Skip to main content
PMC home page
Endocrinology logoLink to Endocrinology
. 2008 May 1;149(8):4128–4136. doi: 10.1210/en.2008-0123

Inhibition of Brain Prostaglandin Endoperoxide Synthase-2 Prevents the Preparturient Increase in Fetal Adrenocorticotropin Secretion in the Sheep Fetus

Jason Gersting 1, Christine E Schaub 1, Maureen Keller-Wood 1, Charles E Wood 1
PMCID: PMC2488234  PMID: 18450957

Abstract

Maturation of the fetal hypothalamus-pituitary-adrenal axis is critical for the timely somatic development of the fetus and readiness for birth. Recently, we proposed that prostaglandin generation within the fetal central nervous system is critical for the modulation of hypotension-induced fetal ACTH secretion. The present study was designed to test the hypothesis that the preparturient increase in fetal ACTH secretion is dependent upon fetal central nervous system prostaglandin synthesis mediated by the activity of prostaglandin endoperoxide synthase (PGHS)-2 (cyclooxygenase-2) in the fetal brain. We performed two studies in chronically catheterized fetal sheep. In the first study, we infused nimesulide or vehicle intracerebroventricularly (icv) into singleton fetal sheep and collected blood samples until spontaneous parturition. Nimesulide significantly delayed parturition, and inhibited fetal ACTH and proopiomelanocortin secretion but did not prevent the preparturient increase in fetal plasma cortisol concentration. In the second study, we used twin fetuses. One fetus received intracerebroventricular nimesulide and the other intracerebroventricular vehicle. Nimesulide reduced brain tissue concentrations of prostaglandin estradiol, while not affecting plasma prostaglandin E2 concentrations, demonstrating an action restricted to the fetal brain. Nimesulide reduced PGHS-2 mRNA and increased PGHS-2 protein, while not altering PGHS-1 mRNA or protein in most brain regions, suggesting an effect of the inhibitor on PGHS-2 turnover and relative specificity for PGHS-2 in vivo. We conclude that the preparturient increase in fetal ACTH and proopiomelanocortin is dependent upon the activity of PGHS-2 in the fetal brain. However, we also conclude that the timing of parturition is not solely dependent upon ACTH in this species.

MATURATION OF THE fetal hypothalamus-pituitary-adrenal (HPA) axis is critical for the timely somatic development of the fetus and readiness for birth (1). In sheep and in other species, there is an increase in fetal HPA axis activity at or near the end of gestation that is important for fetal lung and gastrointestinal tract maturation, and for modulation of fetal growth and metabolism. Indeed, in the sheep, preparturient increases in the activity of the fetal HPA axis trigger parturition (2,3). Ingestion of Veratrum californicum by the pregnant ewe produces developmental anomalies in the development of the fetal brain and hypothalamus, and prolongs gestation (4). Liggins et al. (5,6) demonstrated that electrocoagulation of the pituitary in the fetal sheep prolonged gestation. Conversely, infusion of ACTH or glucocorticoid shortened gestation (7,8). Bilateral destruction of the paraventricular nuclei in fetal sheep also prolonged gestation, indicating that disruption of function within this endocrine axis interrupts a key step in the chain of events that leads to parturition in this species (9,10). Although the control of the preparturient increase in ACTH is clearly dependent upon paraventricular nuclei activity, the neurotransmission and neuromodulation controlling the axis are not well understood.

Recently, we proposed that prostaglandin generation within the fetal central nervous system is critical for the modulation of hypotension-induced fetal ACTH secretion (11,12). Although the stimulation of fetal HPA axis in response to hypotension is modulated by prostaglandins, little is known about the dependency of ontogenetic preparturient increases in fetal HPA axis activity.

The present study was designed to test the hypothesis that the preparturient increase in fetal ACTH secretion is dependent upon fetal central nervous system prostaglandin synthesis mediated by the activity of prostaglandin endoperoxide synthase (PGHS)-2 [cyclooxygenase (COX)-2] in the fetal brain. We hypothesized that inhibition of PGHS-2 in the fetal brain would block the increase in fetal ACTH and cortisol secretion, and prolong gestation. The present study was designed to test this hypothesis.

Materials and Methods

These experiments were approved by the University of Florida Institutional Animal Care and Use Committee. In the first experiment, 15 pregnant ewes with singleton fetuses were studied. In the second, five time-dated pregnant ewes with twins were studied.

Fetal surgery

In studies 1 and 2, we used time-dated pregnant ewes carrying singleton and twin fetuses, respectively. Surgery was performed at least 5 d before in vivo study. In study 1, fetal gestational ages at surgery were 121–129 d in the control group and 123–134 d in the nimesulide-treated group. In study 2, fetuses were 119- to 125-d gestation at surgery. Ewes were fasted for 24 h before surgery. Each ewe was anesthetized with halothane (0.5–2.5%) in oxygen. The uterus was exposed via a midline incision, and one set of fetal hindlimbs was located. Through a small hysterotomy incision, a fetal hindlimb was delivered. The tibial artery was located and catheterized using a polyvinylchloride catheter (0.030-in. inner diameter, 0.050-in. outer diameter), with the catheter tip advanced to the subdiaphragmatic aorta. The procedure was repeated in the second hindlimb, to which an amniotic fluid catheter was sutured before returning to the amniotic space. The fetal head was located and delivered through a second uterine incision. A hysterotomy incision was made over the crown of the fetal head. After making a midline incision in the fetal scalp, the fetal skin was marsupialized with the uterus. A small hole was made in the skull 1-cm lateral to bregma; an 18-gauge hypodermic needle was used as a probe for identifying the depth of the lateral cerebral ventricle. A polyvinylchloride catheter (0.030-in. inner diameter, 0.050-in. outer diameter) was cut to a length equal to the depth of the lateral cerebral ventricle relative to the surface of the skull, and attached to an osmotic mini pump (2ML4 in study 1 and 2ML2 in study 2; ALZET Osmotic Pumps, DURECT Corp., Cupertino, CA) filled with either nimesulide or vehicle, then implanted sc in the neck. Incisions in the fetal skin and uterus were sutured. The surgery for study 2 was the same as for study 1, with the exception that the catheterization procedures were repeated in the twin fetus. After closure of the uterine incisions, fetal arterial and amniotic catheters were routed to the flank of the ewe and held in place with a disposable pocket and elastic bandage. Maternal incisions were closed in layers. During the postoperative period, fetal catheters and maternal flank incisions were cleaned daily with povidone solution, ewes were treated twice daily with ampicillin (Polyflex; Fort Dodge Laboratories, Fort Dodge, WI), and rectal temperatures of the ewes were measured. Use of this surgical procedure and postoperative treatment protocol is routine in our laboratory (13,14).

Drug administration

Nimesulide was purchased from Cayman Chemical (Ann Arbor, MI). Each drug was stored at −20 C as a stock solution of 50 mg/ml in dimethylsulfoxide. Nimesulide was infused at a rate of 1 mg/d intracerebroventricularly (icv) in a 50%/50% mixture of water/dimethylsulfoxide vehicle. This dose was chosen based on the efficacy of acute iv administration of nimesulide in prior experiments (15). In experiments involving twins, one twin received a minipump containing nimesulide, and the other twin received a minipump containing vehicle alone.

Experimental protocol and sample collection

In study 1, starting 5 d after surgery, arterial blood samples (5 ml) were collected at 2-d intervals, anticoagulated in chilled K4-EDTA blood collection tubes (Vacutainer Systems; Becton Dickinson, Franklin Lakes, NJ), and kept on ice until centrifuged. In addition, 1 ml arterial blood was collected into a heparinized syringe and stored on ice for blood gas analysis. Blood samples were centrifuged at 3000 × g for 20 min at 4 C. Plasma was aliquotted and stored at −20 C until analysis for plasma hormone concentrations. PaO2, PaCO2, and pHa were measured using an ABL 77 blood gas analyzer (Radiometer, Copenhagen, Denmark). Blood sampling continued at this frequency until spontaneous parturition.

In study 2, starting 5 d after surgery, arterial blood samples (6 ml) and arterial blood gas samples (1 ml) were collected on a daily basis from each fetus and processed as in study 1. Data from the daily blood samples are not reported. On the final day of the experiment in study 2, a single blood gas sample and five serial arterial blood samples (at 5 min intervals) were collected (4 ml) from each fetus as described previously. Data from these samples are reported as the mean of values measured in the five samples. After the final blood collection, the ewes were euthanized with an overdose of sodium pentobarbital. The fetal brain was rapidly removed and dissected into the following regions: cerebral cortex, cerebellum, hippocampus, hypothalamus, brainstem, and pituitary. Tissue was placed into ribonuclease-free tubes and snap frozen in liquid nitrogen, then stored at −80 C until processed for mRNA and protein extraction.

RNA isolation and gene expression analysis

Before analysis each tissue was pulverized with a precooled Bio-Pulverizer, a trigger-style mortar and pestle (Bio-Spec Products, Bartlesville, OK). RNA extraction was performed using Trizol (Invitrogen Corp., Carlsbad, CA) according to the manufacturer’s recommendations. RNA was quantified by measuring absorbance at 260 nm and quality checked by running a denaturing agarose gel. Multiple aliquots of each sample were made and stored at −80 C.

For each sample, 2 μg total RNA was reverse transcribed using the High Capacity cDNA kit (Applied Biosystems, Foster City, CA), according to manufacturer’s instructions. Real-time PCR was performed as previously described (16). Sequences of probes and primers and the concentrations used are reported in Table 1. Relative expression levels were calculated using the ΔCt method (17). Fold-change expression was calculated by using 2−ΔΔCt.

Table 1.

Primer and probe sequences used in real-time PCR analysis of mRNA concentrations

Forward primer Reverse primer Probe
PGHS-1 GGCACCAACCTCATGTTTGC TCTTGCCGAAGTTTTGAAGA TTCTTTGCCCAACACTTCACCCATCA
PGHS-2 GCACAAATCTGATGTTTGCATTCT CTGGTCCTCGTTCATATCTGCTT TGCCCAGCACTTCACCCATCAATTTT
CRH TCCCATTTCCCTGGATCTCA GAGCTTGCTGCGCTAACTGA TTCCACCTCCTCCGAGAAGTCTTGGAAAT
AVP TTCCAGAACTGCCCAAGGG AGACACTGTCTCAGCTCCAGGTC SYBR
POMC CCGGCAACTGCGATGAG GGAAATGGCCCATGACGTACT AGCCGCTGACTGAGAACCCCCG
LH CCGCTCCCAGATATCCTCTTC GTCTGCTGGCTTTGGGAGTTA TCTAAGGATGCCCCACTTCAATCTCCCA
FSH CCCAACATCCAGAAAGCATGT GCACAGCCAGGCACTTTCA TTCAAGGAGCTGGTGTACGAGACG
PRL TGAGCTTGATTCTTGGGTTGCT CCCCGCACCTCTGTGACTA CTCCTGGAATGACCCTCTGTATCAC
Open in a new tab

Protein isolation and Western blotting

For protein analysis in cerebral cortex, hippocampus, and cerebellum, tissues were homogenized in boiling lysis buffer containing 1% sodium dodecyl sulfate, 1 mm sodium orthovanadate, and 10 mm Tris (pH 7.4) (Sigma Chemical Co., St. Louis, MO). Homogenates were boiled for 5 min then centrifuged at 7500 × g for 10 min at 4 C to remove particulate matter. The resulting supernatant was assayed for protein content using the Bio-Rad DC Protein Assay (Bio-Rad Laboratories, Inc., Hercules, CA) and stored at −80 C. For protein analysis in hypothalamus and brainstem, PGHS-1 and -2 protein was concentrated by preparation of microsomes. There was 0.15–0.2 g brain tissue homogenized in a Potter-Elvehjem glass/Teflon tissue grinder (Wheaton Science Products, Millville, NJ) with 5 ml ice-cold microsomal homogenization buffer [1 mm EDTA, 0.32 m sucrose, 0.1 mm dithiothreitol, 1 mm HEPES (pH 7.4)] using a motor drive (DynaMix; Fisher Scientific, Pittsburgh, PA) for 10–15 strokes set at moderate speed. Twenty microliters of 200 mm phenylmethylsulfonylfluoride were added, and homogenates were spun at 550 × g for 10 min at 4 C. The supernatant was transferred to a thick-walled polyallomer ultracentrifuge tube (Beckman Instruments, Palo Alto, CA) and spun at 10,000 × g for 20 min at 4 C. The resulting supernatant was transferred to a sterile ultracentrifuge tube and spun at 100,000 × g for 1 h at 4 C. The resulting microsomal pellet was resuspended in 125 μl ice-cold homogenization buffer. Protein concentrations were determined using the Bradford method (18).

Western blots were performed by loading 20 μg microsomal protein or whole cell homogenate in each lane of a 7.5% Tris-HCl polyacrylamide gel (Criterion Gel System; Bio-Rad Laboratories) in addition to a mass marker (Rainbow Molecular Mass Standard; Bio-Rad Laboratories), and a commercially available positive control for either ovine PGHS-1 or PGHS-2 (Oxford Biomedical, Oxford, MI). After transfer to nitrocellulose membrane, membranes were blocked for 1 h at room temperature with nonfat dry milk in Tris-buffered saline/1% Tween 20 at 2% for PGHS-1 and 3% for PGHS-2. Primary antibodies were diluted in the blocking buffer and incubated with the membrane for 1 h at room temperature. Polyclonal anti-PGHS-1 (1:2500, no. PG-16; Oxford Biomedical; PGHS-2) and monoclonal anti-PGHS-2 (1:1000, no. 160112; Cayman Chemical) were used to probe for PGHS-1 and -2, respectively. Peroxidase-conjugated secondary antibody was diluted in the blocking buffer and incubated with the membrane for 45 min at room temperature (PGHS-1: donkey antirabbit at 1:3000; PGHS-2: sheep antimouse at 1:3000, nos. NA934 and NA931, respectively; Amersham Biosciences Inc., Piscataway, NJ). Membranes were washed three times for 10 min in Tris-buffered saline/1% Tween 20 and developed using enhanced chemiluminescence reagent. Standard radiographic film was used to visualize the completed blot. Blots were analyzed using Quantity One software (Bio-Rad Laboratories). The results of the densitometry were expressed as relative OD units.

Hormone assays

Plasma concentrations of ACTH1–39, proopiomelanocortin (POMC), cortisol, prostaglandin E2 (PGE2), estradiol, and estradiol-3-sulfate were measured as previously described (19,20,21). Briefly, ACTH1–39 was measured using an immunoradiometric assay purchased from DiaSorin Inc. (catalog no.27130; Stillwater, MN), cortisol, estradiol, and estradiol-3-sulfate using enzyme immunoassay (EIA) kits from Oxford Biomedical (catalog nos. EA65 and EA70), POMC using an ELISA from IDS Corp. (catalog no. AC-71; Boldon, UK), and PGE2 using an EIA from Cayman Chemical (catalog no. 514010). The POMC assay measures both POMC and 22-kDa “proACTH.” For simplicity, we will refer to the results of this assay as “POMC.” Before assay, cortisol was extracted from plasma using ethanol, and PGE2 was extracted from plasma using ethyl acetate, as previously described (19,21). Brain tissue concentrations of PGE2 were measured using the Cayman EIA after extraction of the prostanoid from homogenized tissue using eight volumes of ethyl acetate.

Statistics

Plasma hormone concentrations in study 1 were analyzed by two-way ANOVA, corrected for repeated measures in one dimension, days before parturition (22). The effect of nimesulide on the length of gestation was assessed using the Mantel-Cox test for survival analysis (23). Abundance of mRNA and protein for PGHS-1 and -2 in study 2 were analyzed by two-way ANOVA for repeated measures in both dimensions (brain region and nimesulide vs. control). The effect of nimesulide in each brain region was tested using simple effects contrasts. Plasma hormone concentrations in study 2 were analyzed by the paired t test (24).

Results

Study 1: PGHS-2 and the ontogeny of the fetal HPA axis

In control (untreated) fetuses, fetal plasma concentrations of cortisol increased in late gestation, progressively increasing to peak levels in the last 1- to 2-d fetal life (Fig. 1, closed symbols). Fetal plasma concentrations of ACTH1–39 and POMC increased very late in gestation, increasing only within the last 1–2 d (Fig. 1). The increase in fetal HPA axis activity was followed by an increase in fetal plasma PGE2 concentrations before parturition (Fig. 1, bottom-right panel, closed symbols).

Figure 1.

Figure 1

Open in a new tab

Fetal plasma concentrations of ACTH (top-left panel), POMC (top-right panel), cortisol (bottom-left panel), and PGE2 (bottom-right panel). Fetuses were treated with vehicle (control, closed symbols) or nimesulide (open symbols) icv. Data are represented as mean values ± 1 sem.

Intracerebroventricular infusion of nimesulide blocked the spontaneous increase in fetal plasma ACTH1–39 and POMC (Fig. 1, open symbols). When analyzed by one-way ANOVA, the concentration of neither hormone was significantly related to the number of days before parturition. When analyzed by two-way ANOVA, there were statistically significant differences between groups for both ACTH1–39 (P < 0.01) and POMC (P < 0.001), and a significant group × time interaction for POMC (P < 0.05). The group x time interaction for ACTH1–39 was not significant (P = 0.16), although pairwise comparison using the Bonferroni test did reveal a statistically significant (P < 0.05) difference between values of ACTH1–39 in the last sample before parturition (57 ± 5 vs. 27 ± 6 pg/ml in control and nimesulide treatment groups, respectively).

Fetal plasma cortisol concentration did increase significantly (P < 0.001), and the pattern of fetal plasma cortisol in relation to parturition was not significantly different from that in the control group (P = 0.62 for interaction between group and days prepartum in two-way ANOVA).

Nimesulide prevented the preparturient increase in fetal plasma concentrations of PGE2. When analyzed by two-way ANOVA, there was a statistically significant group x time interaction (P = 0.001), and analysis by Bonferroni test reveals a statistically significant difference between values of PGE2 in the last blood sample before parturition (505 ± 140 and 1724 ± 172 pg/ml in control and nimesulide treatment groups, respectively).

Nimesulide treatment increased the length of gestation slightly but significantly (P = 0.007 by Mantel-Cox test; Fig. 2). Parturition occurred on d 147.9 ± 0.3 in the nimesulide-treated fetuses and d 146.3 ± 0.3 in the vehicle-treated fetuses.

Figure 2.

Figure 2

Open in a new tab

Analysis of progression to parturition in control (solid lines) and nimesulide (dashed lines) treated fetuses. There was a statistically significant difference in the day of spontaneous parturition between the two groups.

Study 2: effect of nimesulide blockade on fetal brain PGE2 concentrations and gene expression

We used twin fetuses to test the effect of 5-d treatment with nimesulide on regional brain concentrations of PGE2, gene and protein expression, and plasma hormone concentrations. Although PGHS-2 is involved in the biosynthesis of several prostanoids, the efficacy of enzyme blockade in the inhibition of prostanoid biosynthesis was tested by measurement of brain tissue concentrations of PGE2 (Fig. 3). Nimesulide significantly reduced the concentrations of PGE2 in brainstem, cerebral cortex, hippocampus, and cerebellum, the tissues that were available for this analysis (P < 0.05 for main effect of drug treatment as tested by two-way ANOVA). Consistent with the results of study 1, 5-d intracerebroventricular treatment with nimesulide did not significantly change plasma concentrations of ACTH, cortisol, POMC, or PGE2 (Table 2). Nimesulide significantly increased (P < 0.05 by paired t test) the plasma concentration of estradiol; however, it did not significantly change the plasma concentration of estradiol sulfate. mRNA abundances for hypothalamic CRH and arginine vasopressin (AVP) and for pituitary POMC, LH, FSH, and prolactin (PRL) were also unchanged by the nimesulide treatment (Table 3).

Figure 3.

Figure 3

Open in a new tab

Brain regional tissue concentrations of PGE2 in brainstem (top-left panel), cerebral cortex (top-right panel), hippocampus (bottom-left panel), and cerebellum (bottom-right panel). Fetuses were treated with vehicle (control, black bars) or nimesulide (gray bars) icv. Data are represented as mean values ± 1 sem. Statistically significant difference between control and nimesulide groups is represented with the asterisk (*).

Table 2.

Plasma hormone concentrations on last day of infusion

Analyte Untreated twin Treated twin
ACTH1–39 (pg/ml) 22 ± 1 23 ± 1
Cortisol (ng/ml) 2.6 ± 0.4 2.1 ± 0.3
POMC (pm) 6.6 ± 2.9 7.7 ± 3.4
PGE2 (pg/ml) 282 ± 53 253 ± 55
Estradiol (pg/ml) 12 ± 4 26 ± 7a
Estradiol sulfate (pg/ml) 622 ± 96 607 ± 74
Open in a new tab

Data are represented as mean ± sem. 

a

P < 0.05. 

Table 3.

mRNA abundances for pituitary and hypothalamic variables

Variable Untreated twin Treated twin
CRH (hypothalamus) 11.17 ± 1.17 10.66 ± 0.50
AVP (hypothalamus) 1.55 ± 1.55 3.63 ± 1.13
POMC (pituitary) 3.61 ± 0.50 4.45 ± 0.19
LH (pituitary) 8.98 ± 0.58 8.82 ± 0.35
FSH (pituitary) 10.24 ± 0.30 10.24 ± 0.19
PRL (pituitary) 6.12 ± 0.26 6.32 ± 0.50
Open in a new tab

Data are represented as values of ΔCt ± sem. 

Nimesulide significantly changed the abundance of PGHS-2 mRNA and protein (P < 0.05 in both analyses for main effect of drug treatment as tested by two-way ANOVA; Figs. 4 and 5, respectively). Analysis of individual groups revealed significant decreases in PGHS-2 mRNA in all brain regions and increases in pituitary (Fig. 4). These changes were accompanied by increases in PGHS-2 protein in brainstem, hippocampus, cerebellum, and hypothalamus, and a slight but significant decrease in PGHS-2 protein in cortex (Fig. 5). As shown in Figs. 4 and 5, respectively, there were no statistically significant effects of nimesulide on the expression of PGHS-1, either at the mRNA (P = 0.07 for main effect of nimesulide) or protein (P = 0.08 for nimesulide × region interaction) level.

Figure 4.

Figure 4

Open in a new tab

Brain regional tissue concentrations of PGHS-1 (left) and PGHS-2 (right) mRNA. Data are represented as mean values ± sem of fold difference from control fetuses within each region. Fetuses were treated with vehicle (control, black bars) or nimesulide (gray bars) icv. Statistically significant difference between control and nimesulide groups is represented with the asterisk (*).

Figure 5.

Figure 5

Open in a new tab

Brain regional tissue concentrations of PGHS-1 (left) and PGHS-2 (right) protein. Data are represented as mean values ± sem of arbitrary units of OD. Fetuses were treated with vehicle (control, black bars) or nimesulide (gray bars) icv. Statistically significant difference between control and nimesulide groups is represented with the asterisk (*).

Discussion

The results of this study demonstrate that the preparturient increase in fetal ACTH and POMC secretion is dependent upon PGHS-2 activity within the fetal brain, and that the preparturient increase in fetal plasma cortisol concentration is not dependent upon increases in fetal plasma ACTH concentration. Combined with previous studies from this laboratory, the present results demonstrate the fundamental importance of fetal brain prostaglandins in the control of fetal ACTH secretion. The demonstration that inhibition of PGHS-2 blocks the preparturient increase in fetal ACTH secretion in the present study complements our previous study demonstrating that the ACTH response to arterial hypotension is reduced by inhibition of prostaglandin biosynthesis (11,25). As revealed by decreased tissue concentrations of PGE2, the inhibition of prostaglandin biosynthesis was measurable throughout the brain, in regions known to express PGHS-2 (26,27).

There is a rich literature demonstrating the ability of PGE2 to increase fetal ACTH secretion. Injection of PGE2 iv increases fetal ACTH (28). The increase in PGHS activity in ovine placenta before parturition (29), and the well-documented increase in fetal plasma PGE2 concentrations before parturition (30), suggested the possibility that placental PGE2 stimulated fetal ACTH secretion, providing a route of communication between placenta and fetal hypothalamus. The potential role of placental PGE2 as a stimulus to ACTH was questioned in light of the demonstration that higher concentrations of PGE2 were required to stimulate ACTH secretion when delivered into carotid arterial blood (31). A subsequent study demonstrated that the increase in fetal ACTH secretion preceded the increases in plasma PGE2 concentration, casting further doubt on the possible cause-and-effect relationship between placental PGE2 and the preparturitional increase in fetal ACTH secretion (32). The present study affirms a role of PGE2 in the control of the ontogenetic increase in fetal ACTH secretion but demonstrates that the site of synthesis of the PGE2 is within the fetal brain. Interestingly, we cannot be sure that the final increase in cortisol and apparent increase in adrenal sensitivity that precedes parturition in the nimesulide-treated fetuses are not completely independent of brain PGHS-2 activity. Although we assume that the delivery of nimesulide from the osmotic minipumps was constant, we cannot be sure that the effective infusion rate was not reduced after several days or weeks in the minipumps at fetal body temperature.

A striking aspect of the present results is the dissociation between fetal ACTH and cortisol concentrations. The present results are consistent with a study by Poore et al. (33), in which ACTH was infused iv into hypophysectomized fetuses at rates designed to produce a constant plasma ACTH concentration. The results of that study demonstrated that, in the presence of constant fetal plasma ACTH concentrations (concentrations high enough to maintain adrenal viability and function), fetal plasma cortisol concentrations increase as they do in intact fetuses, and parturition is triggered on time. These results demonstrate that well-known changes in adrenal cortical function in the fetus, perhaps in combination with a non-ACTH adrenocorticotropic stimulus, are more important than the increase in hypothalamic or pituitary “drive” to the ontogenetic increase in cortisol secretion. This suggests that fetal ACTH serves two roles, one as an acute stimulus to cortisol secretion after stress, and the other as a trophic hormone that maintains adrenal function and responsiveness to other adrenocorticotropic stimuli. We speculate that the nimesulide-treated fetuses had slightly longer gestation length because the nimesulide inhibited the ACTH responses to the normal (and experiment-induced) stressors that sometimes hasten parturition in chronically catheterized fetal sheep (34).

Adrenal sensitivity to ACTH is a known influence on fetal plasma cortisol concentrations in the sheep fetus. Classical studies by several laboratories demonstrated adrenal growth and increased adrenal sensitivity to ACTH in late gestation (35,36). The increase in adrenal mass is accompanied by an increase in steroidogenic responsiveness to ACTH, an increase in expression of key steroidogenic enzymes, and an increase in the expression of MC2 receptors (ACTH receptors) and steroidogenic acute regulatory protein in the adrenal cortex (37,38,39,40). Acute changes in adrenal sensitivity are also important in the regulation of cortisol responses to stress (41). Although it is possible that there is a yet unidentified endocrine factor stimulating the adrenal, it is quite possible that efferent nerves innervating the adrenal cortex increase the adrenal responsiveness to ACTH in late gestation. In adult dogs, electrical stimulation of the thoracic splanchnic nerves increases the adrenal cortisol secretion rate independent of changes in plasma ACTH concentration or adrenal blood flow (42). In fetal sheep, section of the splanchnic nerves reduces the cortisol response to hypotension (43). It is possible that the late gestation increase in fetal cortisol secretion might be in part mediated by increased splanchnic nerve activity.

Our methodology in the present study gives us confidence that we did not simply fail to detect an increase in fetal ACTH secretion before parturition in study 1. We measured immunoreactive ACTH using a two-site immunoradiometric assay that has been validated for fetal sheep plasma by Myers et al. (44). In contrast with our previous ACTH RIA, this assay is not confounded by circulating concentrations of POMC, pro-ACTH, or fragments containing the ACTH11–24 epitope. We also used a two-site ELISA for POMC and pro-ACTH. This assay does not detect either ACTH1–39 or fragments of the mature peptide. The results of our experiments reveal that ACTH1–39 increases in catheterized but otherwise untreated fetal sheep, that there are concomitant increases in POMC of even larger magnitude, and that the intracerebroventricular infusion of nimesulide blocked the increase in both.

We are also confident that the nimesulide infusion blocked the action of PGHS-2 in the fetal brain, not the placenta. The nimesulide infusion did not reduce fetal plasma PGE2 concentrations (Table 2), suggesting that the mechanism of the inhibition of ACTH was not the inhibition of placental PGHS activity. Leakage of significant amounts of this drug into the peripheral circulation would have inhibited placental PGHS-2 and, therefore, circulating PGE2 (21). The final increase in fetal plasma PGE2 concentration before spontaneous parturition was prevented in the nimesulide group. This is unlikely to be the result of direct inhibition of placental PGHS-2 activity; any effect of nimesulide on the enzyme activity in the placenta would have resulted in reduced fetal plasma PGE2 concentration throughout the infusion period (21). It is more likely that nimesulide interrupted the neuroendocrine cascade that stimulates parturition in this species.

As demonstrated in study 2, the intracerebroventricular infusion of nimesulide resulted in changes in tissue abundance of mRNA and protein for PGHS isoforms that are consistent with the interaction of the drug with PGHS-2. Nimesulide had no statistically significant effects on the abundance of PGHS-1 at either the mRNA or the protein level; all of the drug effects were observed in the abundance of PGHS-2 (Figs. 4 and 5). Nimesulide increased the abundance of PGHS-2 protein and decreased the abundance of PGHS-2 mRNA. One possible interpretation of these results is that the drug bound to, and stabilized, PGHS-2 protein. PGHS is a “suicide inactivated” enzyme that is degraded after activity (45,46). If the enzyme protein is autoregulated, a reduction in the rate of degradation might be reflected in a reduction in the mRNA abundance and a reduction in the rate of synthesis. The lack of effect of nimesulide on plasma POMC, ACTH, or cortisol in study 2 is consistent with the conclusion that PGHS-2 activity is important for the preparturient increase in HPA axis activity but appears to have little influence on the prior unstressed plasma concentrations of these hormones. The effect of nimesulide on plasma estradiol concentration is unexplained by changes in pituitary LH, FSH, or PRL mRNA.

We conclude that the activity of PGHS-2 in the ovine fetal brain is important as a mediator of the preparturient increase in fetal ACTH and POMC secretion that heralds parturition in this species. We also conclude that the increase in fetal plasma cortisol concentration at the end of gestation is at least partially mediated by an increase in fetal adrenal sensitivity to ACTH or other adrenocorticotropic factors. PGHS-2-mediated prostanoid generation within the fetal brain is a critical component of the neuroendocrine mechanisms controlling parturition in this species.

Acknowledgments

We thank Ms. Xiaoyang (Lisa) Fang for her outstanding technical help.

Footnotes

This work was supported by National Institutes of Health Grants HD42135 and HD33053 (to C.E.W.), as well as a predoctoral fellowship award to J.G. from the Florida/Puerto Rico Affiliate of the American Heart Association.

Disclosure Statement: The authors have nothing to disclose.

First Published Online May 1, 2008

Abbreviations: AVP, Arginine vasopressin; COX, cyclooxygenase; EIA, enzyme immunoassay; HPA, hypothalamus-pituitary-adrenal; icv, intracerebroventricularly; PGE2, prostaglandin estradiol; PGHS, prostaglandin endoperoxide synthase; POMC, proopiomelanocortin; PRL, prolactin.

References

  1. Liggins GC 1976 Adrenocortical-related maturational events in the fetus. Am J Obstet Gynecol 126:931–941 [DOI] [PubMed] [Google Scholar]
  2. Liggins GC, Fairclough RJ, Grieves SA, Kendall JZ, Knox BS 1973 The mechanism of initiation of parturition in the ewe. Recent Prog Horm Res 29:111–159 [DOI] [PubMed] [Google Scholar]
  3. Rose JC, Macdonald AA, Heymann MA, Rudolph AM 1978 Developmental aspects of the pituitary-adrenal axis response to hemorrhagic stress in lamb fetuses in utero. J Clin Invest 61:424–432 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Binns W, Shupe JL, Keeler RF, James LF 1991 Chronologic evaluation of teratogenicity in sheep fed Veratrum californicum. J Am Vet Med Assoc 147:839–842 [PubMed] [Google Scholar]
  5. Liggins GC, Kennedy PC, Holm LW 1967 Failure of initiation of parturition after electrocoagulation of the pituitary of the fetal lamb. Am J Obstet Gynecol 98:1080–1086 [DOI] [PubMed] [Google Scholar]
  6. Liggins GC, Holm LW, Kennedy PC 1966 Prolonged pregnancy following surgical lesions of the foetal lamb pituitary. J Reprod Fertil 12:419–422 [Google Scholar]
  7. Liggins GC 1968 Premature parturition after infusion of corticotrophin or cortisol into foetal lambs. J Endocr 42:323–329 [DOI] [PubMed] [Google Scholar]
  8. Liggins GC 1969 Premature delivery of foetal lambs infused with glucocorticoids. J Endocr 45:515–523 [DOI] [PubMed] [Google Scholar]
  9. McDonald TJ, Nathanielsz PW 1991 Bilateral destruction of the fetal paraventricular nuclei prolongs gestation in sheep. Am J Obstet Gynecol 165:764–770 [DOI] [PubMed] [Google Scholar]
  10. Gluckman PD, Mallard C, Boshier DP 1991 The effect of hypothalamic lesions on the length of gestation in fetal sheep. Am J Obstet Gynecol 165:1464–1468 [DOI] [PubMed] [Google Scholar]
  11. Tong H, Lakhdir F, Wood CE 1998 Endogenous prostanoids modulate the ACTH and AVP responses to hypotension in late-gestation fetal sheep. Am J Physiol 275(3 Pt 2):R735–R741 [DOI] [PubMed] [Google Scholar]
  12. Wood CE 2005 Estrogen/hypothalamus-pituitary-adrenal axis interactions in the fetus: the interplay between placenta and fetal brain. J Soc Gynecol Investig 12:67–76 [DOI] [PubMed] [Google Scholar]
  13. Raff H, Wood CE 1992 Effect of age and blood pressure on the heart rate, vasopressin, and renin response to hypoxia in fetal sheep. Am J Physiol 263(4 Pt 2):R880–R884 [DOI] [PubMed] [Google Scholar]
  14. Wood CE 1989 Sinoaortic denervation attenuates the reflex responses to hypotension in fetal sheep. Am J Physiol 256(5 Pt 2):R1103–R1110 [DOI] [PubMed] [Google Scholar]
  15. Reimsnider S, Wood CE 2006 Differential modulation of ovine fetal ACTH secretion by PGHS-1 and PGHS-2. Neuroendocrinology 83:4–11 [DOI] [PubMed] [Google Scholar]
  16. Wood CE, Giroux D 2003 Central nervous system prostaglandin endoperoxide synthase-1 and -2 responses to oestradiol and cerebral hypoperfusion in late-gestation fetal sheep. J Physiol 549(Pt 2):573–581 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-ΔΔ C(T)) method. Methods 25:402–408 [DOI] [PubMed] [Google Scholar]
  18. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254 [DOI] [PubMed] [Google Scholar]
  19. Powers MJ, Wood CE 2006 Ketamine inhibits fetal ACTH responses to cerebral hypoperfusion. Am J Physiol Regul Integr Comp Physiol 292:R1542–R1549 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Wood CE, Gridley KE, Keller-Wood M 2003 Biological activity of 17β-estradiol-3-sulfate in ovine fetal plasma and uptake in fetal brain. Endocrinology 144:599–604 [DOI] [PubMed] [Google Scholar]
  21. Reimsnider SK, Wood CE 2005 Does reduction of circulating prostaglandin e(2) reduce fetal hypothalamic-pituitary-adrenal axis activity? J Soc Gynecol Investig 12:e13–e19 [DOI] [PubMed] [Google Scholar]
  22. Winer BJ 1971 Statistical principles in experimental design. 2nd ed. New York: McGraw-Hill; 514–603 [Google Scholar]
  23. Parmer MKB, Machin D 1996 Survival analysis. A practical approach. Chichester, UK: John Wiley & Sons [Google Scholar]
  24. Zar JH 1984 Biostatistical analysis. 2nd ed. Englewood Cliffs, NJ: Prentice-Hall [Google Scholar]
  25. Ali NS, Keller-Wood M, Wood CE 2005 Ontogenetic changes in the extra-pituitary expression of pro-opiomelanocortin in the developing ovine fetus. Peptides 26:301–306 [DOI] [PubMed] [Google Scholar]
  26. Tong H, Dhillon H, Wood CE 2000 Induction of PGHS-2 mRNA in response to cerebral hypoperfusion in late-gestation fetal sheep. Prostaglandins Other Lipid Mediat 62:165–172 [DOI] [PubMed] [Google Scholar]
  27. Tong H, Richards E, Wood CE 1999 Prostaglandin endoperoxide synthase-2 abundance is increased in brain tissues of late-gestation fetal sheep in response to cerebral hypoperfusion. J Soc Gynecol Investig 6:127–135 [DOI] [PubMed] [Google Scholar]
  28. Hollingworth SA, Deayton JM, Young IR, Thorburn GD 1995 Prostaglandin E2 administered to fetal sheep increases the plasma concentration of adrenocorticotropin (ACTH) and the proportion of ACTH in low molecular weight forms. Endocrinology 136:1233–1240 [DOI] [PubMed] [Google Scholar]
  29. Rice GE, Wong MH, Hollingworth SA, Thorburn GD 1990 Prostaglandin G/H synthase activity in ovine cotyledons: a gestational profile. Eicosanoids 3:231–236 [PubMed] [Google Scholar]
  30. Thorburn GD, Hollingworth SA, Hooper SB 1991 The trigger for parturition in sheep: fetal hypothalamus or placenta? J Dev Physiol 15:71–79 [PubMed] [Google Scholar]
  31. Cudd TA, Wood CE 1992 Prostaglandin E2 releases ovine fetal ACTH from a site not perfused by the carotid vasculature. Am J Physiol 263(1 Pt 2):R136–R140 [DOI] [PubMed] [Google Scholar]
  32. Kumarasamy V, Mitchell MD, Bloomfield FH, Oliver MH, Campbell ME, Challis JR, Harding JE 2005 Effects of periconceptional undernutrition on the initiation of parturition in sheep. Am J Physiol Regul Integr Comp Physiol 288:R67–R72 [DOI] [PubMed] [Google Scholar]
  33. Poore KR, Young IR, Canny BJ, Thorburn GD 1998 Studies on the role of ACTH in the regulation of adrenal responsiveness and the timing of parturition in the ovine fetus. J Endocrinol 158:161–171 [DOI] [PubMed] [Google Scholar]
  34. McMillen IC, Phillips ID, Ross JT, Robinson JS, Owens JA 1995 Chronic stress—the key to parturition? Reprod Fertil Dev 7:499–507 [DOI] [PubMed] [Google Scholar]
  35. Wintour EM, Brown EH, Denton DA, Hardy KJ, McDougall JG, Oddie CJ, Whipp GT 1975 The ontogeny and regulation of corticosteroid secretion by the ovine foetal adrenal. Acta Endocrinol (Copenh) 79:301–316 [DOI] [PubMed] [Google Scholar]
  36. Rose JC, Meis PJ, Urban RB, Greiss FC 1982 In vivo evidence for increased adrenal sensitivity to adrenocorticotropin-(1–24) in the lamb fetus late in gestation. Endocrinology 111:80–85 [DOI] [PubMed] [Google Scholar]
  37. Riley SC, Boshier DP, Luu-The V, Labrie F, Challis JRG 1992 Immunohistochemical localization of 3β-hydroxysteroid/δ5-δ4-isomerase, tyrosine hydroxylase and phenylethanolamine N-methyl transferase in adrenal glands of sheep fetuses throughout gestation and neonates. J Reprod Fertil 96:127–134 [DOI] [PubMed] [Google Scholar]
  38. Simmonds PJ, Phillips ID, Poore KR, Coghill ID, Young IR, Canny BJ 2001 The role of the pituitary gland and ACTH in the regulation of mRNAs encoding proteins essential for adrenal steroidogenesis in the late-gestation ovine fetus. J Endocrinol 168:475–485 [DOI] [PubMed] [Google Scholar]
  39. Su Y, Carey LC, Valego NK, Rose JC 2005 Developmental changes in adrenocorticotrophin (ACTH)-induced expression of ACTH receptor and steroid acute regulatory protein mRNA in ovine fetal adrenal cells. J Soc Gynecol Investig 12:416–420 [DOI] [PubMed] [Google Scholar]
  40. Carey LC, Su Y, Valego NK, Rose JC 2006 Infusion of ACTH stimulates expression of adrenal ACTH receptor and steroidogenic acute regulatory protein mRNA in fetal sheep. Am J Physiol Endocrinol Metab 291:E214–E220 [DOI] [PubMed] [Google Scholar]
  41. McDonald TJ, Nathanielsz PW 1998 The involvement of innervation in the regulation of fetal adrenal steroidogenesis. Horm Metab Res 30:297–302 [DOI] [PubMed] [Google Scholar]
  42. Engeland WC, Gann DS 1989 Splanchnic nerve stimulation modulates steroid secretion in hypophysectomized dogs. Neuroendocrinology 50:124–131 [DOI] [PubMed] [Google Scholar]
  43. Myers DA, Robertshaw D, Nathanielsz PW 1990 Effect of bilateral splanchnic nerve section on adrenal function in the ovine fetus. Endocrinology 127:2328–2335 [DOI] [PubMed] [Google Scholar]
  44. Myers DA, Bell PA, Hyatt K, Mlynarczyk M, Ducsay CA 2005 Long-term hypoxia enhances proopiomelanocortin processing in the near-term ovine fetus. Am J Physiol Regul Integr Comp Physiol 288:R1178–R1184 [DOI] [PubMed] [Google Scholar]
  45. Mevkh AT, Miroshnikov KA, Igumnova ND, Varfolomeev SD 1993 Prostaglandin H synthase. Inactivation of the enzyme in the course of catalysis is accompanied by fast and dramatic changes in protein structure. FEBS Lett 321:205–208 [DOI] [PubMed] [Google Scholar]
  46. Varfolomeyev SD, Mevkh AT 1993 Prostaglandin H synthase as a limiting enzyme of prostaglandin synthesis: substrate-induced inactivation as a new kind of enzyme activity regulation. Biotechnol Appl Biochem 17(Pt 3):291–304 [PubMed] [Google Scholar]

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES