Skip to main content
Journal of Virology logoLink to Journal of Virology
. 1990 Oct;64(10):5029–5035. doi: 10.1128/jvi.64.10.5029-5035.1990

Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

M Merchlinsky 1
PMCID: PMC247994  PMID: 2398534

Abstract

In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera.

Full text

PDF
5029

Images in this article

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Baroudy B. M., Venkatesan S., Moss B. Incompletely base-paired flip-flop terminal loops link the two DNA strands of the vaccinia virus genome into one uninterrupted polynucleotide chain. Cell. 1982 Feb;28(2):315–324. doi: 10.1016/0092-8674(82)90349-x. [DOI] [PubMed] [Google Scholar]
  2. Baroudy B. M., Venkatesan S., Moss B. Structure and replication of vaccinia virus telomeres. Cold Spring Harb Symp Quant Biol. 1983;47(Pt 2):723–729. doi: 10.1101/sqb.1983.047.01.083. [DOI] [PubMed] [Google Scholar]
  3. Burkhoff A. M., Tullius T. D. The unusual conformation adopted by the adenine tracts in kinetoplast DNA. Cell. 1987 Mar 27;48(6):935–943. doi: 10.1016/0092-8674(87)90702-1. [DOI] [PubMed] [Google Scholar]
  4. Campbell J. I., Binns M. M., Tomley F. M., Boursnell M. E. Tandem repeated sequences within the terminal region of the fowlpox virus genome. J Gen Virol. 1989 Jan;70(Pt 1):145–154. doi: 10.1099/0022-1317-70-1-145. [DOI] [PubMed] [Google Scholar]
  5. Craig N. L. The mechanism of conservative site-specific recombination. Annu Rev Genet. 1988;22:77–105. doi: 10.1146/annurev.ge.22.120188.000453. [DOI] [PubMed] [Google Scholar]
  6. Davison A. J., Moss B. Structure of vaccinia virus late promoters. J Mol Biol. 1989 Dec 20;210(4):771–784. doi: 10.1016/0022-2836(89)90108-3. [DOI] [PubMed] [Google Scholar]
  7. DeLange A. M. Identification of temperature-sensitive mutants of vaccinia virus that are defective in conversion of concatemeric replicative intermediates to the mature linear DNA genome. J Virol. 1989 Jun;63(6):2437–2444. doi: 10.1128/jvi.63.6.2437-2444.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. DeLange A. M., McFadden G. Efficient resolution of replicated poxvirus telomeres to native hairpin structures requires two inverted symmetrical copies of a core target DNA sequence. J Virol. 1987 Jun;61(6):1957–1963. doi: 10.1128/jvi.61.6.1957-1963.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. DeLange A. M., McFadden G. Sequence-nonspecific replication of transfected plasmid DNA in poxvirus-infected cells. Proc Natl Acad Sci U S A. 1986 Feb;83(3):614–618. doi: 10.1073/pnas.83.3.614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. DeLange A. M., Reddy M., Scraba D., Upton C., McFadden G. Replication and resolution of cloned poxvirus telomeres in vivo generates linear minichromosomes with intact viral hairpin termini. J Virol. 1986 Aug;59(2):249–259. doi: 10.1128/jvi.59.2.249-259.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Garon C. F., Barbosa E., Moss B. Visualization of an inverted terminal repetition in vaccinia virus DNA. Proc Natl Acad Sci U S A. 1978 Oct;75(10):4863–4867. doi: 10.1073/pnas.75.10.4863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gershon P. D., Black D. N. A capripoxvirus pseudogene whose only intact homologs are in other poxvirus genomes. Virology. 1989 Sep;172(1):350–354. doi: 10.1016/0042-6822(89)90138-4. [DOI] [PubMed] [Google Scholar]
  13. González A., Talavera A., Almendral J. M., Viñuela E. Hairpin loop structure of African swine fever virus DNA. Nucleic Acids Res. 1986 Sep 11;14(17):6835–6844. doi: 10.1093/nar/14.17.6835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Goodman S. D., Nash H. A. Functional replacement of a protein-induced bend in a DNA recombination site. Nature. 1989 Sep 21;341(6239):251–254. doi: 10.1038/341251a0. [DOI] [PubMed] [Google Scholar]
  15. Graham F. L., Smiley J., Russell W. C., Nairn R. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol. 1977 Jul;36(1):59–74. doi: 10.1099/0022-1317-36-1-59. [DOI] [PubMed] [Google Scholar]
  16. Hattori M., Sakaki Y. Dideoxy sequencing method using denatured plasmid templates. Anal Biochem. 1986 Feb 1;152(2):232–238. doi: 10.1016/0003-2697(86)90403-3. [DOI] [PubMed] [Google Scholar]
  17. Merchlinsky M., Garon C. F., Moss B. Molecular cloning and sequence of the concatemer junction from vaccinia virus replicative DNA. Viral nuclease cleavage sites in cruciform structures. J Mol Biol. 1988 Feb 5;199(3):399–413. doi: 10.1016/0022-2836(88)90613-4. [DOI] [PubMed] [Google Scholar]
  18. Merchlinsky M. Intramolecular homologous recombination in cells infected with temperature-sensitive mutants of vaccinia virus. J Virol. 1989 May;63(5):2030–2035. doi: 10.1128/jvi.63.5.2030-2035.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Merchlinsky M., Moss B. Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA. J Virol. 1989 Oct;63(10):4354–4361. doi: 10.1128/jvi.63.10.4354-4361.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Merchlinsky M., Moss B. Resolution of linear minichromosomes with hairpin ends from circular plasmids containing vaccinia virus concatemer junctions. Cell. 1986 Jun 20;45(6):879–884. doi: 10.1016/0092-8674(86)90562-3. [DOI] [PubMed] [Google Scholar]
  21. Merchlinsky M., Moss B. Resolution of vaccinia virus DNA concatemer junctions requires late-gene expression. J Virol. 1989 Apr;63(4):1595–1603. doi: 10.1128/jvi.63.4.1595-1603.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Merchlinsky M. Resolution of poxvirus telomeres: processing of vaccinia virus concatemer junctions by conservative strand exchange. J Virol. 1990 Jul;64(7):3437–3446. doi: 10.1128/jvi.64.7.3437-3446.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Moyer R. W., Graves R. L. The mechanism of cytoplasmic orthopoxvirus DNA replication. Cell. 1981 Dec;27(2 Pt 1):391–401. doi: 10.1016/0092-8674(81)90422-0. [DOI] [PubMed] [Google Scholar]
  24. Parsons B. L., Pickup D. J. Tandemly repeated sequences are present at the ends of the DNA of raccoonpox virus. Virology. 1987 Nov;161(1):45–53. doi: 10.1016/0042-6822(87)90169-3. [DOI] [PubMed] [Google Scholar]
  25. Parsons B. L., Pickup D. J. Transcription of orthopoxvirus telomeres at late times during infection. Virology. 1990 Mar;175(1):69–80. doi: 10.1016/0042-6822(90)90187-v. [DOI] [PubMed] [Google Scholar]
  26. Pickup D. J., Bastia D., Stone H. O., Joklik W. K. Sequence of terminal regions of cowpox virus DNA: arrangement of repeated and unique sequence elements. Proc Natl Acad Sci U S A. 1982 Dec;79(23):7112–7116. doi: 10.1073/pnas.79.23.7112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Senecoff J. F., Cox M. M. Directionality in FLP protein-promoted site-specific recombination is mediated by DNA-DNA pairing. J Biol Chem. 1986 Jun 5;261(16):7380–7386. [PubMed] [Google Scholar]
  28. Snyder U. K., Thompson J. F., Landy A. Phasing of protein-induced DNA bends in a recombination complex. Nature. 1989 Sep 21;341(6239):255–257. doi: 10.1038/341255a0. [DOI] [PubMed] [Google Scholar]
  29. Wittek R., Menna A., Müller H. K., Schümperli D., Boseley P. G., Wyler R. Inverted terminal repeats in rabbit poxvirus and vaccinia virus DNA. J Virol. 1978 Oct;28(1):171–181. doi: 10.1128/jvi.28.1.171-181.1978. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES