GenBank accession numbers for newly-identified or newly-completed zebrafish sHSPs are: hspb2 (EF583628), hspb3 (EF583629), hspb6 (EF614998), hspb7 (BC083373), hspb8 (BC057441), hspb9 (EF583630), hspb11 (EF583631), hspb12 (partial cds; EF636699), and hspb15 (EF583632). Confirmed sequences were conceptually translated in all six frames to find longest open reading frame.

Alignments of crystallin domains were performed using ClustalX 1.81 (Thompson et al., 1997). Pairwise and multiple alignment penalties for gap opening were 10.0, 0.10 for gap extension, and Gonnet 250 for protein weight matrix. Phylogenetic trees were created using Neighbor-Joining and Bayesian posterior probability algorithms using ClustalX or Mr. Bayes 2.1 (Huelsenbeck et al., 2000), respectively. Neighbor-Joining trees were bootstrapped 100 times. For Bayesian analysis, two simultaneous chains were run for 100,000 generations using Metropolis-coupled Markov chain Monte Carlo sampling. Trees were sampled every 100 generations and a burn-in value of 250 was used. All trees were rooted based on the results of a complete analysis performed using Saccharomyces cerevisiae HSP26 as an outgroup.

Determination of gene locations and structures, and syntenic analysis were based on the UC Santa Cruz assembly (http://genome.ucsc.edu/) based on version Zv6 of the zebrafish genome (The Wellcome Trust Sanger Institute).

2.2. Fish care

Fish were maintained and bred using standard procedures and in accordance with Williams College animal welfare assurance certificate A3133-01. Embryos were staged according to Kimmel et al. (1995) as equivalent hours post-fertilization (hpf) at 28.5°C

2.3. Real time RT-PCR

Embryos were raised at 28.5°C until the 16-cell stage, 12hpf, 24hpf, and 48hpf, or 5 days post-fertilization (dpf). For all stages except the 16-cell stage, clutches were divided into two equal groups, with half being heat shocked at 37°C for one hour followed by recovery for one hour. This heat shock paradigm has been shown to induce heat shock proteins without some of the problematic effects of higher-temperature heat shock (Krone et al., 1997). Heat shock prior to blastula stages is extremely damaging to embryos; we therefore did not heat shock 16-cell stage embryos. Heat shocked and non-heat shocked embryos were homogenized in Trizol, total RNA was purified using the RNeasy mini-kit (Qiagen) protocol, and cDNA was synthesized from total RNA using Superscript III (Invitrogen) Reverse Transcriptase and random hexamer primers. Primers were designed using Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3.cgi) and purchased from Sigma-Genosys (The Woodlands, TX, USA). Primer sequences and their annealing temperatures are listed:

gene forward reverse Tann (°C)
hspb1 ATGAACACGGCTTCATTTCC GCGGAGCTTCAACAGTTAG 56.3
hspb2 GCATGGCTTTGTGAGTCGTA AGTTCTTCGTGGAGCCTGAA 57.3
hspb3 TTTCCCACTGGATTTCAAGC CAGGGCAAAGAGTCGATGT 56.3
hspb4 ATGGCCTGCTCACTCTTTGT CCCACTCACACCTCCATACC 56.3
hspb5a CCCAGGCTTCTTCCCTTATC GTGCTTCACATCCAGGTTGA 60.7
hspb5b CCTACTGACGGCCAAATGTT GGCATCAGCAGCAGACAAA 60.7
hspb6 GGATCCCAAATGGAGTCAC TTGTCTGTGTCAGAGGTGCG 56.3
hspb7 TAAATGCCGGCTACCAGAG TGTGCATGCTCCAGTTTAGC 57.3
hspb8 ACCGACCAAAGTGAGAGGG GCATTTACGGAGCTCTGAGG 57.3
hspb9 TGGACGACCCTTTCTTTGAG GCATTATTTGGGCTCTACGG 55.0
hspb11 AGAGCTCGCCGTTAAACAG AATAGGATCCCTTCCCATCG 56.3
hspb12 ACCCACAAGTCTGTGCTTCC CGTCGTTCACACACAGGTTC 55.0
hspb15 ACAAGCTTCCGGCTGACTTA GTTCATCCGTTTTTGCAGGT 56.3
EF-1α CAGCTGATCGTTGGAGTCAA TGTATGCGCTGACTTCCTTG 56.3

The iCycler iQ Real Time Detection System (Bio-Rad) was used for PCR. For each primer pair, a temperature gradient was performed to determine optimal annealing temperature, and this temperature was used for analysis. Amplification efficiency for each primer pair was determined according to the protocol recommended by the iCycler manufacturer. For analysis, cDNA was diluted ten-fold in water and used for PCR. In addition to cDNA, all PCR reactions contained 0.5μM each forward and reverse primers and SybrGreen (Bio-Rad) reaction mix. Melting curves for each PCR product were performed automatically by the system. In one case where a primer pair failed to amplify single, specific product, new primers were designed and specificity was verified for the new pair. Following PCR, Ct values were determined automatically by the software. Expression levels were based on analysis of cDNA from each of two or three independent RNA samples, each of which were run in triplicate. Gene expression levels, normalized to EF-1α (a standard internal control), were estimated using the equation: F = (1+ε)ˆ(-ΔCt) where ΔCt = Ct(EF-1α) − Ct(sHSP) and is ε efficiency for genes whose amplification efficiencies were within 1.0% of that of EF-1α. For those genes whose amplification efficiencies were greater than 1.0% different from that of EF-1α, values were corrected to reflect these differences. Relative expression values were converted to and displayed as light intensity values on a scale from 0 to 255.

3. Results

3.1. the sHSP gene family in zebrafish

Seven zebrafish sHSPs, hspb1, hspb2, hspb3, hspb4, hspb5a, hspb5b, and hspb12 have been previously identified (Posner et al., 1999; Franck et al., 2004; Thisse and Thisse, 2004; Mao et al., 2005; Smith et al., 2006). Through searching all available expressed gene and genomic sequence databases, we have identified six additional zebrafish sHSPs (Table 1). From the aligned crystallin domains (Fig. 1), we constructed phylogenetic trees using either Neighbor-Joining or Bayesian posterior probability algorithms to determine the evolutionary relationships of the sHSPs. While the trees derived using these algorithms were not precisely identical, they differed in only minor details (Fig. 2).

Table 1.

Summary of sHSP genes in zebrafish and human

Gene Zebrafish Human

Gene Other names Chromosome:locationa Exonsb Map position Exonsb

hspb1 Hsp27 16:40148126-40154368 3 7q11.23 3
hspb2 MKBP 5:64297779-64313514 2 11q22-23 2
hspb3 5:53445179-53445937 1 5q11.2 1
hspb4 aA-crystallin, CRYAA 1:41386888-41390243 3 or 4c 21q22.3 3 or 4d
hspb5a aB-crystallin, CRYABA 15:12257017-12261795 3 11q22.3-q23.1 3
hspb5b aB-crystallin, CRYABB 5:64319420-64323810 3 see above 3
hspb6(13)e* Hsp20, HspB13 15:49659903-49661283 3 19q13.12 3
hspb7* cvHsp 23:26600535-26605689 3 1p36.23-p34.3 2-4f
hspb8* Hsp22, E2IG1, H11 5:10081155-10100866 3 12q24.23 3
hspb9(14)e* HspB14 3:40596891-40597575 1 or 2g 17q21.2 1
hspb10 ODF1 not found 8q22.3 2
hspb11* Hsp30 21:17886029-17886771 1 NA NA
hspb12 NAh 4 NA NA
hspb15* 5:30370587-30371692 3 NA NA
a

based on version Zv6 zebrafish genome assembly

b

based on mRNAs and ESTs mapped to genome within UC Santa Cruz genome assemblies

c

some splice variants include a 4th 3’UTR exon

d

some splice variants skip a 3’UTR exon

e

number in parenthesis refers to previous numerical designation (Franck et al, 2004)

f

a variety of splice forms contain between two and four exons, though most contain three

g

89% of mRNAs mapped to genome are unspliced

h

is not represented in most recent genome assembly

*

indicates newly-identified genes

Figure 1.

Figure 1

Alignment of vertebrate sHSP crystallin domains. Color shading indicates type of amino acid residue, where these residues are conserved across species’. Sequences from the following species were used as representatives of each class of vertebrates: Homo sapiens (Hs) for mammalian, Gallus gallus (Gg) for avian, and Xenopus laevis (Xl), Xenopus tropicalis (Xt), or Rana catesbiana (Rc) for amphibian. An exception was made for teleost fish, where, in addition to zebrafish Danio rerio (Dr), sequences for the Japanese pufferfish Takifugu rubripes (Fr) were included where possible. The X. laevis gene HSP30D gene was used to represent the amphibian HSPB11 family, and the G. gallus gene HSPB11a was used to represent the avian HSPB11 family. Height of gray bars below alignment represent the degree of conservation at each position. For HSPB6 and HSPB6, the number in parenthesis refers to previous gene name. Accession numbers for cDNA or protein sequences are provided (parenthesis).

aORF predicted from Fugu genome, fourth assembly (http://www.fugu-sg.org)

bfrom Franck et al. (2004)

Figure 2.

Figure 2

Phylogenetic trees of vertebrate sHSPs based on the alignment shown in Figure 1 and constructed using Neighbor-joining (A) or Bayesian posterior probability (B) algorithms. A. Root position (asterisk) was determined from phylogenetic tree using S. cerevisiae HSP26 as outgroup. Bootstrap values ≥87% are provided. B. Portion of Bayesian tree. Posterior probability values ≥0.89 are provided. Scales refer to the inferred number of sequence changes per site. Numbers in parenthesis refer to the prior names of these genes.

Of the six new zebrafish sHSPs, we found one each orthologous to the tetrapod genes HSPB7, and HSPB8; one to HSPB11 (HSP30), which appears to exist in all vertebrates except mammals; and one each corresponding to the apparently fish-specific genes hspb13, hspb14, and hspb15. The nearest human homologs to the latter three genes, as based on the topology of the phylogram in Figure 2, are HSPB6, HSPB9, and HSPB1, respectively. Assuming that fish do not have HSPB6 or HSPB9, this suggests that the common ancestor to teleosts and tetrapods had all four genes (HSPB6, HSPB13, HSPB9, and HSPB14), with HSPB6 and HSPB9 having been lost during the evolution of the teleost lineage, and HSPB13 and HSPB14 having been lost during the evolution of tetrapods. However, an alternative explanation, that each of these gene pairs derived from a common ancestor, but that the protein-coding sequences diverged quickly following the teleost-tetrapod split as a result of differences in selective pressure, is also plausible.

Because synteny between zebrafish and human genomes is relatively well conserved (Postlethwait et al., 2000; Woods et al., 2000), we were able to compare the syntenic relationships of every probable or possible orthologous pair in order to provide a more definitive assessment of orthology. All of the zebrafish sHSPs were represented in the most recent zebrafish genome assembly (version Zv6) except for hspb12. We found that synteny is reasonably strongly conserved between four zebrafish and human sHSP genes (two or more immediate gene neighbors in common), hspb1, hspb2, hspb5b, and hspb7 (Fig. 3A for hspb5b; data not shown for others). Conservation of synteny is less strong for hspb3, hspb4, hspb5a, and hspb8 (Fig. 3A for hspb5a; data not shown for others). For example, while zebrafish hspb5b and human HSPB5 share the same two immediate neighbors, zebrafish hspb5a and human HSPB5 share only one of two nearby neighbors. Of the six genes that map to within 100kbp of zebrafish hspb5a, however, five are within 6.7Mbp of HSPB5, supporting the argument for their orthology.

Figure 3.

Figure 3

Syntenic relationships between representative zebrafish sHSPs and their putative human orthologs. Zebrafish (Dre) data are shown in black. Human (Hsa) data are shown in violet. In instances where no zebrafish gene is known to exist at a particular location in the zebrafish genome, but where a putative ortholog to a human gene has been mapped, the human gene name is provided in violet. Unannotated zebrafish mRNAs and ESTs were subject to a Blast search, and given a provisional name of their nearest human homolog (E-value cutoff-20) followed by an ‘H’ (e.g. LOC388389H). mRNAs or ESTs with no significant matches to anything in Genbank are identified by accession number. A. Syntenic relationships between zebrafish hspb5a and hspb5b and human HSPB5. Approximately 200kbp of zebrafish Chromosomes 5 and 15, and 300kbp of human Chromosome 11, are shown. Human genes located outside the 300kbp interval, and their approximate distances from human HSPB5, are LOC120379 (160kbp), TMPRSS5 (1.8Mbp), ARCN1 (6.7Mbp), and PHLDB1 (6.7Mbp). B. Conserved synteny between zebrafish hspb6 and human HSPB6. Approximately 265kbp of zebrafish Chromosome 15, and 165kbp of human Chromosome 19, are shown. C. Syntenic relationship between zebrafish hspb9 and human HSPB9. Approximately 200kbp of zebrafish Chromosome 3, and 180kbp of human Chromosome 17, are shown. Human genes that map outside this region and their approximate distances from human HSPB9 are: RPL23 (3.3Mbp), MPP2 (1.8Mbp), and LOC388389 (2.8Mbp). Dashed lines in B and C indicate homologous genes not previously identified as orthologs.

The closest human homolog to zebrafish hspb13 is human HSPB6. We found that a 265kbp region spanning zebrafish hspb13 has four to five genes in common with the chromosomal region spanning human HSPB6, suggesting a common ancestry for these genes (Fig. 3B). This level of conservation is even stronger than it is for several accepted orthologous pairs; therefore, the zebrafish hspb13 gene is most likely an HSPB6 ortholog. Zebrafish hspb14 and human HSPB9 show a similar pattern. While they lack common neighbors within 100kbp (of zebrafish hspb14) and 90kbp (of human HSPB9), three genes that map to within 100kbp of the zebrafish hspb14 are within 3.3Mbp of human HSPB9 on Chromosome 17 (Fig. 3C). Zebrafish hspb14 and human HSPB9 share another similarity; unlike the majority of sHSPs, both zebrafish hspb14 and human HSPB9 are most frequently found unspliced (see Table 1). These results suggest that zebrafish hspb14 is likely to be the fish ortholog of human HSPB9. Based on these data, we will henceforth refer to this gene as hspb9. By way of comparison, zebrafish hspb15 shows no evidence for orthology with human HSPB1, its closest human homolog; they do not have a single neighbor in common within 250kbp of either gene, and none of the human genes that map to this interval in zebrafish are located on the same human chromosome as the human HSPB1 gene. Although we cannot absolutely rule out the possibility that this pair is orthologous, there is currently insufficient evidence to support it.

3.2. expression of sHSPs – normal development and upregulation by heat shock

We used quantitative real time RT-PCR to determine the approximate relative expression levels of all thirteen sHSPs during development and in response to heat shock (Fig. 4 and Table 2). Based on our results, hspb1 appears to be expressed at higher levels than the other sHSPs throughout embryonic development, although hspb8 is also expressed at quite high levels. With the exception of hspb3, hspb5a, and hspb15, all of the remaining sHSP genes appear to expressed during normal development, albeit at much lower levels than either hspb1 or hspb8. As we controlled for PCR efficiency in determining expression levels, these data are at least roughly comparable from gene to gene. However, the high degree of variability in the PCR limits our ability to define expression levels with absolute certainty.

Figure 4.

Figure 4

Expression of zebrafish sHSPs during development and in response to heat shock. At left is shown relative expression levels during normal development. Because of the huge range in expression levels between hspb1 and the remainder of the sHSPs, each value was multiplied by 105 and the natural log of this number was converted to greyscale intensity values, where white corresponds to the maximum observed expression level (that of hspb1 at 12hpf). At right is heat shock-induced expression as fraction of normal. White in this case corresponds to 50-fold or greater upregulation (see Table 2 for actual values). Values are displayed on a linear scale.

Table 2.

Relative expression of zebrafish sHSPs during embryonic and larval developmenta

16-cell 12 hpf 24 hpf 48 hpf 5 dpf

gene normal normal HS b fold
diff. c
normal HS fold
diff.
normal HS fold
diff.
normal HS fold
diff.

hspb1 497 ± 150 9242 ± 3351 34470 ± 3558 3.7 * 1586 ± 252 21250 ± 1792 13.9* 625 ± 227 20470 ± 1412 51.2* 332 ± 15.3 29880 ± 1031 90.5*
hspb2 1.4 ± 0.6 0.1 ± 0.0 0.2 ± 0.1 1.9 15.7 ± 11.0 7.3 ± 3.5 0.5 17.8 ± 7.0 20.0 ± 10.6 1.1 22.2 ± 10.6 16.8 ± 8.0 0.8
hspb3 0.0 ± 0.0 0.2 ± 0.1 0.3 ± 0.1 2.0 2.9 ± 2.2 1.4 ± 0.7 0.5 2.2 ± 1.1 2.1 ± 0.9 1.0 2.2 ± 0.4 3.0 ± 0.7 1.4
hspb4 1.0 ± 0.6 1.1 ± 0.6 18.4 ± 10.2 17.3 8.6 ± 3.6 44.5 ± 23.4 5.2 212 ± 155 304 ± 158 1.4 618 ± 225 1115 ± 77.0 1.8
hspb5a 0.8 ± 0.9 0.7 ± 0.7 0.7 ± 0.6 1.1 0.1 ± 0.1 0.3 ± 0.3 2.1 0.3 ± 0.3 0.0 ± 0.0 0.0 0.6 ± 0.3 0.4 ± 0.1 0.7
hspb5b 0.1 ± 0.1 2.9 ± 1.0 7.3 ± 4.7 2.5 2.6 ± 1.7 4.4 ± 3.3 1.7 12.4 ± 10.8 2.2 ± 1.3 0.2 18.0 ± 1.9 22.1 ± 2.3 1.2
hspb6 7.3 ± 2.0 3.6 ± 1.3 7.6 ± 2.3 2.1 34.5 ± 0.0 44.2 ± 2.3 1.3 263.3 ± 54.0 76.7 ± 2.7 0.3 353 ± 95.5 1532 ± 263 4.3
hspb7 0.2 ± 0.2 2.9 ± 0.1 3.7 ± 0.0 1.3 26.0 ± 25.3 43.2 ± 46.5 1.7 46.5 ± 14.1 30.3 ± 7.2 0.7 33.9 ± 5.8 16.1 ± 0.6 0.5
hspb8 2.2 ± 1.9 295 ± 78 1583 ± 585 5.4 4542 ± 3705 8036 ± 4229 1.8 602 ± 245 5188 ± 3239 8.6 513 ± 122 4782 ± 659 9.3*
hspb9 63.3 ± 35.1 7.1 ± 1.7 12.6 ± 3.8 1.8 253 ± 17.5 843 ± 255 3.3 324 ± 215 1182 ± 0.0 3.6 90.8 ± 18.6 2290 ± 237 25.2*
hspb11 1.3 ± 1.0 5.5 ± 2.0 16.7 ± 4.5 3.0 65.0 ± 9.0 868 ± 316 13.3 142 ± 57.3 552 ± 0.0 4.8* 74.2 ± 5.1 2368 ± 0.0 31.9*
hspb12 5.3 ± 0.4 3.1 ± 0.9 7.3 ± 3.3 2.4 190 ± 19.7 119 ± 39.7 0.6 33.9 ± 5.8 32.3 ± 2.2 1.0 39.8 ± 2.8 84.5 ± 20.1 2.1
hspb15 3.0 ± 0.5 1.2 ± 0.5 1.6 ± 0.7 1.3 4.3 ± 0.0 11.6 ± 1.2 2.7 12.4 ± 6.9 4.4 ± 2.2 0.4 17.5 ± 10.9 23.4 ± 0.8 1.3
a

based on results of real time PCR, fraction of EF-1α expression (x105); values are reported ± standard error of the mean

b

expression following one-hour heat shock relative to EF-1α expression (x105)

c

fold difference; ratio of HS-induced expression to unstressed expression

*

p<0.05, Student’s t-test

In response to a one-hour heat shock at 37°C, we found the expression of several sHSPs, hspb1, hspb4, hspb8, hspb9, and hspb11, to be upregulated more than five-fold at one or more stages of development: (Fig. 4B and Table 3). While the extent of upregulation of hspb4 was not statistically significant, the magnitude of upregulation (17.3-fold at 12hpf and 5.2-fold at 24hpf) suggests that these differences are real. hspb1 showed the greatest maximal degree of upregulation (90.5x normal levels at 5dpf). In general, the heat shock-responsiveness of the sHSPs appears to increase with age with the notable exception of hspb4.

Table 3.

Summary of zebrafish sHSP ESTs*

graphic file with name nihms32662t3.jpg
a

embryos and adults

b

adults only

c

shield stage embryos, 26-somite stage embryos, and adult liver

d

does not include retina

e

posterior segment; includes lens, retinal pigment epithelium, and skin

*

shading indicates most abundant source(s) of each gene

Because it would be nearly impossible to exhaustively describe the expression of all thirteen sHSPs, we have inventoried all zebrafish sHSP ESTs currently in Genbank to provide a more global view of the expression of these genes during development and in the adult (Table 3). Interestingly, hspb1 is found at highest levels in myoblast libraries, consistent with its reported expression in developing somites (Thisse et al., 2001; Mao and Shelden, 2006). Not surprisingly, the lens α-crystallins, hspb4, hspb5a, and hspb5b are found predominantly in lens libraries. Three sHSPs, hspb6, hspb7, and hspb11, are primarily found in adult heart libraries. This finding is not surprising in the case of hspb7, which was originally identified as a protein expressed highly and selectively in human heart (Krief et al., 1999). On the other hand, it is a bit surprising that hspb6, which is relatively broadly expressed in other species (Verschuure et al., 2003), appears to be more or less restricted to heart in zebrafish. To our knowledge, expression of hspb11 has not yet been characterized in adults of any species. Finally, hspb8 is relatively abundant in a broad spectrum of embryonic and adult libraries, consistent with expression data from other systems (Kappe et al., 2001; Verschuure et al., 2003), while hspb2, hspb3, hspb9, hspb12, and hspb15 are not particularly abundant in any library represented in Genbank.

4. Discussion

4.1. evolution of the sHSP gene family

sHSPs comprise a diverse and rapidly-evolving family of proteins. Duplication and subsequent expansion of sHSP genes seems to have occurred frequently throughout evolution. For example, the nematode Caenorhabditis briggsae has as many as ten sHSPs that are in the same clade as the vertebrate HSPB9 and HSPB11 genes (Hong et al., 2004) and data not shown), and Xenopus laevis has as many as seven HSPB11 genes (Krone et al., 1992). Some sHSPs have also apparently been lost during evolution. For example, HSPB12, which has been found in chicken and fish, seems to have been lost in mammals (Franck et al., 2004). Could this diversity have contributed to species evolution? By way of analogy, it has been proposed that duplication of the ancestral genome may account for the diversity of teleosts (Postlethwait et al., 2000; Venkatesh, 2003; Volff, 2005). Indeed, the complement of sHSPs present in an organism is likely to confer specific selective advantages to individuals in specific situations and could therefore have contributed to speciation.

While humans are thought to have ten sHSPs, zebrafish (and other teleosts examined to date) have thirteen. Here we are able to show that the fish gene previously referred to as hspb13 is in fact orthologous to human HSPB6, and fish hspb14 is, in all likelihood, orthologous to human HSPB9. The only remaining mammalian sHSP for which no fish ortholog has been found is therefore HSPB10. The two identified fish genes that are most similar to human HSPB10 are hspb9 and hspb11. However, there is no evidence from our analysis to suggest that either of these genes is an HSPB10 ortholog. Because HSPB10 in mammals is a sperm-specific protein, and sperm is likely to be underrepresented in zebrafish EST sequencing projects, it may be that fish hspb10 has simply yet to be found. Alternatively, hspb10 may have been lost during fish evolution due to different constraints on sperm evolution, or it may have diverged to such an extent that it is no longer recognizable.

It is rather interesting, in light of estimates that approximately one quarter of all human genes has a pair of orthologs in teleost fish (Postlethwait et al., 2000; Woods et al., 2005), that only HSPB5 has paired orthologs in the zebrafish. In order to determine whether we overlooked the second of some duplicated pairs, we attempted to examine the syntenic relationships between each of the remaining zebrafish genes, hspb12 and hspb15, and their nearest mammalian counterparts, HSPB7 and HSPB1. Unfortunately, hspb12 is not yet represented in the finished zebrafish genome, so we were not able to resolve this relationship. Regardless, the presence of HSPB12 in the chicken strongly suggests that it did not arise as a result of the teleost genome duplication, and thus is not a second ortholog of HSPB7. In the case of hspb15, there is currently no evidence to support its being a second HSPB1 ortholog. However, as the zebrafish genome is not one hundred percent complete, we cannot unequivocally rule out the possibility.

4.2. expression of zebrafish sHSPs

As stated previously, this is the first study to systematically characterize the expression of the entire sHSP gene family in a single species. Our results show that many of the sHSPs are expressed at appreciable levels during embryonic and larval development. Of these, we found hspb1 to be expressed at the highest levels, reaching maximal expression around 12hpf, similar to previous findings (Mao et al., 2005). Five of the thirteen sHSPs, hspb1, hspb4, hspb8, hspb9, and hspb11, were found to be upregulated by heat shock. These results are largely consistent with results in other systems, where hspb11 was reported to upregulated by heat shock in Xenopus (Ali et al., 1993; Heikkila, 2003), and HSPB1, HSPB5 (Mounier and Arrigo, 2002) and HSPB8 (Chowdary et al., 2004) have been reported to be upregulated by heat shock in some mammalian systems. However, this is the first report of hspb4 being upregulated by heat shock in any system, although Hawse et al. (Hawse et al., 2003) found that HSPB4 was upregulated specifically by Cu2+ in culture human lens epithelial cells. This apparent discrepancy may be explained by the fact that, in our hands, hspb4 was upregulated during only a fairly narrow window of development, a window that could have been easily missed by other studies. Indeed, it has been reported that the heat shock-responsiveness of genes can change throughout the life of the organism (Davis and King, 1989; Heikkila, 2004). We also found hspb9 to be upregulated by heat shock which had not been reported in other systems. This discrepancy could again be accounted for by differences between developmental and adult stages. An alternative explanation is that real time PCR is more senstive at detecting small differences in expression than traditional methods. Regardless of the explanation, the results of these studies provide an important foundation for both further analysis of the evolution and regulation of sHSPs, as well as efforts to determine whether the effects of sHSP mutations in humans may be related to defects arising during development.

Acknowledgments

We extend our deepest gratitude to Dr. Lois Banta for use of the real time PCR system. We would also like to thank Dr. David C. Smith for discussions about evolution, and Drs. Wilfried de Jong and Jason Wilder for comments on the manuscript. This work was supported by NIH R03EY015207 to LDH and an Essel Foundation Grant to the Neuroscience Program at Williams College.

abbreviations

sHSP

small heat shock protein

HSP

heat shock protein

CMT

Charcot-Marie Tooth Disease

dHMN

Distal Hereditary Motor Neuropathy

EF-1α

elongation factor-1α

hpf

hours post-fertilization

dpf

days post-fertilization

μM

micromolar

kD

kilodaltons

RT-PCR

reverse transcription polymerase chain reaction

Ct

threshold cycle

EST

expressed sequence tag

kbp

kilobase pairs

Mbp

megabase pairs

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Ali A, Krone PH, Heikkila JJ. Expression of endogenous and microinjected hsp 30 genes in early Xenopus laevis embryos. Dev Genet. 1993;14:42–50. doi: 10.1002/dvg.1020140106. [DOI] [PubMed] [Google Scholar]
  2. Armstrong CL, Krueger-Naug AM, Currie RW, Hawkes R. Constitutive expression of heat shock protein HSP25 in the central nervous system of the developing and adult mouse. J Comp Neurol. 2001;434:262–274. doi: 10.1002/cne.1176. [DOI] [PubMed] [Google Scholar]
  3. Berry V, Francis P, Reddy MA, Collyer D, Vithana E, MacKay I, Dawson G, Carey AH, Moore A, Bhattacharya SS, Quinlan RA. Alpha-B crystallin gene (CRYAB) mutation causes dominant congenital posterior polar cataract in humans. Am J Hum Genet. 2001;69:1141–1145. doi: 10.1086/324158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bhat SP, Nagineni CN. alpha B subunit of lens-specific protein alpha-crystallin is present in other ocular and non-ocular tissues. Biochem Biophys Res Commun. 1989;158:319–325. doi: 10.1016/s0006-291x(89)80215-3. [DOI] [PubMed] [Google Scholar]
  5. Chowdary TK, Raman B, Ramakrishna T, Rao CM. Mammalian Hsp22 is a heat-inducible small heat-shock protein with chaperone-like activity. Biochem J. 2004;381:379–387. doi: 10.1042/BJ20031958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Davis RE, King ML. The developmental expression of the heat-shock response in Xenopus laevis. Development. 1989;105:213–222. doi: 10.1242/dev.105.2.213. [DOI] [PubMed] [Google Scholar]
  7. Dean DO, Tytell M. Hsp25 and-90 immunoreactivity in the normal rat eye. Invest Ophthalmol Vis Sci. 2001;42:3031–3040. [PubMed] [Google Scholar]
  8. Dubin RA, Wawrousek EF, Piatigorsky J. Expression of the murine alpha B-crystallin gene is not restricted to the lens. Mol Cell Biol. 1989;9:1083–1091. doi: 10.1128/mcb.9.3.1083-1091.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Evgrafov OV, et al. Mutant small heat-shock protein 27 causes axonal Charcot-Marie-Tooth disease and distal hereditary motor neuropathy. Nat Genet. 2004;36:602–606. doi: 10.1038/ng1354. [DOI] [PubMed] [Google Scholar]
  10. Fontaine JM, Rest JS, Welsh MJ, Benndorf R. The sperm outer dense fiber protein is the 10th member of the superfamily of mammalian small stress proteins. Cell Stress Chaperones. 2003;8:62–69. doi: 10.1379/1466-1268(2003)8<62:tsodfp>2.0.co;2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Franck E, Madsen O, van Rheede T, Ricard G, Huynen MA, de Jong WW. Evolutionary diversity of vertebrate small heat shock proteins. J Mol Evol. 2004;59:792–805. doi: 10.1007/s00239-004-0013-z. [DOI] [PubMed] [Google Scholar]
  12. Gastmann O, Burfeind P, Gunther E, Hameister H, Szpirer C, Hoyer-Fender S. Sequence, expression, and chromosomal assignment of a human sperm outer dense fiber gene. Mol Reprod Dev. 1993;36:407–418. doi: 10.1002/mrd.1080360402. [DOI] [PubMed] [Google Scholar]
  13. Gernold M, Knauf U, Gaestel M, Stahl J, Kloetzel PM. Development and tissue-specific distribution of mouse small heat shock protein hsp25. Dev Genet. 1993;14:103–111. doi: 10.1002/dvg.1020140204. [DOI] [PubMed] [Google Scholar]
  14. Hawkes EL, Krueger-Naug AM, Nickerson PE, Myers TL, Currie RW, Clarke DB. Expression of Hsp27 in retinal ganglion cells of the rat during postnatal development. J Comp Neurol. 2004;478:143–148. doi: 10.1002/cne.20266. [DOI] [PubMed] [Google Scholar]
  15. Hawse JR, Cumming JR, Oppermann B, Sheets NL, Reddy VN, Kantorow M. Activation of metallothioneins and alpha-crystallin/sHSPs in human lens epithelial cells by specific metals and the metal content of aging clear human lenses. Invest Ophthalmol Vis Sci. 2003;44:672–679. doi: 10.1167/iovs.02-0018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Heikkila JJ. Expression and function of small heat shock protein genes during Xenopus development. Semin Cell Dev Biol. 2003;14:259–266. doi: 10.1016/j.semcdb.2003.09.022. [DOI] [PubMed] [Google Scholar]
  17. Heikkila JJ. Regulation and function of small heat shock protein genes during amphibian development. J Cell Biochem. 2004;93:672–680. doi: 10.1002/jcb.20237. [DOI] [PubMed] [Google Scholar]
  18. Hong M, Kwon JY, Shim J, Lee J. Differential hypoxia response of hsp-16 genes in the nematode. J Mol Biol. 2004;344:369–381. doi: 10.1016/j.jmb.2004.09.077. [DOI] [PubMed] [Google Scholar]
  19. Huelsenbeck JP, Rannala B, Larget B. A Bayesian framework for the analysis of cospeciation. Evolution Int J Org Evolution. 2000;54:352–364. doi: 10.1111/j.0014-3820.2000.tb00039.x. [DOI] [PubMed] [Google Scholar]
  20. Irobi J, et al. Hot-spot residue in small heat-shock protein 22 causes distal motor neuropathy. Nat Genet. 2004;36:597–601. doi: 10.1038/ng1328. [DOI] [PubMed] [Google Scholar]
  21. Iwaki A, Nagano T, Nakagawa M, Iwaki T, Fukumaki Y. Identification and characterization of the gene encoding a new member of the alpha-crystallin/small hsp family, closely linked to the alphaB-crystallin gene in a head-to-head manner. Genomics. 1997;45:386–394. doi: 10.1006/geno.1997.4956. [DOI] [PubMed] [Google Scholar]
  22. Kappe G, Franck E, Verschuure P, Boelens WC, Leunissen JA, de Jong WW. The human genome encodes 10 alpha-crystallin-related small heat shock proteins: HspB1-10. Cell Stress Chaperones. 2003;8:53–61. doi: 10.1379/1466-1268(2003)8<53:thgecs>2.0.co;2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kappe G, Leunissen JA, de Jong WW. Evolution and diversity of prokaryotic small heat shock proteins. Prog Mol Subcell Biol. 2002;28:1–17. doi: 10.1007/978-3-642-56348-5_1. [DOI] [PubMed] [Google Scholar]
  24. Kappe G, Verschuure P, Philipsen RL, Staalduinen AA, Van de Boogaart P, Boelens WC, De Jong WW. Characterization of two novel human small heat shock proteins: protein kinase-related HspB8 and testis-specific HspB9. Biochim Biophys Acta. 2001;1520:1–6. doi: 10.1016/s0167-4781(01)00237-8. [DOI] [PubMed] [Google Scholar]
  25. Kijima K, Numakura C, Goto T, Takahashi T, Otagiri T, Umetsu K, Hayasaka K. Small heat shock protein 27 mutation in a Japanese patient with distal hereditary motor neuropathy. J Hum Genet. 2005;50:473–476. doi: 10.1007/s10038-005-0280-6. [DOI] [PubMed] [Google Scholar]
  26. Krief S, Faivre JF, Robert P, Le Douarin B, Brument-Larignon N, Lefrere I, Bouzyk MM, Anderson KM, Greller LD, Tobin FL, Souchet M, Bril A. Identification and characterization of cvHsp. A novel human small stress protein selectively expressed in cardiovascular and insulin-sensitive tissues. J Biol Chem. 1999;274:36592–36600. doi: 10.1074/jbc.274.51.36592. [DOI] [PubMed] [Google Scholar]
  27. Krone PH, Sass JB, Lele Z. Heat shock protein gene expression during embryonic development of the zebrafish. Cell Mol Life Sci. 1997;53:122–129. doi: 10.1007/PL00000574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Krone PH, Snow A, Ali A, Pasternak JJ, Heikkila JJ. Comparison of regulatory and structural regions of the Xenopus laevis small heat-shock protein-encoding gene family. Gene. 1992;110:159–166. doi: 10.1016/0378-1119(92)90643-4. [DOI] [PubMed] [Google Scholar]
  29. Lang L, Miskovic D, Fernando P, Heikkila JJ. Spatial pattern of constitutive and heat shock-induced expression of the small heat shock protein gene family, Hsp30, in Xenopus laevis tailbud embryos. Dev Genet. 1999;25:365–374. doi: 10.1002/(SICI)1520-6408(1999)25:4<365::AID-DVG10>3.0.CO;2-2. [DOI] [PubMed] [Google Scholar]
  30. Lee DC, Kim RY, Wistow GJ. An avian alpha B-crystallin. Non-lens expression and sequence similarities with both small (HSP27) and large (HSP70) heat shock proteins. J Mol Biol. 1993;232:1221–1226. doi: 10.1006/jmbi.1993.1476. [DOI] [PubMed] [Google Scholar]
  31. Liang P, MacRae TH. Molecular chaperones and the cytoskeleton. J Cell Sci. 1997;110(Pt 13):1431–1440. doi: 10.1242/jcs.110.13.1431. [DOI] [PubMed] [Google Scholar]
  32. Litt M, Kramer P, LaMorticella DM, Murphey W, Lovrien EW, Weleber RG. Autosomal dominant congenital cataract associated with a missense mutation in the human alpha crystallin gene CRYAA. Hum Mol Genet. 1998;7:471–474. doi: 10.1093/hmg/7.3.471. [DOI] [PubMed] [Google Scholar]
  33. Loones MT, Chang Y, Morange M. The distribution of heat shock proteins in the nervous system of the unstressed mouse embryo suggests a role in neuronal and non-neuronal differentiation. Cell Stress Chaperones. 2000;5:291–305. doi: 10.1379/1466-1268(2000)005<0291:tdohsp>2.0.co;2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mao L, Bryantsev AL, Chechenova MB, Shelden EA. Cloning, characterization, and heat stress-induced redistribution of a protein homologous to human hsp27 in the zebrafish Danio rerio. Exp Cell Res. 2005;306:230–241. doi: 10.1016/j.yexcr.2005.02.007. [DOI] [PubMed] [Google Scholar]
  35. Mao L, Shelden EA. Developmentally regulated gene expression of the small heat shock protein Hsp27 in zebrafish embryos. Gene Expr Patterns. 2006;6:127–133. doi: 10.1016/j.modgep.2005.07.002. [DOI] [PubMed] [Google Scholar]
  36. Monastirli A, Vourekas A, Badavanis G, Pasmatzi E, Sagriotis A, Drainas D, Pavlidou D, Georgiou S, Sakkis T, Mantagos S, Kourounis G, Varakis J, Stamatiou G, Tsambaos D. Hsp27 expression coincides with epidermal stratification during human epidermal morphogenesis. Acta Derm Venereol. 2005;85:389–393. doi: 10.1080/00015550510032869. [DOI] [PubMed] [Google Scholar]
  37. Mounier N, Arrigo AP. Actin cytoskeleton and small heat shock proteins: how do they interact? Cell Stress Chaperones. 2002;7:167–176. doi: 10.1379/1466-1268(2002)007<0167:acashs>2.0.co;2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Narberhaus F. Alpha-crystallin-type heat shock proteins: socializing minichaperones in the context of a multichaperone network. Microbiol Mol Biol Rev. 2002;66:64–93. doi: 10.1128/MMBR.66.1.64-93.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Plumier JC, Hopkins DA, Robertson HA, Currie RW. Constitutive expression of the 27-kDa heat shock protein (Hsp27) in sensory and motor neurons of the rat nervous system. J Comp Neurol. 1997;384:409–428. [PubMed] [Google Scholar]
  40. Posner M, Kantorow M, Horwitz J. Cloning, sequencing and differential expression of alphaB-crystallin in the zebrafish, Danio rerio. Biochim Biophys Acta. 1999;1447:271–277. doi: 10.1016/s0167-4781(99)00155-4. [DOI] [PubMed] [Google Scholar]
  41. Postlethwait JH, Woods IG, Ngo-Hazelett P, Yan YL, Kelly PD, Chu F, Huang H, Hill-Force A, Talbot WS. Zebrafish comparative genomics and the origins of vertebrate chromosomes. Genome Res. 2000;10:1890–1902. doi: 10.1101/gr.164800. [DOI] [PubMed] [Google Scholar]
  42. Runkle S, Hill J, Kantorow M, Horwitz J, Posner M. Sequence and spatial expression of zebrafish (Danio rerio) alphaA-crystallin. Mol Vis. 2002;8:45–50. [PMC free article] [PubMed] [Google Scholar]
  43. Smith AA, Wyatt K, Vacha J, Vihtelic TS, Zigler JS, Jr, Wistow GJ, Posner M. Gene duplication and separation of functions in alphaB-crystallin from zebrafish (Danio rerio) Febs J. 2006;273:481–490. doi: 10.1111/j.1742-4658.2005.05080.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Tallot P, Grongnet JF, David JC. Dual perinatal and developmental expression of the small heat shock proteins alphaB-crystallin and Hsp27 in different tissues of the developing piglet. Biol Neonate. 2003;83:281–288. doi: 10.1159/000069488. [DOI] [PubMed] [Google Scholar]
  45. Tam Y, Heikkila JJ. Identification of members of the HSP30 small heat shock protein family and characterization of their developmental regulation in heat-shocked Xenopus laevis embryos. Dev Genet. 1995;17:331–339. doi: 10.1002/dvg.1020170406. [DOI] [PubMed] [Google Scholar]
  46. Tang B, Liu X, Zhao G, Luo W, Xia K, Pan Q, Cai F, Hu Z, Zhang C, Chen B, Zhang F, Shen L, Zhang R, Jiang H. Mutation analysis of the small heat shock protein 27 gene in Chinese patients with Charcot-Marie-Tooth disease. Arch Neurol. 2005a;62:1201–1207. doi: 10.1001/archneur.62.8.1201. [DOI] [PubMed] [Google Scholar]
  47. Tang BS, et al. Small heat-shock protein 22 mutated in autosomal dominant Charcot-Marie-Tooth disease type 2L. Hum Genet. 2005b;116:222–224. doi: 10.1007/s00439-004-1218-3. [DOI] [PubMed] [Google Scholar]
  48. Thisse B, Pflumio S, Fürthauer M, Loppin B, Heyer V, Degrave A, Woehl R, Lux A, Steffan T, Charbonnier XQ, Thisse C. Expression of the zebrafish genome during embryogenesis (NIH R01 RR15402) ZFIN Direct Data Submission 2001 [Google Scholar]
  49. Thisse B, Thisse C. Fast Release Clones: A High Throughput Expression Analysis. ZFIN Direct Data Submission 2004 [Google Scholar]
  50. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–4882. doi: 10.1093/nar/25.24.4876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Tuttle AM, Gauley J, Chan N, Heikkila JJ. Analysis of the expression and function of the small heat shock protein gene, hsp27, in Xenopus laevis embryos. Comp Biochem Physiol A Mol Integr Physiol. 2006;147:112–121. doi: 10.1016/j.cbpa.2006.12.003. [DOI] [PubMed] [Google Scholar]
  52. Venkatesh B. Evolution and diversity of fish genomes. Curr Opin Genet Dev. 2003;13:588–592. doi: 10.1016/j.gde.2003.09.001. [DOI] [PubMed] [Google Scholar]
  53. Verschuure P, Tatard C, Boelens WC, Grongnet JF, David JC. Expression of small heat shock proteins HspB2, HspB8, Hsp20 and cvHsp in different tissues of the perinatal developing pig. Eur J Cell Biol. 2003;82:523–530. doi: 10.1078/0171-9335-00337. [DOI] [PubMed] [Google Scholar]
  54. Vicart P, Caron A, Guicheney P, Li Z, Prevost MC, Faure A, Chateau D, Chapon F, Tome F, Dupret JM, Paulin D, Fardeau M. A missense mutation in the alphaB-crystallin chaperone gene causes a desmin-related myopathy. Nat Genet. 1998;20:92–95. doi: 10.1038/1765. [DOI] [PubMed] [Google Scholar]
  55. Volff JN. Genome evolution and biodiversity in teleost fish. Heredity. 2005;94:280–294. doi: 10.1038/sj.hdy.6800635. [DOI] [PubMed] [Google Scholar]
  56. Woods IG, Kelly PD, Chu F, Ngo-Hazelett P, Yan YL, Huang H, Postlethwait JH, Talbot WS. A comparative map of the zebrafish genome. Genome Res. 2000;10:1903–1914. doi: 10.1101/gr.10.12.1903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Woods IG, Wilson C, Friedlander B, Chang P, Reyes DK, Nix R, Kelly PD, Chu F, Postlethwait JH, Talbot WS. The zebrafish gene map defines ancestral vertebrate chromosomes. Genome Res. 2005;15:1307–1314. doi: 10.1101/gr.4134305. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES