Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Jul 5.
Published in final edited form as: Virology. 2008 May 2;376(2):397–407. doi: 10.1016/j.virol.2008.03.027

Intragenotypic JFH1 based recombinant hepatitis C virus produces high levels of infectious particles but causes increased cell death

Guaniri Mateu 1, Ruben O Donis 2, Takaji Wakita 3, Jens Bukh 4,5,6, Arash Grakoui 1,*
PMCID: PMC2492671  NIHMSID: NIHMS55423  PMID: 18455749

Abstract

The full-length hepatitis C virus (HCV) JFH1 genome (genotype 2a) produces moderate titers of infectious particles in cell culture but the optimal determinants required for virion production are unclear. It has been shown that intragenotypic recombinants encoding core to NS2 from J6CF in the context of JFH1 are more robust in the release of viral particles. To understand the contributions of structural and nonstructural genes to HCV replication potential and infectivity, we have characterized intragenotypic recombinant genotype 2a viruses with different portions of the J6 isolate engineered into the JFH1 infectious clone. All genomes produced high levels of intracellular HCV RNA and NS3 protein in Huh-7.5 transfected cells. However, JFH1 genomes containing J6 sequences from C to E2 (CE2) or C to p7 (Cp7) secreted up to 100-fold more infectious HCV particles than the parental JFH1 clone. Subsequent infection of naïve Huh-7.5 cells with each of the J6/JFH1 recombinants at a multiplicity of infection of 0.0003 resulted in high viral titers only for CE2 and Cp7 viruses. Comparison of virion production by the Cp7 J6/JFH1 recombinant to previously described J6/JFH1 recombinants showed flexibility of the chimeric junction. Moreover, NTRNS2 a chimeric virus equivalent to the previously reported FL-J6/JFH chimera, showed a 10- fold enhancement of virus titers compared to CNS2. NTRNS2 differs from CNS2 by three nucleotide differences residing in the 5’NTR and core coding sequence and all three nucleotide changes were necessary for increased virion production. Importantly, cells producing Cp7 virus showed increased apoptosis compared with JFH1, an effect correlating with virion production. These studies begin to unravel requirements for robust virus replication and the relationship between increased virion production and host cell viability.

Keywords: Hepatitis C virus, intragenotypic recombinant, JFH, cell death

Introduction

Hepatitis C virus (HCV) infection currently affects approximately 170 million people worldwide and is resolved by only a minority of patients (1999; Wasley and Alter, 2000). The chronic viral infection frequently progresses to end-stage liver disease, cirrhosis and in some cases, to development of hepatocellular carcinoma (Alter et al., 1999; Alter et al., 1992). There is no therapeutic or prophylactic vaccine available for HCV and the only effective antiviral therapy, interferon and ribavirin, produces sustained viral clearance in less than 50% of treated patients (Reichard, Schvarcz, and Weiland, 1997).

A noteworthy characteristic of the HCV genome, a plus-strand RNA of ~9.6 kb, is its genetic diversity (Lindenbach and Rice, 2005; Moradpour, Penin, and Rice, 2007). HCV isolates have been classified into six major genotypes (from 1–6) and multiple subtypes (a,b,c, etc.). In infected individuals, HCV exists as quasispecies of closely related genomes (Bukh, Miller, and Purcell, 1995). A number of studies have suggested that the outcome of HCV infection as well as the response to interferon treatment depends on the genotype or quasispecies with which the patient is infected. However, it is not clear how subtle differences in the HCV genome affect viral replication, infectivity and host response (Sakai et al., 2007).

Until recently, the only available system to study the replication cycle of HCV was the subgenomic replicons that were adapted for efficient RNA replication in vitro (Blight, Kolykhalov, and Rice, 2000; Lohmann et al., 1999). However, full-length genomes containing cell culture-adaptive mutations did not produce infectious virus particles in culture and were severely attenuated in vivo (Bukh et al., 2002). These observations led to the hypothesis that mutations that enhance RNA replication may have deleterious effects on virion production. In 2003, Kato and coworkers reported that a subgenomic replicon derived from JFH1 cDNA did not require adaptive mutations for efficient replication in cell culture (Kato et al., 2003a). JFH1 is an HCV isolate of genotype 2a (GT2a) obtained from a patient with fulminant hepatitis (Kato et al., 2001). For reasons that are still not understood, the full-length JFH1 genome has been shown to produce moderate titers of infectious particles in cell culture (Wakita et al., 2005).

We sought to exploit the use of synthetic chimeric viruses to map the functional regions of HCV using viruses with different phenotypes. The infectious clone pJ6CF encodes the consensus polyprotein of HCV strain HC-J6 (CH) that belongs to genotype 2a, as does JFH1, but J6 does not replicate in the hepatoma cell line Huh-7.5 (Yanagi et al., 1999). Chimeric clones have recently been reported in which the structural region, p7, and NS2 of the JFH1 genome has been replaced with the analogous region from clones with the same or different genotypes (Gottwein et al., 2007; Lindenbach et al., 2005; Pietschmann et al., 2006; Yi et al., 2007). Intragenotypic chimeric viruses in which the structural region, p7 and a portion of NS2 from HCV JFH1 was replaced with the corresponding region from the infectious clone pJ6CF derived from the HCV strain HC-J6(CH), exhibited enhanced RNA replication and also secretes more infectious virus (Pietschmann et al., 2006). This indicated that the structural region, p7 or NS2 might influence the efficiency of HCV replication and virus production. Despite multiple efforts (Lindenbach et al., 2005; Pietschmann et al., 2006), it is still not known which regions of the JFH1 genome play a role in its ability to facilitate viral particle secretion, although a recent report found that the JFH1 protease and polymerase are essential for replication of J6/JFH1 recombinants (Murayama et al., 2007). Recently, it was also shown that specific nucleotide changes in the structural region of JFH1 increased virion production (Delgrange et al., 2007). The present work describes the generation of chimeric JFH1 based viruses, with structural and non-structural genes from the HCV strain J6, to optimize virion production. The intragenotypic J6/JFH1 viruses were compared in terms of intracellular replication and infectious virus production and we report here a chimeric virus that robustly produces infectious virus while simultaneously slowing the growth and increasing the number of apoptotic Huh-7.5 transfected cells.

Results

Construction of intragenotypic J6/JFH1 recombinants

Our goal was to better understand the relative contribution of the HCV genome structural and non-structural regions in replication and virion production. Specifically, we studied the effects of exchanging intragenotypic E2, p7, NS2 and NS3 proteins on viral replication and infectivity. To this end, four intragenotypic recombinants were generated in which sequences from the core to part of the protease domain of NS3 protein of the JFH1 clone were replaced with the analogous region derived from HCV J6, also genotype 2a (Yanagi et al., 1999) (Figure 1A). These recombinants, designated CE2, Cp7, CNS2 and CNS3 comprise J6 genes from core (from amino acid #33) to the C terminal end of E2, p7, NS2, respectively, or to the N-terminal portion of NS3 (including amino acid #79 of NS3). These J6/JFH1 recombinants allowed us to examine the relative contribution of each protein to replication and virus production.

Figure 1.

Figure 1

Open in a new tab

Replication and protein production of chimeric J6/JFH1 virus. (A) Organization of full-length HCV constructs. Four J6/JFH1 infectious clones were developed by swapping regions from Core to either E2, p7, NS2 or NS3 of the JFH1 genome with the corresponding region of the J6 strain genome to create CE2, Cp7, CNS2 and CNS3recombinants, respectively. HCV J6 strain sequences are represented in gray while JFH1 sequences are in white. Ten micrograms of in vitro transcribed RNA were electroporated into 8 × 104 Huh-7.5 cells (B) Intracellular protein production as measured by Western blot analysis. Detection of HCV NS3 antigen in transfected Huh-7.5 cells by Western blot analysis. Cell lysates were prepared and viral and cellular proteins were detected using anti-NS3 monoclonal antibody and anti- β-actin at days 2,5,7,14 and 35 post-transfection. (C) Short term and (D) long term kinetics of chimeric infectious virus particle release in the supernatant (Log10 TCID50/ml). The data shown in Figure 1C is a collection of three independent transfections with standard error of mean and 1D is a representative of three independent experiments. Supernatants were harvested at the indicated time points, serially diluted 10-fold and used to inoculate naïve Huh-7.5 cells. The viral titers were determined 3 days post infection by immunohistochemistry using monoclonal anti NS5A antibody by calculating tissue culture infection dose at which 50% of the wells were positive for viral antigen. (E) Kinetics of recombinant chimeric virus infection in naïve Huh-7.5 cells. Naïve Huh-7.5 cells were inoculated at an m.o.i of 3× 10−4 with supernatants of day 3 post-transfection. Infectious virus in the supernatants (Log10 TCID50/ml) was determined by IHC using anti-NS5A monoclonal antibody at the indicated time points. CNS2, CNS3, GND and JFH showed no infectivity with symbols all overlapping. The data shown in Figure 1E is a collection of four independent infections with standard error of mean.

Replication of intragenotypic J6/JFH1 HCV chimeras

In vitro transcribed RNAs were transfected into Huh-7.5 cells, which are highly permissive for HCV replication (Blight, Kolykhalov, and Rice, 2000). The wild type JFH1 genome and the replication defective mutant genome GND served as positive and negative controls, respectively (Wakita et al., 2005). Replication was monitored at multiple time points after transfection by examining viral protein expression using western blotting for NS3. As shown in figure 1B, JFH1 and each of the J6/JFH1 genomes expressed NS3 except, as expected, GND. As observed in figure 1B all chimeras showed similar viral protein levels at the days 2 and 5 post-transfection, but by day 7 levels of NS3 increased while host cell protein β-actin levels decreased in cells transfected with CE2 and Cp7 clones.

Production of J6/JFH1 chimeric infectious virus

The contribution of the HCV structural proteins to virus assembly and egress is measured by the efficiency of secretion of infectious viral particles. A comparative short and long term quantitative and kinetic analysis of infectious particles released in the supernatant was performed. Viral titers were determined by 50% tissue culture infectivity dose (TCID50) at the indicated time points after transfection. The amount of infectious virus released varied among the different J6/JFH1 recombinants when analyzed for 96 hours post-transfection (Figure 1C). Chimeric viruses Cp7 (4.6 Log TCID50/ml) and CE2 (4.2 Log TCID50/ml) showed a 100-fold increase in the amount of infectious virus released in the supernatant when compared to the wild-type JFH1 (1.8 Log TCID50/ml). Our results confirm the observation that NS2 is important for virus production and release, since the only difference between the Cp7 and CNS2 is that in the Cp7 virus NS2 belongs to the parental JFH1 genome. Moreover, these data show that for each intragenotypic recombinant, J6 structural sequences increase virus release compared to the parental JFH1 clone and that, similar to Pietschmann et al. (Pietschmann et al., 2006), virus production can be increased substantially by fusing the pJ6CF structural sequences at or close to the p7-NS2 cleavage site.

Temporal analysis of infectious virion production revealed a decrease in viral titers for each chimera over time (Figure 1D). For each recombinant, virus production peaked between day 2 and 5 post-transfection with LogTCID50/mL values of 4.8 for CNS2 and Cp7, 4.5 for CE2, 3.8 for CNS3, and 2.8 for JFH1. JFH1 viral titers decreased rapidly, and were undetectable by day 21. Although the reduction in the level of secreted virus was delayed for CNS2 and CNS3, by day 35 post-transfection no infectious viral particles could be detected in the supernatants of cells transfected with these chimeras. At later time points (day 77) only Cp7 could be detected in the supernatants of Huh-7.5 transfected cells (data not shown).

CE2 and Cp7 recombinant J6/JFH1 viruses are more infectious in vitro

Naïve Huh-7.5 cells were infected with the supernatants of cells transfected with the different chimeras to investigate if there were differences in the infectivity of the secreted virus particles. Supernatants of cells transfected with JFH1, GND and the different J6/JFH1 constructs were harvested on day 3 post-transfection. After determining the viral titers, naïve Huh-7.5 cells were infected with recombinant virus at a multiplicity of infection (m.o.i.) of 3 × 10−4. This m.o.i was chosen to normalize initial infection to JFH1 that showed a maximum viral titer of 2.8 Log TCID50/ml. At the indicated time points following infection, supernatants were collected for viral titer determination (Figure 1E). Importantly, viral infectivity determined in four independent low m.o.i inoculations and measured by TCID50/ml was only evident from the CE2 and Cp7 viruses (Figure 1E), with both establishing a robust infection yielding viral titers of 104-105 TCID50 /ml of culture supernatant.

Comparison of infectivity and flexibility of chimeric junctions

Three intragenotypic chimeric viruses expressing the structural region of the pJ6CF clone in the context of JFH1 have been previously described (Lindenbach et al., 2005; Pietschmann et al., 2006). Chimeric virus FL-J6/JFH (Lindenbach et al., 2005) contains part of the 5’ NTR region, core, E1, E2, p7 and NS2 from the pJ6CF clone in the context of the JFH1 genome. For comparison with Cp7 virus, the most efficient of our J6/JFH1 viruses, we constructed an equivalent chimeric virus, NTRNS2. We also constructed a chimeric virus CNS2C3 in which core through the first transmembrane domain of NS2 from JFH1 were replaced by the corresponding region from J6CF. This construct is similar to the J6/C3, and a third construct CNS2 is similar to the construct J6/C6. Both J6/C3 and J6/C6 were previously reported to be more efficient than JFH1 (Pietschmann et al., 2006). The kinetics of the release of infectious virus by the chimeric viruses Cp7, CNS2, CNS2C3 and NTRNS2, representing all of the intragenotypic chimeras containing the structural genes of J6 reported to date, were compared (Figure 2A). Supernatants of transfected cells were collected daily for four days and the infectious virus was quantified. As shown in figure 2B, the amount of infectious virus secreted in the supernatant of Huh-7.5 cells electroporated with the chimeric RNA transcripts is similar after 24 hours post transfection, but after 96 hours Cp7 and CNS2C3 are most robustly producing virus. The high titer produced early by Cp7, CNS2C3 and NTRNS2 chimeric viruses indicates that initial infectivity of the chimeric viruses allows some flexibility in the cross over point between pJ6CF and JFH1. In agreement with the results reported by Pietschmann et al. (Pietschmann et al., 2006) CNS2 virus yields were approximately 10-fold lower than CNS2C3 at 72 hours post-transfection. This difference became more pronounced (~100-fold) at 96 hours post-transfection.

Figure 2.

Figure 2

Open in a new tab

Virion production by different chimeric constructs. (A) Constructs that are equivalent to the previously reported NTRNS2 and CNS2C3 are shown. (B) In order to compare their ability to produce infectious virions, we collected the supernatants and quantified infectivity by IHC assay (Log10 TCID50/ml). Significant differences were observed in levels of infectious virus produced by NTRNS2 and CNS2 96 hours post transfection (p<0.05). The data shown in Figure 2B is a collection of at least a minimum of three independent transfections with standard error of mean.

Single mutations in the capsid coding sequence do not affect infectious particles production

Surprisingly, NTRNS2, which is equivalent to FL-J6/JFH reported by Lindenbach et al. (Lindenbach et al., 2005), showed differences after two days post transfection in terms of virion production when compared to CNS2. The differences in sequence between CNS2 and NTRNS2 comprise one nucleotide in the 5’ NTR (C301U) and two in the core region: G398C results in an amino acid change (E20Q) whereas C412U does not lead to an amino acid change (Figure 3A). Residue Q20 is present in J6 (genotype 2a) as well as in other strains of genotype 1a, 1b, 2f and 2e. Nucleotide position 301 in the 5’ NTR is in domain IIIe of the IRES element of HCV and has been reported to interact with the 40S ribosomal subunit (Spahn et al., 2001) while the other two changes fall in a loop of secondary structure from nucleotide 387 to 424 (McMullan et al., 2007). Both generate changes in the amino acid sequence of the alternative reading frame (ARF) that results from a +1 frameshift (Baril and Brakier-Gingras, 2005). The changes in the ARF are G398C (H →Q) and C412U (S→F). In terms of RNA secondary structure, change G398C is located in a bulge in stem loop V (SLV) and the change C412U disrupts a C-G base pair interaction on SLV (Tuplin et al., 2002) (Figure 3A). Since it has been previously reported that specific mutations in JFH1 core protein are essential for infectious virus production (Delgrange et al., 2007; Murray et al., 2007), we decided to assess the contribution of these three mutations on initial translation, subsequent replication capacity and virion production. To define the mechanism responsible for the observed difference between CNS2 and NTRNS2 we developed 3 bicistronic genomes (Figure 3B) in which the 5’UTR and the first 33 amino acids of core protein are fused with Gaussia luciferase protein (Gluc). In these bicistronic constructs, Gluc is translated from the HCV IRES while in the second cistron, the EMCV IRES initiates the translation of the HCV polyprotein (on the highly efficient Cp7 backbone) at the N-terminus of core. This strategy allows the study of the HCV IRES efficiency independent of replication by determining RLU activity at early time points (Gluc will be generated via translation of the input RNA and subsequently detected and measured in the supernatant) and replication capacity of the genomes by assessing RLU at later time points (replication of the input RNA will continue to generate more Gluc thus leading to an increase as compared to the replication defective GND control). As shown in figure 3C, there were no differences in translation efficiencies between CNS2/Gluc/Cp7, NTRNS2/Gluc/Cp7 and the negative control NTR/NS2/Gluc/GND. In terms of replication, both constructs were able to replicate above the levels of the replication defective clone GND (Figure 3D). To further investigate the effects of these mutations on virion production, we introduced the three individual mutations in the context of the CNS2 monocistronic parental genome. Despite the fact that there were significant differences between CNS2 and NTRNS2 (p<0.05), there were not significant differences in terms of virion production 96 hours post transfection between the three mutants or the parental CNS2 and NTRNS2 parental clones (Figure 3E).

Figure 3.

Figure 3

Open in a new tab

Single mutations in the capsid coding sequence do not affect infectious particles production. (A) Three nucleotide differences between CNS2 and NTRNS2 J6/JFH1 viruses are shown. The first nucleotide difference is in the IRES element of the 5’NTR region (C301U). In CNS2 there is a G-C pair in the stem loop III (SLIII) while in NTRNS2 there is a disruption of this base pairing. The other two differences are in the core protein both in the stem loop V (SLV): G398C results in an amino acid change (E20Q) whereas C412U does not result in amino acid change but causes disruption of the Watson-Crick base-pairing. (B) A schematic representation of the full-length bicistronic Gluc reporter plasmids used to analyze the effect of the mutations. The plasmids contain Gluc under the control of the HCV IRES and the Cp7 HCV chimeric genome downstream of EMCV IRES. Bicistronic genomes with mutations in the IRES and core sequence are indicated. (C) Translation and (D) replication of the bicistronic reporter viruses was assessed by transfection of Huh-7.5 cells with 10 µg of in vitro RNA transcribed biscistronic genomes. Supernatants were harvested and assayed by luciferase activity in triplicates (labeled as Log10 Relative Luciferase Units, RLU) at the indicated time points post electroporation. The levels of Gaussia luciferase secreted during the first 8 hours post transfection are due to translation of the input RNA while the amounts produced 24–96 hours post transfection are due to replication of the full-length bicistronic Gluc reporter RNA. (E) Modifications in the 5’ UTR and core coding sequence were engineered in the context of the CNS2 parental virus to compare their capacity to produce infectious virions. Supernatants were harvested and virus quantified infectivity by IHC assay (Log10 TCID50/ml) at the indicated time points. The data shown in Figure 3E is a collection of seven independent transfections with standard error of mean. Amounts of secreted virus in cells transfected with NTRNS2 were significantly higher than CNS2 (asterisks indicate p<0.05) 24, 48 and 96 hours post transfection.

Recombinant Cp7 J6/JFH1 virus affects cell division of transfected Huh-7.5 cells

We observed that Huh-7.5 cells transfected with RNA of the Cp7 construct consistently grew slower as compared to cells transfected with JFH or GND. Since Cp7 produced higher viral titers compared with JFH1, we sought to further characterize the effect on host cell growth. Uninfected Huh-7.5 cells were electroporated with in vitro transcribed RNA from JFH1, Cp7 and GND. Measurement of attached cell numbers revealed reduced numbers of cells over time in cultures transfected with Cp7 as compared to those transfected with JFH1 or GND (Figure 4A). To determine whether this difference was secondary to reduced cell division or increased cell death, cells were stained seventy-two hours after transfection with carboxyfluorescein succinimidyl ester (CFSE), which is partitioned equally among daughter cells with each cell division. At the indicated time points, cells were analyzed by flow cytometry. By day 8, cells transfected with Cp7 showed a significantly slower rate of cell division (MFI 595) when compared to those transfected with JFH1 (MFI 172) and GND (MFI 186) (Figure 4B). These differences remained significant until day 18 after electroporation (Figure 4C). High intracellular viral replication and virion release may play an important role in the reduced cellular division of Cp7 transfected cells. To confirm that infectious virus was being secreted, viral titers were assessed at the indicated time points. More infectious virus was secreted at day 8 in cells transfected with Cp7 (4.1 Log TCID50/ml) when compared to JFH1 (1.8 Log TCID50/ml). By day 18, there was a 1.5 log lower titer of virus released by cells transfected with JFH1 as compared to Cp7 (Figure 4D).

Figure 4.

Figure 4

Open in a new tab

Recombinant virus Cp7 reduces proliferation of Huh-7.5 cells. Cells were electroporated with in vitro transcribed RNA of JFH, Cp7 and GND and were trypsinized and counted at the indicated time points (A). Cells were CFSE labeled two days post transfection. At days 3, 8 and day 18 post transfection cells were trypsinized and analyzed by FACS. The columns and bars represent means and standard deviation of four independent transfections. B) Recombinant virus Cp7 retards proliferation of transfected Huh-7.5 cells as demonstrated by the slower rate CFSE dilution. The numbers in each histogram represent the mean fluorescence intensity (MFI) of the cells at the indicated time points. After one division the MFI decreases geometrically by a factor of two and appears as uniformly spaced clusters on a log scale. (C) MFI of cells transfected with JFH1, Cp7 and GND. Data shown are representative of four separate experiments. (D) Time course of infectious JFH, Cp7 and GND virus released into supernatant (Log10 TCID50/ml) of RNA transfected and CFSE labeled Huh-7.5 cells. (E) Cp7 induces apoptosis in Huh-7.5 cells as indicated by the increase in the percentage of Annexin-V positive cells. Huh-7.5 transfected with JFH1, Cp7 and GND were trypsinized and stained with Annexin V-APC at days 3, 8 and 18. By day 3 there was a significant increase in the percentage of apoptosis in cells transfected with JFH and Cp7 compared to cells transfected with the GND negative control (p<0.005). At day 8 and 18, Cp7 transfected cells showed significant higher percentage of apoptotic cells when compared to the parental JFH1 and the GND control (p<0.005 and p<0.05, respectively). The columns and bars represent means and standard deviation of five independent transfections.

Cp7 replication induces apoptosis in Huh-7.5 cells

The diminution in cell division could be secondary to virus induced cell cycle arrest or apoptosis. The cells transfected with JFH, Cp7 and GND were stained with Annexin-V at days 3, 8 and 18 after electroporation. As shown in figure 4E, JFH and Cp7 transfected cells appeared to be undergoing apoptosis as indicated by Annexin V staining at day 3 (11.8% and 16.98% respectively) and day 8 (6.42% and 12.91%, respectively) post transfection. By day 18 only Cp7 transfected cells showed increased percentage of apoptotic cells (4.20%) compared to the background percentage of apoptosis in control GND (1.73%) transfected Huh-7.5 cells. Since the presence of hypodiploid nuclei is an indicator of apoptosis, we additionally used Flow cytometric analysis of propidium iodide stained cells and demonstrated that JFH, Cp7 or GND transfected cells were not arrested in a particular phase of cell cycle (data not shown). However we observed that the percentage of hypodiploid cells increased from 7% to almost 20% at day 8 in Cp7 while remaining unchanged for JFH1 and GND transfected cells (data not shown).

Discussion

In this study we described intragenotypic JFH1-based recombinants capable of assembling and releasing infectious viral particles with greater efficiency than the parental JFH1 genome. Through comparison of the known intragenotypic recombinants reported to date, our results confirm previous observations that intragenotypic J6/JFH recombinants including CNS2 of J6 efficiently produce virus (Gottwein et al., 2007; Pietschmann et al., 2006; Yi et al., 2007) but importantly, extend these observations to include more efficient genomes that include only CE2 or Cp7 of J6 and demonstrate decreased cell viability under conditions of high virus production. It is interesting to note that in the study described here, the intracellular accumulation of the NS3 protein (Figure 1B) was notably greater during the first 14 days after transfection of cells with chimeric CE2 and Cp7, the two constructs that produced the highest levels of infectious virus (Figure 1C and 1D), compared to the other chimeras. A recent study by Yi et al. suggests that the intracellular accumulation of core protein correlates closely with virus production (Yi et al., 2007). Although pulse chase studies are required to assess stability of the viral proteins, the authors speculated that the core protein might be stabilized by being packaged into nascent viral particles (Yi et al., 2007).

In our studies of virus release, CE2 and Cp7 robustly secrete infectious virus into the supernatants, followed by CNS2 and CNS3 with similar infectious release kinetics and by JFH1, for which titers are as low as 2 LogTCID50/ml (Figure 1C and D). Structural sequences from J6CF increased the efficiency of viral production, as reported by Pietschmann et al. (Pietschmann et al., 2006), indicating that J6 proteins may have a fundamentally better potential for virion assembly and release. As deduced from these results, when NS2 is derived from the same isolate as the nonstructural proteins, the ability to secrete infectious virus into the supernatants is enhanced. Recent studies have additionally reported that when the C-terminal portion of the NS2 is derived from the JFH1 sequence, it is more efficient in producing infectious particles (Pietschmann et al., 2006; Yi et al., 2007). Consistent with replacing JFH1 sequence with J6 sequence, studies of limited mutations in the structural proteins of JFH1 have shown that they actually improve virus production (Delgrange et al., 2007). Furthermore, intergenotypic recombinants acquire compensatory mutations in p7, NS2, NS3, and NS5A that appear to facilitate the release of infectious viral particles (Gottwein et al., 2007; Yi et al., 2007).

In our study, long term kinetic analysis of viral particle release showed a reduction of viral titers with time (Figure 1D). This reduction may be due to the selection of cells resistant to HCV infection that might have been present in the Huh-7.5 cell line or that emerge during the HCV infection due to the reduction of CD81 expression (Koutsoudakis et al., 2007; Morikawa et al., 2007; Tscherne et al., 2007). Indeed, this phenomenon has previously been observed in Huh-7.5 cells transfected with JFH1 in which levels of secreted virus varied and intracellular HCV RNA levels fluctuated for at least 6 months (Zhong et al., 2006). An important observation is that Cp7 infected cells continued secreting virus during the course of the experiment whereas the levels decreased in Cp7 transfected cells. One possible explanation is that the appearance of resistant cells is perhaps delayed, in cells infected compared to those transfected, since levels of secreted virus peaked at day 7 post-infection whereas the same viral titers (4.5 LogTCID50/ml for Cp7 and 3.5 LogTCID50/ml for CE2) are reached at day 2 in transfected cells (Figure 1C and 1E). At low m.o.i., only infectivity of CE2 and Cp7 could be recovered confirming the observation that these viruses are more infectious when compared to the other J6/JFH1 chimeras (Figure 1E). The lack of viral particles released into the supernatants of cells infected with JFH1, CNS2 and CNS3 viruses may be attributed to the conditions of the infection. At very low m.o.i., necessitated by the low titer JFH1, (0.0003 TCID50/cell) levels of replication may not be sufficient to produce detectable levels of infectious virus in Huh-7.5 cells and active infection of naïve cells is consequently not maintained.

Others have reported the propagation and passage of JFH1 without loss of infectivity in Huh-7.5.1 cells (Zhong et al., 2005; Zhong et al., 2006). Zhong et al. reported that JFH1 produced high infectivity titers (105-106 ffu/ml) within a few days after infection of naïve Huh-7.5.1 at an m.o.i 0.002 (Zhong et al., 2005) and 0.01 (Zhong et al., 2006). Since Huh-7.5.1 cells were derived from the Huh-7.5 GFP-HCV replicon cell line I/5A-GFP6 (Moradpour et al., 2004) and were cured with IFN-γ to eliminate the replicon (Zhong et al., 2005), it is possible that Huh-7.5.1 are more amenable to infection with HCV than Huh-7.5 cells. It is however more likely that the high titers were achieved with passaged virus that contained adaptive mutations rather than unmodified JFH1 from transfection supernatant.

The lack of viral particle production from CNS2 infected cells (Figure 1E) suggests that replacement of JFH NS2 with J6CF sequences is detrimental for virus production at low multiplicity of infection. Previous reports suggest that the most appropriate crossover site in terms of better infectivity is at the transmembrane domain-1 (TMD1) of NS2 (Pietschmann et al., 2006). When we compared J6/C3 (crossover site right after the first TMD of NS2) to Cp7 we did not observe a significant difference between Cp7, CNS2C3 and NTRNS2. In agreement with the results reported by Pietschmann et al. (Pietschmann et al., 2006), our data show that there is flexibility in the optimal junction for the construction of chimeric HCV genomes in terms of replication efficiency and virus production.

Studies of the 5’ NTR are complicated since the region is known to contain both translation and replication elements (McMullan et al., 2007; Reusken et al., 2003). Recent studies suggest that numerous residues in the core protein are essential for infectious virion production (Murray et al., 2007) possibly due to modulation of host cellular functions. In addition, more robust production of HCV particles can be obtained by introducing a few specific mutations in the core coding sequence of JFH1 (Delgrange et al., 2007). We have performed a comprehensive analysis of the effects on translation and replication of these changes in the core protein in the context of an infectious J6/JFH1 bicistronic reporter virus and subsequently analyzed their impact on virion production by engineering these changes in a monocistronic chimeric virus.

Measuring Gluc activity over time allowed us to assess differences in translation and replication efficiency determined by the three positions that distinguish CNS2 and NTRNS2 (Figure 3C and D). Since there were no significant differences in translation and replication efficiency between CNS2 and NTRNS2, it is possible that these three mutations may affect packaging and release of viral particles leading to an increase in virion production. Although amino acids 15–28 have been reported to be dispensable for HCV-like particle assembly and morphogenesis (Hourioux et al., 2007), other studies have shown that mutations in the core region might alter RNA packaging, recruitment of nonstructural proteins and replication complexes to lipid droplets, virion assembly and morphogenesis (Boulant, Targett-Adams, and McLauchlan, 2007; Kim, Ha, and Park, 2006; Miyanari et al., 2007; Rodriguez-Casado, Molina, and Carmona, 2007) which are critical for the production of infectious virus. We observed a consistent two fold increase in replication levels in NTRNS2 when compared with CNS2, although this difference in replication is not observable in logarithmic scale (Figure 3D). However, it is possible that slight differences in replication can cause a 10-fold increase in virion production.

When single mutations were engineered in the context of the CNS2 backbone, they did not recapitulate the increased virion production observed for the NTRNS2 clone (Figure 3E). One possibility is that the combination of mutations is necessary to observe differences in virus production. Core contains conserved RNA structures involved in replication as well as a conserved alternative open reading frame (ARFP) important for HCV replication in vivo and in vitro (McMullan et al., 2007). The C-terminal portion has been implicated in the processing of the core protein from its immature form to the mature form necessary for particle formation (Kato et al., 2003b). Consistent with these data, a recent study by Delgrange et al. showed that two changes in the carboxy terminal region of JFH1 core, implicated in processing core to its mature form, could improve infectious virus production (Delgrange et al., 2007). The authors proposed that these mutations lead to an increase in immature capsid protein (p23) that may be a necessary component for virion production. Interestingly, the E20Q amino acid mutation described in our study (Figure 3A), in addition to two other mutations described by Kato et al have been identified as important residues conferring increase in p23 levels thus potentially leading to efficient JFH1 particle formation (Kato et al., 2003b).

Interestingly, we observed that the number of Cp7 transfected cells did not increase with the same rate as JFH1 or GND transfected cells (Figure 4A). To assess if these differences were due to cell death or retardation in cell growth we performed CFSE staining of cells. CFSE staining showed a reduction of cell proliferation in cells transfected with Cp7 (Figure 4B and C). We couldn’t attribute this phenomenon to cell cycle arrest at any of distinct phases in cell cycle, but we observed an increased percentage of apoptosis in cells transfected with JFH1 and Cp7 compared to cells transfected with the GND control (Figure 4E).

Growth rate was greatly reduced when secreted levels of infectious virus peaked (Figure 4D). Once the Cp7 extracellular infectious virus levels declined, approximately four weeks post-transfection (Figure 1D), the effect in cell growth retardation was no longer observed (data not shown). We hypothesize that Cp7 transfected cells grew slower and underwent apoptosis (Figure 4E) because high amounts of virus were secreted. After three weeks, HCV resistant cells or cells that did not secrete high amounts of virus emerged, reducing the levels of secreted virus and allowing increased cell growth. The appearance of HCV resistant cells after infection with JFH1 virus has been previously described and it has been shown to be due to the loss or diminution of CD81 expression in Huh-7.5 and Huh 7 cell lines (Akazawa et al., 2007; Koutsoudakis et al., 2007; Morikawa et al., 2007; Tscherne et al., 2007; Zhong et al., 2006). It is also possible that virus variants could have emerged during the course of the experiment, but this possibility is still under investigation. This raises the interesting question of whether there is an emergence of resistant cells in vivo where viral titers have been reported to be very high.

Although apoptosis plays a central role for the elimination of viral infections there is controversy about whether HCV infection has pro- or anti- apoptotic effects in vivo. There have been reports showing that individual HCV proteins can directly promote or inhibit apoptosis (Nanda, Herion, and Liang, 2006; Saito et al., 2006; Szabo, 2006). More recently there have been two reports that have used similar newly developed JFH1 in vitro systems to study viral factors (Sekine-Osajima et al., 2008) and host cell factors (Zhu et al., 2007) affecting apoptosis. In our report, apoptosis of an homogeneous cell population depends on robust virus production. We observed a correlation between particle production, cell growth arrest and apoptosis.

What actually happens in the liver of a patient infected with HCV is not known but it is possible that progressive liver damage might not only be a result of the anti-HCV immune response but also of direct cytopathic effect in virally infected cells. Some indirect evidence for this possibility is that liver injury progresses more rapidly in immune deficient patients than in immune competent HCV infected patients (Thomas and Seeff, 2005). Our established set of intragenotypic chimeras that produce infectious viral particles and in particular, our chimeric virus that comprises sequences from the isolate J6CF from core to p7 in the context of JFH1, will be helpful in examining further the effects of viral mutations, host cell growth retardation and apoptosis, and compensatory changes on infectivity and HCV persistence.

Materials and Methods

Cell culture

Huh-7.5 cells (kindly provided by C.M. Rice; (Blight, McKeating, and Rice, 2002)) were maintained in Dubecco’s modified Eagle medium (DMEM) containing 10% heat-inactivated fetal calf serum (Atlanta Biologicals) and incubated at 37°C, 5% CO2 and 100% relative humidity.

Construction of full-length chimeric genomes

Plasmids pJFH1 and pGND, full-length genotype 2a cDNA clones, were described previously (Wakita et al., 2005). Plasmid pJ6CF, a full-length clone of HCV genotype 2a, was previously shown to be infectious in chimpanzees (Yanagi et al., 1999).

JFHxJ6 CNS3

Plasmid CNS3 was constructed via 3-piece ligation of the 3222-bp BstZ17I- BbvCI fragment from plasmid pJ6CF, the 6016-bp BbvCI-XbaI fragment and the 3122-bp XbaI- BstZ17I fragment from pJFH1.

JFHxJ6 CE2

To generate plasmid CE2, two PCR products were produced with newly introduced restriction sites to facilitate fusion at the junction of the E2 gene from pJ6CF and the p7 gene from pJFH1. The first PCR product containing the core-E2 region of pJ6CF was amplified with primer 027HCVC-F (5’- CGTTGGCGGAGTATACTTGTTGCC-3’) and primer 029HCVE2FPCR-R (5’- CTCGCAGCGTGCAAGACGACAAGCT TCTCCAATGCTGCTTCGGCCTGG-3’). The latter introduces a HindIII restriction site (underlined) in the E2-p7 junction. The second PCR product comprised the E2-NS3 region of the JFH1 strain and was amplified using primer 030HCVE2FPRC-F, complementary to 029HCVE2FPCR-R (5’- CCAGGCCGAAGCAGCATTGGAGAAGCTTGTC GTCTTGCACGCTGCGAG-3’) and 028HCVNS3-R (5’-TACCAAGTCCCCCTCAG CACTCGAGTA-3’). The two products were gel purified and fused via PCR using Vent polymerase (Biolabs) and the primers 027HCVC-F and 028HCVNS3-R. This fusion product was digested with BstZ17I- NotI (2515-bp) and ligated with the 6723-bp NotI-XbaI and 3122-bp XbaI-BstZ17I fragments derived from pJFH1 to generate the full-length clone JFHxJ6 CE2.

JFHxJ6 Cp7

A similar approach was used to construct the full-length clone Cp7. Two PCR products were produced and fused in order to create the junction between the p7 gene from pJ6CF and the NS2 gene from pJFH1. The first PCR product containing the core-p7 region of pJ6CF was amplified with primer 027HCVC-F and primer 031HCVp7FPCR-R (5’-GTCCGTGCACAGGTGCGTCATACGCGTAAGCCTGTTG GGGCAATGC-3’), introducing a MluI restriction site (underlined) in the p7-NS2 junction. The second PCR fragment encoding the NS2 and NS3 genes of pJFH1 was amplified using the primer 032HCVp7FPCR-F (5’-GCATTGCCCCAACAGGC TTACGCGTATGACGCACCTGT GCACGGAC -3’) that is complementary to 031HCVp7FPCR-R and primer 028HCVNS3-R. Both products were gel purified and fused via PCR using primers 027HCVC-F and 028HCVNS3-R. The resulting fragment was gel purified and digested with BsiWI- NotI (1611-bp) and ligated with the 6723-bp NotI-XbaI fragment derived from pJFH1 and the 4026-bp XbaI- BsiWI fragment derived from JFHxJ6 CNS3 to generate the full-length clone JFHxJ6 Cp7.

JFHxJ6 CNS2

To construct clone CNS2, core-NS2 was amplified from pJ6CF using 035HCVCJ6-F (TCTCGTAGACCGTGCACCATGAGCACAAATCCTAAAC CTCAAAG) and 036HCVCJ6-R (GGCATAAGCAGTGATGGGAGCGAGAAGACTCCACCCCTTG). To join the NS2 gene from pJ6CF with the NS3 gene from pJFH1, a second PCR product was generated using primers 037HCVNS3JFH-F (GCTCCCATCACTGCTTATGCC) and 038HCVNS3JFH-R (GCTACCGAGGGGTTAAGCACT). Both products were purified and fused via PCR using primers 035HCVCJ6-F and 038HCVNS3JFH-R. This fragment was used in a 3-piece ligation of the 3222-bp BstZ17I- BbvCI fusion PCR product, the 6016-bp BbvCI-XbaI and the 3122-bp XbaI- BstZ17I fragment from pJFH1.

Plasmid CNS2C3 was generated by ligation of the 11,258 bp BsabI-BbvCI fragment derived from the plasmid Cp7 and 1102 pb fusion PCR product digested with the same enzymes. The fusion PCR product was generated by fusing one PCR product generated by amplifying plasmid CNS2 with 027HCV-F and 085JFHJ6NS2C3R 5’- GAGATAGCACAACCACCACAGAAACCGGCTGAGAAGGGTCTT-3’ and a second fragment generated by amplification of pJFH1 plasmid with primers 084JFHJ6NS2C3F 5’-AAGACCCTTCTCAGCCGGTTTCTGTGGTGGTTGTGCTATCTC-3’ and 028HCVNS3-R. All fragments generated by PCR were verified by sequencing.

Gluc/Cp7and mutant derivatives

Plasmid GLuc/Cp7 was constructed by a three-piece ligation of two fusion PCR products. The first fusion PCR fragment was generated by amplification of two PCR products with primers 060EcoRT7NTRJFH and 136PmeIGlucR. The first product (463 bp) was amplified using primers 060EcoRT7NTRJFH (5’-CCGGAATTCTAATACGACTCACTATAGACC-3’) and 135CoreGLucR (5’-GGGCAAACAGAACTTTGACTCCCATGTATACTCCGCCA ACGATCT -3’) and JFH1 as a template and encodes from nucleotide 1 to 463 (amino acid 33 of the core protein) of JFH1 plasmid and the first 8 amino acids of Gaussia luciferase (GLuc) encoding sequence. The second PCR product used for the fusion was generated by amplification of the sequence encoding for Gluc from plasmid pCMV-Gluc (New England Biolabs) using primers 134CoreGLucF, complementary to 135CoreGLucR (5’-CAGATCGTTGGCGGAGTATACATGGGAGTCAAAGTTCTG TTTGCC-3’) and 136PmeIGLucR (5’- GTGGTCTGTTTAAACTTAGTCACCACCGGCCCCCCT-3’) that introduced a PmeI restriction site (underlined) in the 3’ end sequence of Gluc gene. The second fusion PCR product comprised the EMCV IRES sequence fused with the first amino acid of the core protein to part of NS2 from Cp7 and was generated using primers 066EGFPendEMCVSaF and 057HCVNS2JFHR. The EMCV IRES sequence was amplified from the plasmid FL-Neo (kindly provided by CM Rice) using primers 066EGFPendEMCVSaF (5’-GGCATGGACGAGCTCTACAAGTGAGTTTAAACA GACCACAACGGT-3’) and 067EMCVendCofJFH (GAGGTTTAGGATTTGTGCTCA TTATTATCGTGTTTTTCAAAGG-3’). The PCR fragment that encodes for the first amino acid of the core protein of JFH1 strain to amino acid 890 in NS2 protein (2668 bp) amplified with primers 068EMCVendCofJFH (5’- CCTTTGAAAAACACGATAATAATGAGCACAAATCCTAAACCT-3’) and 057HCVNS2JFHR (5’-AACACCACACCCGGGCAGAATAT-3’). To generate the full-length Gluc/Cp7 plasmid, the first product (1115 bp) that encoded for the T7 promoter, HCV IRES and Gluc was digested with EcoRI-PmeI and ligated with the1635bp- PmeI-BsiWI fragment derived from the second fusion PCR that comprised the EMCV IRES fused with the structural region of Cp7 and a 10992-bp fragment derived from JFH1 digested with EcoRI –BsiWI.

JFH1SphI and mutagenesis

Plasmid JFH1SphI was generated by ligation of 4943-bp fragment generated by digestion of JFH1 with SphI restriction enzyme. The plasmid was used for mutagenesis using QuikChange® XL Site Directed Mutagenesis kit (Stratagene, La Jolla, California). Plasmid C301U JFH1SphI was generated by mutagensis of JFH1SphI with primers 122IRESmutF (5’- GTACTGCCTGATAGGGtGCTTGCGAGTGCCCC-3’) and 123IRESmutR (5’- GGGGCACTCGCAAGCACCCTATCAGGCAGTAC-3’), G398C JFH1SphI with primers 124Core422F (5’-CCAACCGTCGCCCACAAGACGTTAAGTTCA-3’) and 125Core422R (5’- TGAACTTAACGTCTTGTGGGCGACGGTTGG-3’) and C412U JFH1SphI with primers 126Core436F (5’-GAAGACGTTAAGTTtCCGGGCGGCGGCC –3’) and 127Core436R (5’-GGCCGCCGCCCGGAAACTTAACGTCTTC-3’) NTRNS2/Gluc/Cp7 was obtained by ligation of the EcoRI/PmeI fusion PCR product in which the template for the generation of the first PCR fragment was NTRNS2 plasmid. All constructs were verified by DNA sequencing.

RNA synthesis and transfection

Plasmids containing the full-length chimeric HCV cDNA were linearized by XbaI digestion (Yamazaki et al., 2002) followed by treatment with mung bean nuclease to remove 5’ end overhangs. The linearized DNA templates were purified by phenol:chloroform extraction and ethanol precipitation and resuspended at a final concentration of 1µg/µl. The linearized DNA templates were transcribed with T7 RNA polymerase using a MEGAscript™ T7 kit (Ambion, Austin, TXs) according to the manufacturer. After transcription, synthesized RNA was treated with DNAse I, the integrity of the RNA was analyzed by non-denaturing agarose gel electrophoresis and the yield determined by spectrophotometry and adjusted to 2 µg/µl. RNA was stored at −70 degrees Celsius until electroporation.

Huh-7.5 cells were grown to 60–80% confluence, trypsinized and washed twice in cold PBS. Cells were resuspended in cold PBS at a concentration of 2 × 107 cells/ml, and 0.4 ml aliquots were mixed with 10 µg of in vitro transcribed RNA and dispensed into 0.4 cm Gene Pulser cuvettes (Bio-Rad). Samples were pulsed using an ECM 830 apparatus (BTX Genetronics) with five pulses of 99 µsec at 820 V over 1.1 sec. Cells were resuspended in 20 ml of complete growth medium, plated and incubated at 37°C, 5% CO2 and 100% relative humidity.

Western Blot analysis of HCV proteins

A each time point, cells were washed twice with PBS, lysed with 200µl of buffer (100 mM Tris, pH 6.8; 20 mM dithiothreitol; 4% (w/v) SDS; 20% glycerol; 0.2% w/v bromophenol blue) and homogenized by passing through a 22-gauge needle. Proteins were separed by SDS-PAGE and transferred to Immobilon-P membranes (Millipore, Bedford, MA). Membranes were blocked with TBS-T (20mM Tris, pH 7.4, 150mM NaCl, 0.1% (v/v) Tween-20) with 5% w/v dry milk and HCV proteins were detected using anti-NS3 monoclonal antibody (Virostat), HRP- conjugated secondary antibodies, (Pierce, Rockford, IL) washed repeatedly with TBS-T and detected using an ECL kit (Amersham, NJ).

Viral titration and immnunohistochemical staining

Naïve Huh-7.5 cells were grown in collagen coated 96 well plates at a concentration of 6 × 103 cells/well and inoculated with the samples at 10 fold dilutions in 8 replicates at each dilution in complete growth medium. After 3 days of incubation, cells were immunostained for NS5A (Lindenbach et al., 2005). Cell were washed twice with PBS, fixed for 10 minutes with methanol (−20°C), washed twice with PBS and permeabilized with one wash of PBS- 0.1% Tween 20 (PBS-T). Cells were then blocked for 30 minutes at room temperature with PBS-T containing 1 % (w/v) bovine serum albumin (BSA) and 0.2% dry skim milk, followed by blockage of endogenous peroxidase using 3% H2O2 in PBS for 5 minutes at room temperature. Cells were washed twice with PBS and once with PBS-T and incubated 1 hour at room-temperature with a 1:200 dilution of supernatants from the 9E10, anti-NS5A antibody producing, hybridoma (kindly provided by C.M. Rice). After washing twice with PBS and once with PBS-T, cells were incubated with goat anti-mouse HRP polymer (ImmPRESS™-Vector Labs) diluted 1:3 in PBS-T for 30 minutes at room temperature. Finally, cells were washed as described above and developed using DAB substrate (Vector Laboratories). The viral titers were determined by immunohistochemistry using monoclonal anti NS5A antibody by calculating tissue culture infection dose at which 50% of the wells were positive for viral antigen (Reed and Muench, 1938).

CFSE staining

Seventy-two hours post electroporation supernatants were collected and titered and cells were trypsinized, washed twice with PBS and resuspended at a concentration of 10–15 × 105 cells/ml. 2 µl of the CFSE stock solution (5 mM in DMSO) were added in 1ml of PBS and the diluted stock was added to 1ml of the cell suspension (final concentration of CFSE 5µM). Cells were labeled for 5 minutes at room temperature and immediately washed twice with PBS containing 5% FCS. Cells were counted (3–5 × 105 cells) and resuspended in 10 ml of MEM with 10% FCS and distributed in 24 well plates. Supernatants were collected every 48 hours and analyzed for viral titers and the cells were trypsinized, counted and analyzed using a FACScalibur cytometer (Becton Dickinson) and FlowJo software (version 6.4).

Annexin APC Staining

Apoptosis of transfected Huh-7.5 cells was determined at day 3, 8 and 18 post electroporation by staining with Annexin V-APC (BD Pharmingen™, San Diego, CA) according to the manufacturer’s instructions and FACS analysis was carried out on a FACScalibur cytometer. Cells were washed twice with PBS, counted, adjusted to 1× 106 cells, resuspended in 100µl of 1X Annexin V binding buffer (10mM HEPES/NaOH, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2) with 5 µl of Annexin V-APC and incubated for 20 minutes in the dark. The percentage of apoptotic cells as measured by fluorescence intensity of Annexin V staining was determined using the FACScalibur and FlowJo software (version 6.4).

Acknowledgements

The authors thank Hannah Scarborough and Brian Goldner for excellent technical assistance and Raghavan Chinnadurai, Tim Denning, Laura McMullan and Holly L. Hanson for valuable scientific discussion and critical reading of the manuscript. We also thank Charles M. Rice for providing Huh-7.5 and FL-neo cells and the anti-NS5A, clone 9E10/A3 antibody. TW was partially supported by a grant-in-aid for Scientific Research from the Japan Society for the Promotion of Science, from the Ministry of Health, Labor and Welfare of Japan and from the Ministry of Education, Culture, Sports, Science and Technology, and by the Research on Health Sciences Focusing on Drug Innovation from the Japan Health Sciences Foundation. JB was in part supported by grants from the Lundbeck Foundation, the Novo Nordisk Foundation, the Danish Medical Research Council and the A.P. Møller and the Chastine Mc-Kinney Møller Foundation. The authors would like to acknowledge the support from the Cancer Research Institute Investigator Award, Woodruff Health Sciences Fund, EVC/CFAR Flow Cytometry Core P30 AI050409, Yerkes Research Center Base Grant RR-00165, and the public Health Service AI052448 and AI070101(AG).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Global surveillance and control of hepatitis C. Report of a WHO Consultation organized in collaboration with the Viral Hepatitis Prevention Board, Antwerp, Belgium. J Viral Hepat. 1999;6(1):35–47. [PubMed] [Google Scholar]
  2. Akazawa D, Date T, Morikawa K, Murayama A, Miyamoto M, Kaga M, Barth H, Baumert TF, Dubuisson J, Wakita T. CD81 expression is important for the permissiveness of huh7 cell clones for heterogeneous hepatitis C virus infection. J Virol. 2007;81(10):5036–5045. doi: 10.1128/JVI.01573-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alter MJ, Kruszon-Moran D, Nainan OV, McQuillan GM, Gao F, Moyer LA, Kaslow RA, Margolis HS. The prevalence of hepatitis C virus infection in the United States, 1988 through 1994. N Engl J Med. 1999;341(8):556–562. doi: 10.1056/NEJM199908193410802. [DOI] [PubMed] [Google Scholar]
  4. Alter MJ, Margolis HS, Krawczynski K, Judson FN, Mares A, Alexander WJ, Hu PY, Miller JK, Gerber MA, Sampliner RE, et al. The natural history of community-acquired hepatitis C in the United States. The Sentinel Counties Chronic non-A, non-B Hepatitis Study Team. N Engl J Med. 1992;327(27):1899–1905. doi: 10.1056/NEJM199212313272702. [DOI] [PubMed] [Google Scholar]
  5. Baril M, Brakier-Gingras L. Translation of the F protein of hepatitis C virus is initiated at a non-AUG codon in a +1 reading frame relative to the polyprotein. Nucleic Acids Res. 2005;33(5):1474–1486. doi: 10.1093/nar/gki292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Blight KJ, Kolykhalov AA, Rice CM. Efficient initiation of HCV RNA replication in cell culture. Science. 2000;290(5498):1972–1975. doi: 10.1126/science.290.5498.1972. [DOI] [PubMed] [Google Scholar]
  7. Blight KJ, McKeating JA, Rice CM. Highly permissive cell lines for subgenomic and genomic hepatitis C virus RNA replication. J Virol. 2002;76(24):13001–13014. doi: 10.1128/JVI.76.24.13001-13014.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Boulant S, Targett-Adams P, McLauchlan J. Disrupting the association of hepatitis C virus core protein with lipid droplets correlates with a loss in production of infectious virus. J Gen Virol. 2007;88(Pt 8):2204–2213. doi: 10.1099/vir.0.82898-0. [DOI] [PubMed] [Google Scholar]
  9. Bukh J, Miller RH, Purcell RH. Biology and genetic heterogeneity of hepatitis C virus. Clin Exp Rheumatol. 1995;13 Suppl 13:S3–S7. [PubMed] [Google Scholar]
  10. Bukh J, Pietschmann T, Lohmann V, Krieger N, Faulk K, Engle RE, Govindarajan S, Shapiro M, St Claire M, Bartenschlager R. Mutations that permit efficient replication of hepatitis C virus RNA in Huh-7 cells prevent productive replication in chimpanzees. Proc Natl Acad Sci U S A. 2002;99(22):14416–14421. doi: 10.1073/pnas.212532699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Delgrange D, Pillez A, Castelain S, Cocquerel L, Rouille Y, Dubuisson J, Wakita T, Duverlie G, Wychowski C. Robust production of infectious viral particles in Huh-7 cells by introducing mutations in hepatitis C virus structural proteins. J Gen Virol. 2007;88(Pt 9):2495–2503. doi: 10.1099/vir.0.82872-0. [DOI] [PubMed] [Google Scholar]
  12. Gottwein JM, Scheel TK, Hoegh AM, Lademann JB, Eugen-Olsen J, Lisby G, Bukh J. Robust hepatitis C genotype 3a cell culture releasing adapted intergenotypic 3a/2a (S52/JFH1) viruses. Gastroenterology. 2007;133(5):1614–1626. doi: 10.1053/j.gastro.2007.08.005. [DOI] [PubMed] [Google Scholar]
  13. Hourioux C, Ait-Goughoulte M, Patient R, Fouquenet D, Arcanger-Doudet F, Brand D, Martin A, Roingeard P. Core protein domains involved in hepatitis C virus-like particle assembly and budding at the endoplasmic reticulum membrane. Cell Microbiol. 2007;9(4):1014–1027. doi: 10.1111/j.1462-5822.2006.00848.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kato T, Date T, Miyamoto M, Furusaka A, Tokushige K, Mizokami M, Wakita T. Efficient replication of the genotype 2a hepatitis C virus subgenomic replicon. Gastroenterology. 2003a;125(6):1808–1817. doi: 10.1053/j.gastro.2003.09.023. [DOI] [PubMed] [Google Scholar]
  15. Kato T, Furusaka A, Miyamoto M, Date T, Yasui K, Hiramoto J, Nagayama K, Tanaka T, Wakita T. Sequence analysis of hepatitis C virus isolated from a fulminant hepatitis patient. J Med Virol. 2001;64(3):334–339. doi: 10.1002/jmv.1055. [DOI] [PubMed] [Google Scholar]
  16. Kato T, Miyamoto M, Furusaka A, Date T, Yasui K, Kato J, Matsushima S, Komatsu T, Wakita T. Processing of hepatitis C virus core protein is regulated by its C-terminal sequence. J Med Virol. 2003b;69(3):357–366. doi: 10.1002/jmv.10297. [DOI] [PubMed] [Google Scholar]
  17. Kim M, Ha Y, Park HJ. Structural requirements for assembly and homotypic interactions of the hepatitis C virus core protein. Virus Res. 2006;122(1–2):137–143. doi: 10.1016/j.virusres.2006.07.008. [DOI] [PubMed] [Google Scholar]
  18. Koutsoudakis G, Herrmann E, Kallis S, Bartenschlager R, Pietschmann T. The level of CD81 cell surface expression is a key determinant for productive entry of hepatitis C virus into host cells. J Virol. 2007;81(2):588–598. doi: 10.1128/JVI.01534-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lindenbach BD, Evans MJ, Syder AJ, Wolk B, Tellinghuisen TL, Liu CC, Maruyama T, Hynes RO, Burton DR, McKeating JA, Rice CM. Complete replication of hepatitis C virus in cell culture. Science. 2005;309(5734):623–626. doi: 10.1126/science.1114016. [DOI] [PubMed] [Google Scholar]
  20. Lindenbach BD, Rice CM. Unravelling hepatitis C virus replication from genome to function. Nature. 2005;436(7053):933–938. doi: 10.1038/nature04077. [DOI] [PubMed] [Google Scholar]
  21. Lohmann V, Korner F, Koch J, Herian U, Theilmann L, Bartenschlager R. Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science. 1999;285(5424):110–113. doi: 10.1126/science.285.5424.110. [DOI] [PubMed] [Google Scholar]
  22. McMullan LK, Grakoui A, Evans MJ, Mihalik K, Puig M, Branch AD, Feinstone SM, Rice CM. Evidence for a functional RNA element in the hepatitis C virus core gene. Proc Natl Acad Sci U S A. 2007;104(8):2879–2884. doi: 10.1073/pnas.0611267104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Miyanari Y, Atsuzawa K, Usuda N, Watashi K, Hishiki T, Zayas M, Bartenschlager R, Wakita T, Hijikata M, Shimotohno K. The lipid droplet is an important organelle for hepatitis C virus production. Nat Cell Biol. 2007;9(9):1089–1097. doi: 10.1038/ncb1631. [DOI] [PubMed] [Google Scholar]
  24. Moradpour D, Evans MJ, Gosert R, Yuan Z, Blum HE, Goff SP, Lindenbach BD, Rice CM. Insertion of green fluorescent protein into nonstructural protein 5A allows direct visualization of functional hepatitis C virus replication complexes. J Virol. 2004;78(14):7400–7409. doi: 10.1128/JVI.78.14.7400-7409.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Moradpour D, Penin F, Rice CM. Replication of hepatitis C virus. Nat Rev Microbiol. 2007;5(6):453–463. doi: 10.1038/nrmicro1645. [DOI] [PubMed] [Google Scholar]
  26. Morikawa K, Zhao Z, Date T, Miyamoto M, Murayama A, Akazawa D, Tanabe J, Sone S, Wakita T. The roles of CD81 and glycosaminoglycans in the adsorption and uptake of infectious HCV particles. J Med Virol. 2007;79(6):714–723. doi: 10.1002/jmv.20842. [DOI] [PubMed] [Google Scholar]
  27. Murayama A, Date T, Morikawa K, Akazawa D, Miyamoto M, Kaga M, Ishii K, Suzuki T, Kato T, Mizokami M, Wakita T. The NS3 helicase and NS5B-to-3'X regions are important for efficient hepatitis C virus strain JFH-1 replication in Huh7 cells. J Virol. 2007;81(15):8030–8040. doi: 10.1128/JVI.02088-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Murray CL, Jones CT, Tassello J, Rice CM. Alanine scanning of the hepatitis C virus core protein reveals numerous residues essential for production of infectious virus. J Virol. 2007;81(19):10220–10231. doi: 10.1128/JVI.00793-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Nanda SK, Herion D, Liang TJ. The SH3 binding motif of HCV [corrected] NS5A protein interacts with Bin1 and is important for apoptosis and infectivity. Gastroenterology. 2006;130(3):794–809. doi: 10.1053/j.gastro.2005.12.030. [DOI] [PubMed] [Google Scholar]
  30. Pietschmann T, Kaul A, Koutsoudakis G, Shavinskaya A, Kallis S, Steinmann E, Abid K, Negro F, Dreux M, Cosset FL, Bartenschlager R. Construction and characterization of infectious intragenotypic and intergenotypic hepatitis C virus chimeras. Proc Natl Acad Sci U S A. 2006;103(19):7408–7413. doi: 10.1073/pnas.0504877103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Reed LJ, Muench H. A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 1938;27(3):493–497. [Google Scholar]
  32. Reichard O, Schvarcz R, Weiland O. Therapy of hepatitis C: alpha interferon and ribavirin. Hepatology. 1997;26:108S–111S. doi: 10.1002/hep.510260719. [DOI] [PubMed] [Google Scholar]
  33. Reusken CB, Dalebout TJ, Eerligh P, Bredenbeek PJ, Spaan WJ. Analysis of hepatitis C virus/classical swine fever virus chimeric 5'NTRs: sequences within the hepatitis C virus IRES are required for viral RNA replication. J Gen Virol. 2003;84(Pt 7):1761–1769. doi: 10.1099/vir.0.19063-0. [DOI] [PubMed] [Google Scholar]
  34. Rodriguez-Casado A, Molina M, Carmona P. Core protein-nucleic acid interactions in hepatitis C virus as revealed by Raman and circular dichroism spectroscopy. Appl Spectrosc. 2007;61(11):1219–1224. doi: 10.1366/000370207782597139. [DOI] [PubMed] [Google Scholar]
  35. Saito K, Meyer K, Warner R, Basu A, Ray RB, Ray R. Hepatitis C virus core protein inhibits tumor necrosis factor alpha-mediated apoptosis by a protective effect involving cellular FLICE inhibitory protein. J Virol. 2006;80(9):4372–4379. doi: 10.1128/JVI.80.9.4372-4379.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Sakai A, Takikawa S, Thimme R, Meunier JC, Spangenberg HC, Govindarajan S, Farci P, Emerson SU, Chisari FV, Purcell RH, Bukh J. In vivo study of the HC-TN strain of hepatitis C virus recovered from a patient with fulminant hepatitis: RNA transcripts of a molecular clone (pHC-TN) are infectious in chimpanzees but not in Huh7.5 cells. J Virol. 2007;81(13):7208–7219. doi: 10.1128/JVI.01774-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sekine-Osajima Y, Sakamoto N, Mishima K, Nakagawa M, Itsui Y, Tasaka M, Nishimura-Sakurai Y, Chen CH, Kanai T, Tsuchiya K, Wakita T, Enomoto N, Watanabe M. Development of plaque assays for hepatitis C virus-JFH1 strain and isolation of mutants with enhanced cytopathogenicity and replication capacity. Virology. 2008;371(1):71–85. doi: 10.1016/j.virol.2007.09.019. [DOI] [PubMed] [Google Scholar]
  38. Spahn CM, Kieft JS, Grassucci RA, Penczek PA, Zhou K, Doudna JA, Frank J. Hepatitis C virus IRES RNA-induced changes in the conformation of the 40s ribosomal subunit. Science. 2001;291(5510):1959–1962. doi: 10.1126/science.1058409. [DOI] [PubMed] [Google Scholar]
  39. Szabo G. Hepatitis C virus NS5A protein--a master regulator? Gastroenterology. 2006;130(3):995–999. doi: 10.1053/j.gastro.2006.01.072. [DOI] [PubMed] [Google Scholar]
  40. Thomas DL, Seeff LB. Natural history of hepatitis C. Clin Liver Dis. 2005;9(3):383–398. doi: 10.1016/j.cld.2005.05.003. vi. [DOI] [PubMed] [Google Scholar]
  41. Tscherne DM, Evans MJ, von Hahn T, Jones CT, Stamataki Z, McKeating JA, Lindenbach BD, Rice CM. Superinfection exclusion in cells infected with hepatitis C virus. J Virol. 2007;81(8):3693–3703. doi: 10.1128/JVI.01748-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tuplin A, Wood J, Evans DJ, Patel AH, Simmonds P. Thermodynamic and phylogenetic prediction of RNA secondary structures in the coding region of hepatitis C virus. Rna. 2002;8(6):824–841. doi: 10.1017/s1355838202554066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Wakita T, Pietschmann T, Kato T, Date T, Miyamoto M, Zhao Z, Murthy K, Habermann A, Krausslich HG, Mizokami M, Bartenschlager R, Liang TJ. Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat Med. 2005;11(7):791–796. doi: 10.1038/nm1268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wasley A, Alter MJ. Epidemiology of hepatitis C: geographic differences and temporal trends. Semin Liver Dis. 2000;20(1):1–16. doi: 10.1055/s-2000-9506. [DOI] [PubMed] [Google Scholar]
  45. Yamazaki T, Akiba H, Iwai H, Matsuda H, Aoki M, Tanno Y, Shin T, Tsuchiya H, Pardoll DM, Okumura K, Azuma M, Yagita H. Expression of programmed death 1 ligands by murine T cells and APC. J Immunol. 2002;169(10):5538–5545. doi: 10.4049/jimmunol.169.10.5538. [DOI] [PubMed] [Google Scholar]
  46. Yanagi M, Purcell RH, Emerson SU, Bukh J. Hepatitis C virus: an infectious molecular clone of a second major genotype (2a) and lack of viability of intertypic 1a and 2a chimeras. Virology. 1999;262(1):250–263. doi: 10.1006/viro.1999.9889. [DOI] [PubMed] [Google Scholar]
  47. Yi M, Ma Y, Yates J, Lemon SM. Compensatory mutations in E1, p7, NS2, and NS3 enhance yields of cell culture-infectious intergenotypic chimeric hepatitis C virus. J Virol. 2007;81(2):629–638. doi: 10.1128/JVI.01890-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zhong J, Gastaminza P, Cheng G, Kapadia S, Kato T, Burton DR, Wieland SF, Uprichard SL, Wakita T, Chisari FV. Robust hepatitis C virus infection in vitro. Proc Natl Acad Sci U S A. 2005;102(26):9294–9299. doi: 10.1073/pnas.0503596102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Zhong J, Gastaminza P, Chung J, Stamataki Z, Isogawa M, Cheng G, McKeating JA, Chisari FV. Persistent hepatitis C virus infection in vitro: coevolution of virus and host. J Virol. 2006;80(22):11082–11093. doi: 10.1128/JVI.01307-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhu H, Dong H, Eksioglu E, Hemming A, Cao M, Crawford JM, Nelson DR, Liu C. Hepatitis C virus triggers apoptosis of a newly developed hepatoma cell line through antiviral defense system. Gastroenterology. 2007;133(5):1649–1659. doi: 10.1053/j.gastro.2007.09.017. [DOI] [PubMed] [Google Scholar]

RESOURCES