Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Dec 15.
Published in final edited form as: Cancer Res. 2008 Dec 15;68(24):10280–10289. doi: 10.1158/0008-5472.CAN-08-1957

Methylation of Polycomb target genes in intestinal cancer is mediated by inflammation

Maria A Hahn 1, Torsten Hahn 1, Dong-Hyun Lee 1, R Steven Esworthy 2, Byung-wook Kim 2, Arthur D Riggs 1, Fong-Fong Chu 2, Gerd P Pfeifer 1
PMCID: PMC2491345  NIHMSID: NIHMS101493  PMID: 19074896

Abstract

Epigenetic changes are strongly associated with cancer development. DNA hypermethylation is associated with gene silencing and is often observed in CpG islands. Recently it was suggested that aberrant CpG island methylation in tumors is directed by Polycomb proteins. However, specific mechanisms responsible for methylation of Polycomb target genes in cancer are not known. Chronic infection and inflammation contribute to up to 25% of all cancers worldwide. Using glutathione peroxidase, Gpx1 and Gpx2, double knockout (Gpx1/2-KO) mice as a model of inflammatory bowel disease predisposing to intestinal cancer, we analyzed genome-wide DNA methylation in the mouse ileum during chronic inflammation, aging and cancer. We found that inflammation leads to aberrant DNA methylation in Polycomb (PcG) target genes, with 70% of the ~250 genes methylated in the inflamed tissue being PcG targets in embryonic stem cells and 59% of the methylated genes being marked by H3K27 trimethylation in the ileum of adult wildtype mice. Acquisition of DNA methylation at CpG islands in the ileum of Gpx-1/2-KO mice frequently correlates with loss of H3K27 trimethylation at the same loci. Inflammation-associated DNA methylation occurs preferentially in tissue-specific silent genes and, importantly, is much more frequently represented in tumors than is age-dependent DNA methylation. 60% of aberrant methylation found in tumors is also present in the inflamed tissue. In summary, inflammation creates a signature of aberrant DNA methylation, which is observed later in the malignant tissue and is directed by the PcG complex.

Introduction

Analogous to mutations, epigenetic changes are strongly associated with cancer development (1). Aberrant DNA hypermethylation is associated with gene silencing and is often observed in CpG islands. Changes in DNA methylation can also occur in premalignant cells or even in normal tissue, for example as a function of aging (2–6). Such epigenetic events are regarded as early steps in carcinogenesis.

Recent data suggest that Polycomb (PcG) proteins may play a critical role in tumorigenesis (7–9). PcG proteins are repressors involved in maintaining gene expression patterns during development and differentiation (10–13). Binding of PcG complexes is highly correlated with the repressive chromatin mark, H3K27 trimethylation (H3K27me3), catalyzed by PcG protein complexes (14–16). Recently, several groups reported that aberrant DNA hypermethylation in cancer often is associated with PcG target genes (17–21). However, the mechanisms responsible for Polycomb target gene methylation in tumorigenesis are not clear.

A strong link between cancer and chronic inflammation has been established (22–24). Inflammatory bowel disease (IBD) correlates with an increased risk for development of colorectal cancer (25). In most IBD animal models, such as mice deficient for TGF-β1, for T cell receptor α and for IL-10, carcinogenesis in the gastrointestinal tract follows the chronic inflammation phase, which is induced by aberrant microflora (26–28). The inflammation process is always associated with the production of reactive oxygen species (ROS). Phagocytic white blood cells produce ROS for killing invading pathogens. However, ROS can harm an inflamed tissue by damaging proteins, lipids and DNA. Some of these damages have mutagenic effects and are associated with cancer (29). DNA damage caused by oxidative stress can result in different types of modifications including cross-link lesions, base and sugar damage, deletions, DNA strand breaks and halogenation of deoxycytosine (30–32). It has been proposed that 5-halogenated cytosine can be a cause for inappropriate de novo DNA methylation since DNMT1 cannot distinguish methylated from halogenated cytosines in vitro (33, 34). This proposed mechanism provides a possible link between inflammation and cancer through aberrant DNA methylation.

To understand how inflammation may modulate DNA methylation patterns, we have analyzed DNA methylation during chronic inflammation in glutathione peroxide 1 and 2 (Gpx1/2) double knockout mice, which are a mouse IBD model (35–37). These mice lack two antioxidant proteins, Gpx1 and Gpx2. Gpx proteins are responsible for neutralization of ROS and for reduction of hydroperoxides including H2O2. Hydrogen peroxide is the product of reduction of superoxide radicals (O2.−) and is the source for potential cytotoxins like HOCl and HOBr, which are used in cytosine halogenation reactions. In gastrointestinal epithelium, the ubiquitous Gpx1 and the epithelium-specific Gpx2 are the major H2O2-reducing Gpx activities. Mice with homozygous disruption of Gpx1 or Gpx2 are disease-free under normal housing conditions whereas inactivation of both genes (Gpx1/2-KO) leads to high susceptibility to ileocolitis, which begins around weaning (35, 36). Depending on the genetic background, the Gpx1/2-KO genotype causes different susceptibility to cancer development. B6 Gpx1/2-KO mice have milder ileocolitis, a lower mortality, and only 2.5% of B6 mice develop tumors in the lower gastrointestinal tract (37). B6;129 double knockout (DKO) mice have higher levels of inflammatory markers compared to B6 DKO mice, and tumors are observed in 20–25% of the mice housed under non-germ-free conditions. This animal model offers the opportunity to follow epigenetic changes from birth through chronic inflammation to tumor formation.

Materials and Methods

Animals

The establishment and maintenance of the Gpx1/2-KO mouse colonies has been described previously (36, 37). For healthy controls, we used non-DKO mice, which carry at least one wildtype (WT) Gpx1 or Gpx2 allele and do not develop intestinal inflammation. Gpx1/2-KO and control mice were housed under normal, non-germ-free conditions. Pathology of the tumors was performed as described previously (36, 37).

DNA isolation

Epithelial cells were isolated from the distal 10 to 12 cm of the small intestine (distal ileum, corresponding to the diseased segment in Gpx1/2-KO mice at the height of pathology and distribution of tumors) by the everted sac method as described previously (38) to recover the villus and crypt compartments. DNA was isolated using a phenol-chloroform extraction method.

MIRA assisted CpG island microarrays

MIRA and protein purification for MIRA were done as described previously (39). DNA was digested with MseI and HhaI, ligated to MseI linkers, and the methylated fragments were enriched by MIRA for hybridization to microarrays as described previously (17, 40). We used mouse CpG island microarrays (Agilent Technologies; Santa Clara, CA) with two-dye Cy3/Cy5 labeling. This microarray covers 16,030 CpG islands and contains 97,652 oligonucleotide probes. All microarray hybridizations (except for the age-dependent DNA methylation study) were done by comparing the experimental sample (DKO mice) with the control sample of the same age group. For inflammation-dependent and age-dependent DNA methylation analysis, we analyzed the MIRA-enriched fractions from pooled DNA from 3–5 mice (on quadruplicate microarrays for each genetic background). In tumor cases, methylation patterns of individual tumors were compared to a mixed DNA sample from five control mice at the age of 8 months. Labeling and array hybridization were as described (40). The data were analyzed with Axon’s GenePix v.5.1 software. Statistical analysis was performed with ChIP Analytics v.1.3. (Agilent) to determine genes affected by DNA methylation. This software includes user-configurable heuristics for binding event identification based on p-values and adjacent probes, as well as inter- and intra-array intensity normalization and error modeling. The default settings were used with Lowess normalization and the requirement of three bound oligonucleotides for a gene to be considered as a methylation-positive candidate. For indication of methylated regions in evaluated genes, we used oligonucleotides with P [Xbar] less than 10−4. Since in our experiments only a few genes (17 genes of 552) were affected by methylation of several CpG islands, we considered these 35 CpG islands as separate genes in our statistic analysis. Since we used mice of both genders, we excluded data for the X-chromosome. Microarray data were deposited into the GEO database (accession number GSE12315).

Tiling microarrays

We used NimbleGen tiling microarray, MM8 Tiling Set 16. This microarray contains a large part of chromosome 7, from 47,370,227 to 115,300,979. MIRA-enriched DNA fractions from 8-month-old DKO mouse ileum and 8-month-old ileum from control mice were compared with input DNA. The labeling of dsDNA, microarray hybridization and scanning were performed by the NimbleGen Service Group (Reykjavik, Iceland). Data were extracted from scanned images by using NimbleScan 2.3 extraction software. The obtained methylation patterns were compared between DKO and control mice.

Combined bisulfite restriction analysis (COBRA) and bisulfite sequencing

To verify the microarray data, we performed COBRA and bisulfite sequencing. Mouse genomic DNA was bisulfite-converted using the Zymo Gold kit (Zymo Research; Orange, CA). The bisulfite-treated DNA was amplified with DNA fragment-specific primers available upon request. PCR products were digested with BstUI, HpyCHIV4, or TaqIα restriction enzymes (New England Biolabs; Ipswich, MA) according to the COBRA method described by Xiong and Laird (41). The PCR products obtained after bisulfite conversion were cloned into the pGEMTeasy vector (Promega; Madison, WI) and 10 individual clones were sequenced.

Chromatin immunoprecipitation and microarrays (ChIP on chip)

Chromatin immunoprecipitation from ileum epithelial cells (prepared as described above) was performed as described (42). We used chromatin containing 8 μg DNA with a size range on agarose gels of 300 bp to 1 kb. Chromatin was incubated overnight with 4 μg antibodies against H3K27me3 or H3K9me3 (Upstate; Lake Placid, NY). Normal rabbit immunoglobulin G (Santa Cruz Biotechnology; Santa Cruz, CA) was used as a control. For generation of blunt ends, ChIP and input DNA were incubated with T4 DNA polymerase (New England Biolabs) in presence of dNTPs at 12°C for 20 min. After purification with QIAquick kits (Qiagen), DNA was ligated to a blunt linker (5′AGCAACTGTGCTATCCGAGGGAT and 5′ATCCCTCGGA) with T4 ligase (New England Biolabs) at 16°C overnight. Amplification was done by using Taq polymerase (Qiagen) according to the MIRA protocol (17). We performed two different types of ChIP on chip experiments: (i) ChIP versus input for detection of localization of chromatin modifications along chromosomes and (ii) ChIP versus ChIP for detection of changes in chromatin modifications during inflammation in the ileum of Gpx1/2-KO mice. ChIP on chip experiments were performed on Agilent CpG island microarrays with Cy3/Cy5 labeling. For ChIP versus ChIP experiments, statistical analysis was performed with ChIP Analytics v.1.3. (Agilent). The default settings were used with Lowess normalization and the requirement of three bound oligonucleotides for a gene to be considered as an H3K27me3-positive candidate. For indication of bound regions in evaluated genes, we used oligonucleotides with P [Xbar] less than 10−3. Binding of H3K27me3 antibodies to chromatin in ChIP versus input arrays was performed after feature extraction and normalization by Axon’s GenePix v.5.1. A CpG island was considered as positive for H3K27me3 binding if it contained three or more probes with a binding ratio of H3K27me3/Input of more than 1.9 and a distance between each probe of less than 1000 bp. For real-time PCR verification, 2 μl of ChIP DNA and input DNA from three independent mice were amplified with gene-specific primers (sequences available upon request). A standard curve method was applied and data were presented relative to input (100%). Hoxa10 promoter primers were used as positive control for binding of H3K27me3; H19 primers were used as a positive control for H3K27me3 and H3K9me3. The Gapdh promoter was used as a negative control. Binding to IgG antibodies was used as background control.

Analysis of gene expression patterns using the Unigene database

In order to compare gene expression with DNA methylation data, we used the NCBI Unigene database, which provides information on tissue-specific EST counts. Up to May 2008, 85872 ESTs were available for mouse intestine. A gene was considered as unexpressed if zero EST counts of this gene were detected per 85872 ESTs. A gene was considered as “low expression” if one or two ESTs were detected. A gene was considered as “expressed” if three or more ESTs were found per 85872 ESTs.

Real-time RT-PCR

Tissues from mouse brain cerebrum and ileum were used. RNA isolation was performed using the RNAeasy Mini kit according to the manufacturer’s protocol (Qiagen). Synthesis of cDNA targets was performed with the iScript cDNA Synthesis kit (BioRad; Hercules, CA). Using real-time PCR, cDNA was amplified with transcript-specific primers (sequences available upon request). For verification of the amount of a particular cDNA in the samples, a standard curve method was applied. Gene transcription was normalized to Gapdh expression.

Results

DNA methylation changes in Gpx1/2-KO B6 mice

For genome-wide analysis of DNA methylation patterns during chronic inflammation, aging and tumorigenesis, we used the methylated-CpG island recovery assay (MIRA) coupled with a microarray approach (17). This method is based on the enrichment of the genomic DNA fraction containing CpG-methylated DNA using the MBD2b and MBD3L1 protein complex and then hybridization using microarrays. We hybridized 5-methylcytosine-enriched DNA from Gpx1/2-KO and control mice onto Agilent CpG island microarrays. To examine DNA methylation changes during ileum inflammation, we analyzed tumor-free ileum of Gpx1/2-KO and wildtype control mice at the ages of 28 days and 8 months. For mice on the B6 background, the microarray statistical analysis revealed that Gpx1/2-KO mice at age 28 days had only 7 genes that have an increased level of CpG island methylation relative to control mice (Fig. 1; Suppl. Tables 1 and 2). However, at the age of 8 months, Gpx1/2-KO B6 mice had 249 genes with increased DNA methylation in comparison to 8-month-old B6 control mice (Fig. 1; Suppl. Table 1). The DNA methylation status of microarray gene candidates Robo1, Gpc6 and Gabrg3 was verified by COBRA and by bisulfite sequencing (Fig. 2). Confirming the microarray results, these data show that during inflammation in the DKO mice, DNA methylation is substantially increasing (Fig. 2). COBRA analysis of other genes, Lepr, Parc, Lhx8, Barhl2, Cdo1, Sez6l, Fbn1 and Jam3, also indicated a strong increase in DNA methylation in the inflamed ileum of DKO mice (Fig. 3; Suppl. Fig. 1). As expected, we also saw an increase in DNA methylation of several CpG islands as a function of age (8 months versus 28 days) in control mice. Aberrant DNA methylation during inflammation can occur independently of age-associated DNA methylation (e.g., Barhl2, Cdo1, Sez6l) or can take place at an increased level in genes that are affected by age-dependent DNA methylation (e.g., Robo1, Gpc6, Gabrg3, Lhx8, Fbn1, Jam3) (Fig. 2 and Suppl. Fig. 1). To determine if inactivation of Gpx1 and Gpx2 in DKO mice may affect DNA methylation independently of tissue inflammation, we performed MIRA-assisted microarray analysis with liver DNA obtained from DKO and control mice at age 28 days and 8 months, since this organ is not affected by inflammation. The microarrays indicated that DNA methylation in liver is increased in only one gene (Vamp4) at the age of 28 days and in 20 genes (11700023E05Rik, 4933433P14Rik, AI854703, Cdkn1b, Ece1, Flt4, Gpx1 exon2, Hapln4, Hnrpk, Mab21l2, Pcdha4, Ppp1r11, Ptch1, Ran, Sema3b, Shroom1, Sox15, Spag1, Yrdc, Zfp710) at the age of 8 months compared to control liver (Fig. 1). Therefore, in the inflamed ileum of DKO mice, aberrant DNA methylation was over 10 times more frequent than in liver.

Figure 1. Results and flow chart of analysis of inflammation-dependent DNA methylation in Gpx1/2-KO mice.

Figure 1

Using MIRA-assisted microarray analysis, inflammation-dependent DNA methylation was determined by hybridization of ileum DNA from 28-day- and 8-month-old Gpx1/2-KO mice versus ileum DNA from control mice of the same age. Experiments were performed for mice on the B6 and B6;129 background. As a control for Gpx1/2-KO-specific DNA methylation in the intestinal epithelium, liver DNA was used. The number of methylated genes is indicated.

Figure 2. Verification of candidate genes methylated in Gpx1/2-KO B6 mouse ileum by COBRA and bisulfite sequencing.

Figure 2

A, Robo1; B, Gpc6; C, Gabrg3. Marked isoforms and genes are according to the UCSC Genome Browser. The “Methylation” bar represents DNA regions where inflammation-associated DNA methylation occurs according to the MIRA microarray experiments. CpG islands and localization of COBRA primers are indicated. Using gene-specific primers, bisulfite-converted DNA was amplified. The numbers refer to mouse identification numbers. These were the same mice used in the microarray approach (Fig. 1). After cutting with enzymes (BstUI, TaqIα or HpyCH4IV) recognizing CpG dincucleotides, mock (−) and enzyme-digested (+) PCR products for individual mouse tissue samples were fractionated by size on a 2% agarose gel. In vitro CpG-methylated mouse DNA (M) served as a positive control. Cleavage indicates DNA methylation. Additionally, PCR products were cloned into the pGEMTeasy vector and sequenced. White and black circles represent unmethylated and methylated CpG sequences, respectively.

Figure 3. Aberrant DNA methylation in mice with B6 and B6;129 genetic background and role of aging in inflammation-dependent DNA methylation.

Figure 3

A, Comparison of genes affected by inflammation-dependent DNA methylation in DKO ileum from mice with B6 and B6;129 genetic background at the age of 8 months. B, DNA methylation analysis of the Robo1, Parc and Lepr CpG islands in control and DKO B6 mice by COBRA. Using gene-specific primers, bisulfite converted DNA was amplified. After cutting with enzyme (BstUI, TaqIα or HpyCH4IV) recognizing CpG sites, mock (−) and enzyme-digested (+) PCR products were fractionated by size on a 2% agarose gel. In vitro methylated mouse DNA (M) served as a positive control. C, DNA methylation patterns of the Robo1, Parc and Lepr CpG islands in control and DKO mice with B6;129 genetic background were analyzed by COBRA. D, Comparison of genes affected by age-dependent and inflammation-dependent DNA methylation in DKO ileum from mice with B6 and B6;129 genetic background at the age of 8 months.

DNA methylation changes in the ileum during inflammation in Gpx1/2-KO B6; 129 mice

In addition to the B6 background, inflammation-dependent DNA methylation was analyzed in B6;129 mice (Fig. 1, Suppl. Tables 1 and 2) which have higher levels of inflammation and are more prone to tumorigenesis (37). According to the microarray data, these mice had an increase in DNA methylation in 26 genes at age 28 days and in 273 genes at age 8 months when comparing to control mice (Fig. 1; Suppl. Table 2). As for B6 mice, microarray data for B6;129 mice were confirmed by COBRA and bisulfite sequencing of CpG islands of gene candidates, Zfp329, Pdx1 and Fat4 (Suppl. Fig. 2). We verified several gene candidates (Vax1, Tnfaip8, Nefm) with the highest p-values to prove that these evaluated genes were highly methylated (Suppl. Table 1 and Suppl. Fig. 3). All three genes had strongly increased DNA methylation in DKO mice compared to control mice. Similar to B6 mice, aberrant DNA methylation during inflammation in B6;129 mice was inflammation-specific in one type of CpG islands, i.e. occurring only in DKO mice (e.g., Zfp329, Msx1, Barhl2, Parc, Tnfaip8, Gabrg3, Itgb4) and also occurred during normal ageing – albeit at a reduced level - in other CpG islands (e.g., Fat4, Pdx1, Dbc1, Cdh7, Cyp7b1, Cdh20, Tbx2, Vax1, Nefm, Robo1, Lepr) (Fig. 3, Suppl. Figs. 2 and 3).

In order to further confirm our CpG island microarray data, we performed NimbleGen tiling array analysis of chromosome 7 from position 47,370,227 to 115,300,979 with DKO and control mouse ileum at age 8 months versus input DNA. According to the CpG island microarrays, chromosome 7, from 47,370,227 to 115,300,979, contains eight genes (Dbx1, Tmem16e, Gabrg3, Nr2f2, A830059I20Rik, Phox2a, Ric3, Cyp2r1) affected by aberrant DNA methylation during inflammation in DKO mice (Suppl. Table 1). Tiling array data confirmed CpG island microarray results since analysis of peaks of MIRA-enriched DNA showed that all eight genes have intense peaks in DKO mice compared to control mice (Suppl. Fig. 4). We searched for hypomethylation of flanking DNA regions around repetitive elements in inflamed tissues. However, we did not detect any substantial hypomethylation in ileum DNA from DKO mice in comparison to healthy control mice.

Since different backgrounds of DKO mice have different susceptibility to tumorigenesis, we compared inflammation-dependent aberrant DNA methylation in B6 and B6;129 mice (Fig. 3 and Suppl. Table 1). We found that both backgrounds had ~80% (213) similarities of inflammation-dependent DNA methylation patterns (Fig. 3A,B,C). This observation suggests that genetic background may affect DNA methylation of only a small proportion of all CpG islands. We compared methylation patterns between mice of the same genetic background by using COBRA. We observed that individual mice with the same background are characterized by similar methylation patterns during inflammation (Fig. 2, Fig. 3, Suppl. Figs. 1, 2 and 3). This data indicates that inflammation-dependent aberrant methylation is not just a stochastic event but is predisposed to occur in specific genes.

Inflammation-dependent DNA methylation and Polycomb marking

Since DNA methylation may be directed by PcG binding (18–21), we compared genes affected by aberrant DNA methylation in DKO mice with genes having promoters marked by H3K27me3, Suz12, Eed1, Phc1, or Rnf2 in mouse embryonic stem (ES) cells (11). We considered a gene as a PcG target if this gene is marked by H3K27me3 and/or is bound by at least one of the analyzed PcGs (Suz12, Eed1, Phc1 or Rnf2) in ES cells. We found that ~70% of genes affected by aberrant DNA methylation in the ileum of DKO mice were PcG targets in ES cells (Table 1, row A). From these PcG targets, 97% were marked by H3K27me3 and 35% were associated with all five PcG marks (Table 1, rows B and C). We observed that PcG targeting is associated with aberrant DNA methylation independently of CpG island localization since ~73% of genes affected by inflammation-dependent DNA methylation in the promoter region and ~67% of genes affected by aberrant DNA methylation outside of the promoter were PcG targets (Table 1, rows D and E). These data were very similar for both genetic backgrounds. Since homeobox genes are regulated by PcG, we analyzed inflammation-dependent DNA methylation in homeobox genes. We found that ~7% of inflammation-dependent DNA methylation takes place at CpG islands associated with homeobox genes (Table 1, row F). Age- dependent DNA methylation affects PcG targets less frequently than inflammation-dependent DNA methylation. Only ~49–53% of age-dependent DNA methylation events occurred at PcG targets (Table 1, row A). Further analysis revealed that 58% of tumor-associated aberrant DNA methylation occurred at PcG targets. These data suggest that PcG targeting established in early development is critical for aberrant DNA methylation occurring during inflammation of the intestinal tissue of mice.

Table 1.

Methylation of Polycomb target genes during inflammation, aging and cancer

Strain Inflammation a Aging b Tumorigenesis c Tumor-specific d
A. PcG targets among genes affected by DNA methylation B6 71% (125/175) 53% (69/129) N/A N/A
B6;129 70% (128/183) 49% (40/81) 58% (82/141) 43% (18/42)
B. Methylated PcG targets associated with H3K27me3 B6 97% (121/125) 96% (66/69) N/A N/A
B6;129 97% (124/128) 98% (39/40) 99% (81/82) 100% (18/18)
C. Methylated PcG targets associated with H3K27me3, Suz12, Eed1, Phc1 and Rnf2 B6 35% (44/125) 38% (26/69) N/A N/A
B6;129 35% (45/128) 35% (14/40) 43% (35/82) 56% (10/18)
D. PcG targets among genes affected by DNA methylation in 5′ gene end B6 75% (75/100) 70% (29/41) N/A N/A
B6;129 72% (70/97) 67% (12/18) 46% (24/52) 15% (2/13)
E. PcG targets among genes affected by methylation outside of promoter B6 67% (50/75) 45% (40/88) N/A N/A
B6;129 67% (58/86) 44% (28/63) 65% (58/89) 55% (16/29)
F. Homeobox genes among genes affected by DNA methylation B6 6.4% (16/249) 4.7% (10/213) N/A N/A
B6;129 7.7% (21/273) 4.8% (6/124) 8.6% (18/210) 12.5% (8/64)
G. Expression of genes affected by methylation in 5′ gene end B6 No86% (122/142)
Low 13% (18/142)
Yes 1% (2/142*
No 77% (47/61)
Low 13% (8/61)
Yes 10% (6/61)
N/A N/A
B6;129 No 84%
(121/144)
Low 15% (21/144)
Yes 1% (2/144 )
No 68% (17/25)
Low 28% (7/25)
Yes 4% (1/25)
No 70% (56/80)
Low 17.5% (14/80)
Yes 12.5% (10/80)
No 21% (4/19)
Low 32% (6/19)
Yes 47% (9/19)
H. Aberrant DNA methylation in 5′ gene end B6 60% (147/249) 33% (70/213) N/A N/A
B6;129 55% (150/273) 26% (32/124) 34% (81/210) 28% (18/64)
a

Genes hypermethylated in the ileum of 8-month-old Gpx-1/2-KO mice versus non-DKO controls

b

Genes hypermethylated in the ileum of 8-month-old control mice versus 28-day-old control mice

c

Genes hypermethylated in tumors of B6;129 Gpx-1/2-KO mice

d

Genes affected by DNA methylation only in tumors

e

No expression, zero EST counts; low expression, 1–2 EST counts; Yes, 3 or more EST counts in mouse intestinal tissue.

The total numbers in this Table were adjusted since for several genes Polycomb binding or expression data were not available. PcG data are from Boyer et al. (ref. 11).

To determine if the Polycomb mark H3K27me3 is found in intestinal epithelial tissue of mice, we carried out chromatin immunoprecipitation (ChIP) on chip experiments with ileum epithelial cells isolated from 8-month-old control and Gpx1/2-KO mice. In total, 146 of the 249 CpG-methylated genes (59%) were positive for the Polycomb mark H3K27me3 in ileum of control mice (Fig. 4A; Suppl. Table 1). 171 CpG islands showed a decrease of Polycomb marking (H3K27me3) and 68 CpG islands showed an increase of this modification in the Gpx1/2-KO mice versus control mice. Only 2 of the 68 CpG islands showing an increase of H3K27me3 were DNA CpG-methylated. However, strikingly, 46 of the 171 CpG islands showing a decrease of H3K27me3 in Gpx1/2-KO mice were on the list of 249 genes having increased DNA methylation in the DKO mice (Fig. 4A). To verify the array data with conventional ChIP assays, we conducted real-time PCR assays of several candidate genes that showed decreased H3K27 trimethylation in the DKO mice (Fig. 4). These experiments confirmed reduction of the Polycomb mark for CpG islands that became CpG-methylated in the DKO mice (Gabrg3, Gpc6, Sez6l, Cdh20, Pcdh17, Pcdh7 and Cbln4). Simultaneously, there was a small increase in H3K9 trimethylation at the same gene targets. These results indicate that inflammation leads to a frequent rearrangement of Polycomb marks. Our results indicate that the repressive chromatin mark H3K27me3 can be removed and replaced by the presumably more permanent repressive mark, DNA CpG methylation, during the intestinal inflammation process in Gpx1/2-KO mice.

Figure 4. Frequent loss of the H3K27me3 Polycomb mark at genes that undergo DNA methylation in the ileum of Gpx-1/2-KO mice.

Figure 4

Chromatin immunoprecipitation was conducted with ileal epithelial cells of 8-month-old wildtype and Gpx-1/2-KO mice. A, The Venn diagram summarizes the data obtained from CpG island arrays. Of the 249 genes that underwent DNA methylation in the ileum of DKO mice, 146 were marked by H3K27me3 in the ileum of control mice. 46 of these genes lost the Polycomb mark in the ileum of Gpx-1/2-KO mice. B, The RT-PCR data show verification of H3K27me3 loss in the ileum of DKO mice versus wildtype mice for the genes indicated. Asterisks indicate statistically significant differences (*, p<0.01; **, p<0.001). Hoxa10 promoter primers were used as positive control for binding of H3K27me3, H19 primers were used as a positive control for H3K27me3 and H3K9me3. The Gapdh promoter was used as a negative control. Binding to IgG antibodies was used as background control. Data shown are relative to “Input” (100%). C, Analysis of H3K9me3 in the ileum of control and DKO mice. D, Nonspecific IgG was used as a control.

Age-dependent DNA methylation in the ileum of Gpx1/2-KO mice

Analogous to inflammation, aging plays a critical role in tumorigenesis and is characterized by CpG island DNA hypermethylation (3). In order to establish a differential role of age-dependent and inflammation-dependent DNA methylation in tumorigenesis, we analyzed DNA methylation in the ileum during aging. Age-dependent DNA methylation was determined by hybridization of MIRA enriched DNA from the ileum of control, Gpx-wildtype mice at age 28 days versus MIRA enriched DNA from ileum of control mice at the age of 8 months. Experiments were done for both B6 and B6;129 backgrounds (Suppl. Tables 1 and 2). Microarray analysis revealed that the ileum from control mice on the B6 background was more affected by age-dependent DNA methylation compared to ileum from B6;129 mice. In ileum of B6 control mice, we detected 213 genes affected by age-dependent DNA methylation in contrast to B6;129 mice, which were characterized by 124 genes methylated with aging. Analysis of the similarities in age-dependent DNA methylation between B6 and B6;129 mice revealed that both genetic backgrounds have 100 genes in common that were affected by age-dependent DNA methylation (Fig. 3D). During aging, 24 genes were B6;129 background-specifically methylated in contrast to 113 genes specifically affected by age-dependent DNA methylation on the B6 background (Fig. 3D). These data indicate that age-dependent DNA methylation is affected by genetic background.

Comparison of age-dependent and inflammation-dependent DNA methylation patterns of DKO B6;129 mouse ileum revealed that 34 genes have accelerated age-dependent DNA methylation in inflamed DKO B6;129 ileum (Fig. 3D). These genes become more methylated from 28 days to 8 months in control tissues and are even more highly methylated in inflamed tissues of DKO mice in comparison to control mice at age 8 months. For DKO B6 mice, we detected 65 genes affected by accelerated age-dependent DNA methylation during inflammation (Fig. 3D). However, age-dependent and inflammation-dependent DNA methylation showed only ~20–30% overlap. 88% of genes for B6;129 mouse ileum and 74% of genes for B6 mouse ileum affected by inflamed ileum-specific methylation were not affected by aging (Fig. 3D). 73% of genes for B6;129 mouse ileum and 70% of genes for B6 ileum affected by age-dependent methylation did not undergo inflammation-dependent DNA methylation. This observation indicates that inflammation dependent and age-dependent DNA methylations preferentially affect different CpG islands.

DNA methylation changes during tumorigenesis in Gpx1/2-KO mice

To elucidate the impact of inflammation-dependent DNA methylation on tumorigenesis, we performed MIRA-assisted microarray analysis on tumors arising in B6;129 DKO mice versus control tissue from wildtype mice at the age of 8 months. Microarray data from six independent tumors revealed that tumorigenesis, as expected, is associated with aberrant DNA methylation. Surprisingly, however, the tumor-associated aberrant DNA methylation was less pronounced than inflammation-dependent DNA methylation since inflamed ileum from DKO 129;B6 8-month-old mice was characterized by 273 affected genes in contrast to 76, 50, 107, 92, 76 and 52 affected genes in the six individual tumors (Suppl. Table 1 and 2). Comparing the DNA methylation patterns of the two events, tumorigenesis and inflammation, we observed three types of genes: genes affected by inflammation-specific DNA methylation in DKO mice, genes affected by tumorigenesis-specific DNA methylation, and genes methylated in both inflamed and tumor tissue samples (Fig. 5A). The last group contained almost 60% of all the genes affected by aberrant DNA methylation in DKO tumors. Comparison of methylation patterns of tumors reveled similarities: 9 genes from a total of 209 tumor-methylated genes were affected by DNA methylation in all 6 tumors (Fig. 5B). However, 6 of these 9 genes were also methylated in inflamed tissues (Suppl. Table 1). Twelve genes were methylated in 5 of 6 tumors and 8 of these 12 were affected by aberrant DNA methylation during inflammation. These observations suggest that inflammation plays a critical role in tumor-associated DNA methylation.

Figure 5. Tumor-associated DNA methylation and the role of aging and inflammation in tumor-associated DNA methylation.

Figure 5

A, Comparison of genes affected by inflammation-dependent and tumor-associated DNA methylation revealed three gene groups: genes affected by inflammation-dependent DNA methylation (group A; example: CpG island at the 5′ end of Barhl2), genes affected by inflammation-dependent and tumor-associated DNA methylation (group B; example: CpG island inside the Itgb4 gene), and genes affected only by tumor-associated aberrant DNA methylation (group C; example: CpG island at the 3′ end of Pitx2 gene). The gel panels show COBRA analysis of genes falling into the three categories. B, Diagram indicating genes affected in common by aberrant DNA methylation in six different DKO ileum tumors. C, Comparison of genes affected by age-dependent, inflammation-dependent and tumor-associated DNA methylation. Genes affected by tumor-associated DNA methylation in different tumors are summarized together. D, Comparison of genes affected by age-dependent, inflammation-dependent and tumor-associated DNA methylation for each individual tumor.

To determine the impact of aging and inflammation on tumorigenesis-associated DNA methylation separately, we compared genes affected by aberrant DNA methylation in aging, inflammation and tumorigenesis. This study was performed for each individual tumor (Fig. 5D). We observed that tumor- associated aberrant DNA methylation consists of tumor-specific, inflammation-dependent and age-dependent DNA methylation. However, we found that only ~2% of genes affected by aberrant DNA methylation in tumors specifically showed age-dependent DNA methylation (these genes were not affected by inflammation-dependent DNA methylation in DKO mice). In contrast, ~60% of tumor-associated DNA methylation occurred also during inflammation and was not affected by age-dependent DNA methylation. These data were also confirmed when genes affected by tumor-associated DNA methylation in all 6 tumors (209) were plotted together (Fig. 5C). This observation indicates that in this mouse model inflammation has a dominant impact relative to aging on aberrant DNA methylation in tumors.

Analysis of expression of genes affected by aberrant DNA methylation at the 5′ end

We analyzed how gene expression status may affect the acquisition of DNA methylation at the 5′ ends of genes. For this approach, we used real-time RT-PCR and the Unigene database, which gives a semiquantitative estimate of tissue-specific gene expression, based on EST counts. Only 1% of methylation-susceptible genes were expressed at substantial levels (more than 2 ESTs out of >85000) according to the Unigene database. Inflammation-associated DNA methylation in the ileum of B6 and B6;129 DKO mice at 5′ gene ends was correlated with 86% and 84% of silent or poorly expressed genes (no EST counts), respectively (Table 1; row G). This 5′ methylation was also associated with 13% and 15% of genes with low expression (1 or 2 EST counts) in B6 and B6;129 DKO mice, respectively. These data indicate that inflammation-dependent DNA methylation occurs preferentially in already tissue-specifically silenced or poorly expressed genes. We performed real-time RT-PCR with control and DKO B6 mouse tissues (Suppl. Fig. 5). Analysis of the Unigene database revealed that the brain frequently expresses genes affected by inflammation-dependent DNA methylation at the 5′ gene ends at high levels. Therefore, we used gene expression in brain as a positive control. We analyzed gene expression of 8 genes, among which 4 genes (Dbc1, Robo1, Barhl2 and Parc) were unexpressed, 3 genes (Sez6l, Fbn1 and Jam3) had low expression and one gene, Cdo1, was expressed according to the Unigene database. For most genes tested, transcription in ileum was strongly reduced in comparison to brain (Suppl. Fig. 5).

Discussion

Our data reveal that inflammation of the ileum leads to aberrant DNA methylation of several hundred CpG islands in Gpx-1/2 double knockout mice on two genetic backgrounds. Both backgrounds showed ~80% similarities in aberrant DNA methylation caused by inflammation and the numbers of genes affected by inflammation-dependent DNA methylation were comparable (249 and 271, respectively). However, B6 Gpx1/2-KO mice have milder ileocolitis and an 8–10-fold lower tumor incidence than B6;129 Gpx1/2-KO mice. These data suggest that while inflammation is clearly associated with methylation of a large number of CpG islands, an increase in such methylation events per se rarely leads to neoplastic transformation in B6 Gpx1/2-KO mice having a relatively tumor-resistant genetic background. We have analyzed the methylated genes for known roles in human cancer. Eighteen of the promoter-methylated genes in our mouse model of ileum inflammation are methylated in human cancers (Pcdh10, Grm7, Robo1, Sall1, Dbc1, Zik1, Cadm1, Dapk1, Hspa2, Fbn1, Prima1, Htr1b, Sez6l, Thbd, Hhip, Sox17, Nell1, Ptgis), and four of these genes (Hhip, Sox17, Nell1 and Ptgis) are methylated in human colorectal cancer (43–45).

Our study revealed that ~60% of cancer-associated DNA methylation events were present in the inflammation-prone tissue prior to tumor formation. This finding indicates an important role of the inflammation process in aberrant DNA methylation in cancer as previously suggested for human cancers of the GI tract (46–48). By comparing the genes affected by inflammation-dependent DNA methylation in the ileum of Gpx-1/2-KO mice with genes marked by PcG proteins and H3K27me3 in mouse ES cells (11), we found that 70% of genes affected by inflammation- dependent DNA methylation are PcG targets. In addition, 59% of the CpG-methylated genes showed occupancy with the PcG mark H3K27me3 in the ileum of wildtype mice. This observation indicates a role of H3K27me3 and the Polycomb complexes in establishment of aberrant DNA methylation. Our data indicate that during tissue inflammation the Polycomb mark may be rearranged. At CpG islands undergoing de novo methylation H3K27me3 can be lost. As a consequence, DNA methylation is a more permanent silencing mark, which may be difficult to remove during subsequent stages of cell proliferation.

Inflammation-dependent DNA methylation has a much stronger correlation with tumor-associated DNA methylation patterns than age-dependent methylation. Age-dependent and inflammation- dependent DNA methylation occurred mostly in different gene targets, although some targets also showed accelerated age-dependent DNA methylation during inflammation in DKO mice. This argues against a scenario in which inflammation can be simply depicted as accelerated aging at the cellular level manifested, for example, by enhanced cell proliferation. Aberrant DNA methylation caused by aging, inflammation and cancer may have different epigenetic mechanisms.

We found that aberrant DNA hypermethylation during inflammation at 5′ ends of genes is most frequently associated with tissue-specifically silenced or very weakly expressed genes. Promoter DNA methylation is likely a consequence of gene silencing directed by PcG binding and low expression levels of the target gene. The biochemical mechanism of inflammation-associated methylation of PcG gene targets remains to be determined. In one hypothetical model, DNA methyltransferases are associated with Polycomb complexes in somatic stem cells. The effect of inflammation would be to induce proliferation of the stem cell pool thus leading to methylation errors at PcG target loci where DNMT proteins are preferentially localized. Alternatively, but not mutually exclusive, chlorination of cytosines at CpG sites as a consequence of oxidative stress and production of HOCl during inflammation, may lead to aberrant methylation of chlorocytosine-containing CpG sites by DNMT1 as previously proposed (33). If DNMT proteins were preferentially associated with PcG targets, CpG sites within these loci could become methylated by this mechanism even in non-dividing cells. This model may also explain the gradual DNA methylation found around tumors since tumors often contain inflammatory infiltrates, which may cause oxidative stress.

In summary, inflammation leads to aberrant DNA methylation, which is predisposed by binding of Polycomb proteins and by lack of gene expression. Future investigations should be aimed at further elucidating the biochemical mechanism of PcG-associated aberrant DNA methylation. In addition, it will be important to determine the functional importance of PcG target gene methylation in tumorigenesis with the goal of identifying those specific PcG targets important in tumor suppression.

Supplementary Material

Suppl data

Acknowledgments

This work was supported by NIH grants CA084469 and CA128495 to GPP and CA114569 to FFC. We would like to thank Tibor Rauch and Zunde Wang for help with the MIRA-assisted microarray method.

References

  • 1.Jones PA, Baylin SB. The epigenomics of cancer. Cell. 2007;128:683–92. doi: 10.1016/j.cell.2007.01.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Issa JP, Ottaviano YL, Celano P, Hamilton SR, Davidson NE, Baylin SB. Methylation of the oestrogen receptor CpG island links ageing and neoplasia in human colon. Nat Genet. 1994;7:536–40. doi: 10.1038/ng0894-536. [DOI] [PubMed] [Google Scholar]
  • 3.Ahuja N, Li Q, Mohan AL, Baylin SB, Issa JP. Aging and DNA methylation in colorectal mucosa and cancer. Cancer Res. 1998;58:5489–94. [PubMed] [Google Scholar]
  • 4.Holst CR, Nuovo GJ, Esteller M, et al. Methylation of p16(INK4a) promoters occurs in vivo in histologically normal human mammary epithelia. Cancer Res. 2003;63:1596–601. [PubMed] [Google Scholar]
  • 5.Yan PS, Venkataramu C, Ibrahim A, et al. Mapping geographic zones of cancer risk with epigenetic biomarkers in normal breast tissue. Clin Cancer Res. 2006;12:6626–36. doi: 10.1158/1078-0432.CCR-06-0467. [DOI] [PubMed] [Google Scholar]
  • 6.Fraga MF, Esteller M. Epigenetics and aging: the targets and the marks. Trends Genet. 2007;23:413–8. doi: 10.1016/j.tig.2007.05.008. [DOI] [PubMed] [Google Scholar]
  • 7.Varambally S, Dhanasekaran SM, Zhou M, et al. The polycomb group protein EZH2 is involved in progression of prostate cancer. Nature. 2002;419:624–9. doi: 10.1038/nature01075. [DOI] [PubMed] [Google Scholar]
  • 8.Bruggeman SW, Hulsman D, Tanger E, et al. Bmi1 controls tumor development in an Ink4a/Arf-independent manner in a mouse model for glioma. Cancer Cell. 2007;12:328–41. doi: 10.1016/j.ccr.2007.08.032. [DOI] [PubMed] [Google Scholar]
  • 9.Kondo Y, Shen L, Cheng AS, et al. Gene silencing in cancer by histone H3 lysine 27 trimethylation independent of promoter DNA methylation. Nat Genet. 2008;40:741–50. doi: 10.1038/ng.159. [DOI] [PubMed] [Google Scholar]
  • 10.Bernstein BE, Mikkelsen TS, Xie X, et al. A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell. 2006;125:315–26. doi: 10.1016/j.cell.2006.02.041. [DOI] [PubMed] [Google Scholar]
  • 11.Boyer LA, Plath K, Zeitlinger J, et al. Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature. 2006;441:349–53. doi: 10.1038/nature04733. [DOI] [PubMed] [Google Scholar]
  • 12.Bracken AP, Dietrich N, Pasini D, Hansen KH, Helin K. Genome-wide mapping of Polycomb target genes unravels their roles in cell fate transitions. Genes Dev. 2006;20:1123–36. doi: 10.1101/gad.381706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lee TI, Jenner RG, Boyer LA, et al. Control of developmental regulators by Polycomb in human embryonic stem cells. Cell. 2006;125:301–13. doi: 10.1016/j.cell.2006.02.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Cao R, Wang L, Wang H, et al. Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science. 2002;298:1039–43. doi: 10.1126/science.1076997. [DOI] [PubMed] [Google Scholar]
  • 15.Czermin B, Melfi R, McCabe D, Seitz V, Imhof A, Pirrotta V. Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell. 2002;111:185–96. doi: 10.1016/s0092-8674(02)00975-3. [DOI] [PubMed] [Google Scholar]
  • 16.Cao R, Zhang Y. SUZ12 is required for both the histone methyltransferase activity and the silencing function of the EED-EZH2 complex. Mol Cell. 2004;15:57–67. doi: 10.1016/j.molcel.2004.06.020. [DOI] [PubMed] [Google Scholar]
  • 17.Rauch T, Li H, Wu X, Pfeifer GP. MIRA-assisted microarray analysis, a new technology for the determination of DNA methylation patterns, identifies frequent methylation of homeodomain-containing genes in lung cancer cells. Cancer Res. 2006;66:7939–47. doi: 10.1158/0008-5472.CAN-06-1888. [DOI] [PubMed] [Google Scholar]
  • 18.Ohm JE, McGarvey KM, Yu X, et al. A stem cell-like chromatin pattern may predispose tumor suppressor genes to DNA hypermethylation and heritable silencing. Nat Genet. 2007;39:237–42. doi: 10.1038/ng1972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Rauch T, Wang Z, Zhang X, et al. Homeobox gene methylation in lung cancer studied by genome-wide analysis with a microarray-based methylated CpG island recovery assay. Proc Natl Acad Sci U S A. 2007;104:5527–32. doi: 10.1073/pnas.0701059104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Schlesinger Y, Straussman R, Keshet I, et al. Polycomb-mediated methylation on Lys27 of histone H3 pre-marks genes for de novo methylation in cancer. Nat Genet. 2007;39:232–6. doi: 10.1038/ng1950. [DOI] [PubMed] [Google Scholar]
  • 21.Widschwendter M, Fiegl H, Egle D, et al. Epigenetic stem cell signature in cancer. Nat Genet. 2007;39:157–8. doi: 10.1038/ng1941. [DOI] [PubMed] [Google Scholar]
  • 22.Moss SF, Blaser MJ. Mechanisms of disease: Inflammation and the origins of cancer. Nat Clin Pract Oncol. 2005;2:90–7. doi: 10.1038/ncponc0081. [DOI] [PubMed] [Google Scholar]
  • 23.Aggarwal BB, Shishodia S, Sandur SK, Pandey MK, Sethi G. Inflammation and cancer: how hot is the link? Biochem Pharmacol. 2006;72:1605–21. doi: 10.1016/j.bcp.2006.06.029. [DOI] [PubMed] [Google Scholar]
  • 24.Lu H, Ouyang W, Huang C. Inflammation, a key event in cancer development. Mol Cancer Res. 2006;4:221–33. doi: 10.1158/1541-7786.MCR-05-0261. [DOI] [PubMed] [Google Scholar]
  • 25.Rutter M, Saunders B, Wilkinson K, et al. Severity of inflammation is a risk factor for colorectal neoplasia in ulcerative colitis. Gastroenterology. 2004;126:451–9. doi: 10.1053/j.gastro.2003.11.010. [DOI] [PubMed] [Google Scholar]
  • 26.Dianda L, Hanby AM, Wright NA, Sebesteny A, Hayday AC, Owen MJ. T cell receptor-alpha beta-deficient mice fail to develop colitis in the absence of a microbial environment. Am J Pathol. 1997;150:91–7. [PMC free article] [PubMed] [Google Scholar]
  • 27.Sellon RK, Tonkonogy S, Schultz M, et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 1998;66:5224–31. doi: 10.1128/iai.66.11.5224-5231.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Engle SJ, Ormsby I, Pawlowski S, et al. Elimination of colon cancer in germ-free transforming growth factor beta 1-deficient mice. Cancer Res. 2002;62:6362–6. [PubMed] [Google Scholar]
  • 29.Halliwell B. Oxidative stress and cancer: have we moved forward? Biochem J. 2007;401:1–11. doi: 10.1042/BJ20061131. [DOI] [PubMed] [Google Scholar]
  • 30.Henderson JP, Byun J, Williams MV, Mueller DM, McCormick ML, Heinecke JW. Production of brominating intermediates by myeloperoxidase. A transhalogenation pathway for generating mutagenic nucleobases during inflammation. J Biol Chem. 2001;276:7867–75. doi: 10.1074/jbc.M005379200. [DOI] [PubMed] [Google Scholar]
  • 31.Evans MD, Dizdaroglu M, Cooke MS. Oxidative DNA damage and disease: induction, repair and significance. Mutat Res. 2004;567:1–61. doi: 10.1016/j.mrrev.2003.11.001. [DOI] [PubMed] [Google Scholar]
  • 32.Kawai Y, Morinaga H, Kondo H, et al. Endogenous formation of novel halogenated 2′-deoxycytidine. Hypohalous acid-mediated DNA modification at the site of inflammation. J Biol Chem. 2004;279:51241–9. doi: 10.1074/jbc.M408210200. [DOI] [PubMed] [Google Scholar]
  • 33.Valinluck V, Sowers LC. Inflammation-mediated cytosine damage: a mechanistic link between inflammation and the epigenetic alterations in human cancers. Cancer Res. 2007;67:5583–6. doi: 10.1158/0008-5472.CAN-07-0846. [DOI] [PubMed] [Google Scholar]
  • 34.Valinluck V, Sowers LC. Endogenous cytosine damage products alter the site selectivity of human DNA maintenance methyltransferase DNMT1. Cancer Res. 2007;67:946–50. doi: 10.1158/0008-5472.CAN-06-3123. [DOI] [PubMed] [Google Scholar]
  • 35.Esworthy RS, Aranda R, Martin MG, Doroshow JH, Binder SW, Chu FF. Mice with combined disruption of Gpx1 and Gpx2 genes have colitis. Am J Physiol Gastrointest Liver Physiol. 2001;281:G848–55. doi: 10.1152/ajpgi.2001.281.3.G848. [DOI] [PubMed] [Google Scholar]
  • 36.Chu FF, Esworthy RS, Chu PG, et al. Bacteria-induced intestinal cancer in mice with disrupted Gpx1 and Gpx2 genes. Cancer Res. 2004;64:962–8. doi: 10.1158/0008-5472.can-03-2272. [DOI] [PubMed] [Google Scholar]
  • 37.Lee DH, Esworthy RS, Chu C, Pfeifer GP, Chu FF. Mutation accumulation in the intestine and colon of mice deficient in two intracellular glutathione peroxidases. Cancer Res. 2006;66:9845–51. doi: 10.1158/0008-5472.CAN-06-0732. [DOI] [PubMed] [Google Scholar]
  • 38.Esworthy RS, Swiderek KM, Ho YS, Chu FF. Selenium-dependent glutathione peroxidase-GI is a major glutathione peroxidase activity in the mucosal epithelium of rodent intestine. Biochim Biophys Acta. 1998;1381:213–26. doi: 10.1016/s0304-4165(98)00032-4. [DOI] [PubMed] [Google Scholar]
  • 39.Rauch T, Pfeifer GP. Methylated-CpG island recovery assay: a new technique for the rapid detection of methylated-CpG islands in cancer. Lab Invest. 2005;85:1172–80. doi: 10.1038/labinvest.3700311. [DOI] [PubMed] [Google Scholar]
  • 40.Rauch TA, Zhong X, Wu X, et al. High-resolution mapping of DNA hypermethylation and hypomethylation in lung cancer. Proc Natl Acad Sci U S A. 2008;105:252–7. doi: 10.1073/pnas.0710735105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997;25:2532–4. doi: 10.1093/nar/25.12.2532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Han L, Lee DH, Szabo PE. CTCF is the master organizer of domain-wide allele-specific chromatin at the H19/Igf2 imprinted region. Mol Cell Biol. 2008;28:1124–35. doi: 10.1128/MCB.01361-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Frigola J, Munoz M, Clark SJ, Moreno V, Capella G, Peinado MA. Hypermethylation of the prostacyclin synthase (PTGIS) promoter is a frequent event in colorectal cancer and associated with aneuploidy. Oncogene. 2005;24:7320–6. doi: 10.1038/sj.onc.1208883. [DOI] [PubMed] [Google Scholar]
  • 44.Taniguchi H, Yamamoto H, Akutsu N, et al. Transcriptional silencing of hedgehog-interacting protein by CpG hypermethylation and chromatic structure in human gastrointestinal cancer. J Pathol. 2007;213:131–9. doi: 10.1002/path.2216. [DOI] [PubMed] [Google Scholar]
  • 45.Zhang W, Glockner SC, Guo M, et al. Epigenetic inactivation of the canonical Wnt antagonist SRY-box containing gene 17 in colorectal cancer. Cancer Res. 2008;68:2764–72. doi: 10.1158/0008-5472.CAN-07-6349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Issa JP, Ahuja N, Toyota M, Bronner MP, Brentnall TA. Accelerated age-related CpG island methylation in ulcerative colitis. Cancer Res. 2001;61:3573–7. [PubMed] [Google Scholar]
  • 47.Kang GH, Lee HJ, Hwang KS, Lee S, Kim JH, Kim JS. Aberrant CpG island hypermethylation of chronic gastritis, in relation to aging, gender, intestinal metaplasia, and chronic inflammation. Am J Pathol. 2003;163:1551–6. doi: 10.1016/S0002-9440(10)63511-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Maekita T, Nakazawa K, Mihara M, et al. High levels of aberrant DNA methylation in Helicobacter pylori-infected gastric mucosae and its possible association with gastric cancer risk. Clin Cancer Res. 2006;12:989–95. doi: 10.1158/1078-0432.CCR-05-2096. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Suppl data

RESOURCES