Emergence of Macrolide Resistance Gene mph(B) in Streptococcus uberis and Cooperative Effects with rdmC-Like Gene

Abstract

Streptococcus uberis UCN60 was resistant to spiramycin (MIC = 8 μg/ml) but susceptible to erythromycin (MIC = 0.06 μg/ml), azithromycin (MIC = 0.12 μg/ml), josamycin (MIC = 0.25 μg/ml), and tylosin (MIC = 0.5 μg/ml). A 2.5-kb HindIII fragment was cloned from S. uberis UCN60 DNA on plasmid pUC18 and introduced into Escherichia coli AG100A, where it conferred resistance to spiramycin by inactivation. The sequence analysis of the fragment showed the presence of an rdmC-like gene that putatively encoded a protein belonging to the alpha/beta hydrolase family and of the first 196 nucleotides of the mph(B) gene putatively encoding a phosphotransferase known to inactivate 14-, 15-, and 16-membered macrolides in E. coli. The entire mph(B) gene was then identified in S. uberis UCN60. The two genes were expressed alone or in combination in E. coli, Staphylococcus aureus, and Enterococcus faecalis. Analysis of MICs revealed that rdmC-like alone did not confer resistance to erythromycin, tylosin, and josamycin in those three hosts. It conferred resistance to spiramycin in E. coli and E. faecalis but not in S. aureus. mph(B) conferred resistance in E. coli to erythromycin, tylosin, josamycin, and spiramycin but only low levels of resistance in E. faecalis and S. aureus to spiramycin (MIC = 8 μg/ml). The combination of mph(B) and rdmC-like genes resulted in a resistance to spiramycin and tylosin in the three hosts that significantly exceeded the mere addition of the resistance levels conferred by each resistance mechanism alone.

Streptococcus uberis is an environmental pathogen commonly responsible for a high proportion of cases of clinical and mostly subclinical mastitis in lactating cows (9). It is also the predominant organism isolated from mammary glands during the nonlactating period (2, 14). β-Lactams are the drugs of choice for therapy of S. uberis infections during lactation and at drying off (6, 27). However, lincosamides or macrolides may be alternatives (7). Spiramycin, a macrolide antibiotic, is used via intramuscular or intramammary routes to treat bovine mastitis due to S. uberis in a few countries (23). In France, it is also used orally or intravenously in humans for therapy of streptococcal or staphylococcal infections.

Spiramycin is a 16-membered lactone ring macrolide with two amino sugars, d-forosamine and d-mycaminose, and a neutral sugar, l-mycarose, attached via glycosidic bonds, whereas most other commercially available macrolides have a 14- or 15-membered ring structure (5). Macrolides act by inhibition of protein biosynthesis at the large subunit (50S) of ribosomes (10). Resistance to this class of antibiotics is conferred mainly by the following four different mechanisms: (i) modification of the 23S rRNA target site by different methyltransferases, (ii) base substitution in 23S rRNA, (iii) efflux of the drug mediated by ABC-type transport systems or by exporters belonging to the major facilitator superfamily, and (iv) inactivation of the molecule by different enzymes (24, 28).

There are two classes of macrolide-inactivating enzymes: erythromycin esterase (22) and macrolide 2′-phosphotransferase [MPH(2′)] (12, 16, 19). MPH(2′) inactivates macrolide antibiotics by O phosphorylation of the 2′-hydroxyl group of an amino sugar in the antibiotic molecule, where the phosphoryl group is derived from the γ-phosphate of ATP. Two groups of phosphotransferases, MPH(2′)-I and MPH(2′)-II, are distinguished on the basis of substrate specificity and primary amino acid sequence. MPH(2′)-I, encoded by the mph(A) and mph(D) genes, inactivates 14-membered ring macrolides more efficiently than the 16-membered ones, whereas MPH(2′)-II, encoded by the mph(B) and mph(C) genes, inactivates both groups of macrolides (3, 26).

The mph(B) gene has been evidenced only in gram-negative bacteria, first in Escherichia coli and then in other members of Enterobacteriaceae and Pseudomonas (11, 25) (http://faculty.washington.edu/marilynr/ermweb4.pdf). In E. coli BM2506, the gene is borne by two different plasmids, pTZ3721 and PTZ3723, which are conjugative and mobilizable, respectively. The mph(B) gene of pTZ3721 is carried by a transposable element of 39 kb belonging to the Tn21 subgroup. This element has a Tn21-like transposition module at one end and a Tn1721-like transposition module at the other end (17). In both plasmids, the mph(B) gene was located a few base pairs downstream from an rdmC-like gene and an acrR-like gene (11). In this study, we report the presence of the mph(B) and rdmC-like genes in the spiramycin-resistant strain S. uberis UCN60. We also show that the rdmC-like gene participates in resistance to spiramycin and that the mph(B) and rdmC-like genes have an enhanced effect on spiramycin resistance when combined in gram-negative and -positive hosts.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

S. uberis UCN60 and S. uberis UCN61 were isolates obtained from clinical mastitis in cows and were resistant and susceptible to spiramycin, respectively. E. coli AG100A, Staphylococcus aureus RN4220, and Enterococcus faecalis JH2-2 were used in cloning experiments. E. coli AG100A is a mutant susceptible to lincosamides resulting from inactivation of the AcrAB pump responsible for the active efflux of lincosamides by transposon Tn903, harboring a kanamycin resistance gene (20). Strains were grown in brain heart infusion broth and agar incubated aerobically at 37°C.

Antibiotic susceptibility testing.

Susceptibility to antibiotics was determined by the agar diffusion technique as recommended by the Comité de l'Antibiogramme de la Société Française de Microbiologie (CA-SFM) (4). MICs were determined by the broth microdilution method (15) by use of Mueller-Hinton broth supplemented with 5% lysed horse blood for S. uberis and incubated at 35°C in ambient air for 24 h. Antibiotics were obtained from Sigma (Saint Quentin Fallavier, France) or from their manufacturers. Recommended CA-SFM breakpoints were used, including that for spiramycin (susceptible was defined as an MIC of ≤1 μg/ml; resistant was defined as an MIC of >4 μg/ml).

Spiramycin inactivation.

Spiramycin inactivation by resting cells of S. uberis UCN60 and E. coli AG100A transformants was tested in liquid medium as previously described (13). Briefly, bacterial cells were suspended in 0.01 M phosphate buffer (pH 7) containing 6 μg of spiramycin per ml and were incubated at 37°C for 24 h. The pH of this suspension was monitored and remained constant. The inactivation of spiramycin was followed by a bioassay with Micrococcus luteus ATCC 9341 as an indicator organism.

PCR conditions.

Oligonucleotide primers used in this study are given in Table 1. The PCR consisted of 30 cycles of denaturation (95°C, 30 s), annealing (50°C, 30 s), and extension (72°C, 30 s to 3 min).

TABLE 1.

Sequences of primers

Primer	Sequence (5′-3′)	Amplified DNA fragment
Acr-F	AGAGTTAGAAAAAGAAAAAATTCG	Internal to acrR-like
Acr-R	AACAGCTTCGAATAATAACTC
MphB-F	ATTAAACAAGTAATCGAGATAGC	Internal to mph(B)
MphB-R	TTTGCCATCTGCTCATATTCC
RdmC-F	ATATTTGCACTGAGAGTTTTGG	Internal to rdmC-like
RdmC-R	ATAAAGCATTAATAATTTCATCCC
RdmC-KpnI-F	GTTAATAGGTACCCAAAAGGG	Entire rdmC-like gene
RdmC-KpnI-R	ATTAAACGGTACCGTTTCTTC
MphB-KpnI-F	TGCTAGGTACCCTGGATGG	Entire mph(B) gene
MphB-KpnI-R	AATAGGTACCATAGTGGTAGG
RdmC-KpnI-F	GTTAATAGGTACCCAAAAGGG	Entire rdmC-like and mph(B) genes
MphB-KpnI-R	AATAGGTACCATAGTGGTAGG

Cloning and sequencing of a DNA fragment conferring resistance to spiramycin in E. coli.

Chromosomal DNA from S. uberis UCN60 was digested with various restriction enzymes and ligated at 4°C to plasmid vector pUC18 digested with the corresponding restriction enzymes. Recombinant plasmids were introduced by electroporation (Gene Pulser; Bio-Rad, Ivry-sur-Seine, France) into competent E. coli AG100A cells. E. coli AG100A transformants were selected on media containing spiramycin (64 μg/ml), ampicillin (100 μg/ml), and kanamycin (20 μg/ml). DNA strands were sequenced in both directions. DNA analyses and nucleotide comparisons were carried out using the National Centre for Biotechnology Information server at http://www.ncbi.nlm.nih.gov/.

Cloning of the mph(B) and rdmC-like genes.

A DNA fragment containing the rdmC-like and mph(B) genes and two other DNA fragments containing each gene alone were amplified by PCR using total DNA of S. uberis UCN60 as a template. Primers shown in Table 1 contained a KpnI site and were specific of DNA flanking the rdmC-like and/or the mph(B) gene. PCR fragments were digested with KpnI and cloned in the gentamicin-resistant shuttle vector pAT392 (1). The three recombinant plasmids bearing the rdmC-like and mph(B) genes alone or combined were then electroporated into E. coli AG100A, S. aureus RN4220, and E. faecalis JH2-2.

Nucleotide sequencing accession number.

The nucleotide sequence of the acrR-like, rdmC-like, and mph(B) gene cluster has been deposited in the GenBank data library under accession no. EU727204.

RESULTS

Resistance to spiramycin in S. uberis UCN60.

S. uberis UCN60 displayed an unusual resistance to spiramycin (the MIC for S. uberis UCN60 was 8 μg/ml, compared to 0.5 μg/ml for S. uberis UCN61). By contrast, S. uberis UCN60 was susceptible to the other tested macrolides and lincosamides, with MICs of clindamycin (0.03 μg/ml), erythromycin (0.06 μg/ml), azithromycin (0.12 μg/ml), josamycin (0.25 μg/ml), and tylosin (0.5 μg/ml) similar to those for S. uberis UCN61. Remarkably, among the three tested 16-membered macrolides, only spiramycin had a high MIC, whereas the two others, josamycin and tylosin, remained active. This dissociated phenotype contrasted with the usual phenotype of cross-resistance between macrolides, lincosamides, and type B streptogramins due to ribosomal methylation. The inactivation of spiramycin by resting cells of S. uberis UCN60 was checked by a microbiological technique. In the presence of nearly 10⁹ cells of S. uberis UCN60, the concentration of native spiramycin (20 μg in a volume of 1 ml) decreased within 1 h to 2.5 μg (which is the limit of detection of the method). The spiramycin concentration remained constant with the negative control, S. uberis UCN61.

Cloning of resistance to spiramycin.

Fragments from S. uberis UCN60 total DNA digested with various restriction enzymes were inserted into plasmid pUC18 DNA digested similarly and introduced into E. coli AG100A by electrotransformation. The plasmid contents of transformants resistant to ampicillin, kanamycin, and spiramycin were analyzed by agarose gel electrophoresis of crude bacterial lysates. One of the transformants harboring plasmid pUC18 with a 2.5-kb HindIII insert that conferred resistance to spiramycin (MIC = 200 μg/ml) in E. coli AG100A was studied further. The transformant was found able to inactivate spiramycin. The sequence of the insert was determined and its analysis revealed homology with known genes. The cloned DNA was nearly identical (>99%) to a fragment of plasmids pTZ3723 and pTZ3721 of E. coli BM2506 that contained, from 5′ to 3′, an acrR-like gene putatively encoding a protein that belonged to the AcrR/TetR family, an rdmC-like gene, and the first 196 nucleotides of mph(B).

We designed various oligonucleotide primers from the sequence of plasmids pTZ3723 and pTZ3721 to amplify by PCR overlapping fragments of the acrR-like, rdmC-like, and mph(B) genes from total DNA of S. uberis UCN60. These PCR experiments and sequence determination confirmed the presence of the acrR-like and rdmC-like genes and revealed the presence of the entire mph(B) gene. However, genes present downstream and upstream from this gene cluster in plasmids pTZ3723 and pTZ3721 could not be amplified from S. uberis UCN60. The mph(B) gene from our strain was 100% identical to the mph(B) gene encoding a phosphotransferase known to inactivate 14-, 15-, and 16-membered macrolides in E. coli (11, 17). The deduced amino acid sequence of the rdmC-like gene displayed homology (from 34% to 50% identity) with a variety of proteins belonging to the alpha/beta hydrolase family, including RdmC, a methyl esterase involved in the biosynthesis of anthracyclines in Streptomyces species (29), streptothricin acetyltransferases, several carboxylesterases, and acetyltransferases described for Bacillus spp. and various species of enterobacteria.

No mph(B), rdmC-like, or acrR-like gene was detected by PCR in the spiramycin-susceptible strain S. uberis UCN61.

Effects of the combined rdmC-like and mph(B) genes.

Cloning of the spiramycin resistance of S. uberis UCN60 into E. coli showed that the rdmC-like gene was sufficient to confer resistance to the macrolide, at least in this host. However, the presence of mph(B), adjacent to the rdmC-like gene, suggested that this gene might be also involved in resistance to spiramycin. Both genes were cloned, separately or combined, in shuttle vector pAT392 in order to determine the phenotype of resistance conferred in gram-negative and gram-positive hosts. Each construct was electroporated into E. coli AG100A, S. aureus RN4220, and E. faecalis JH2-2, and MICs of macrolides and clindamycin were determined (Table 2). MIC determinations revealed the following. (i) rdmC-like alone conferred resistance to spiramycin in E. coli and E. faecalis but not in S. aureus. This gene did not confer resistance to erythromycin, josamycin, or tylosin in those three hosts. (ii) mph(B) conferred resistance to all tested macrolides in E. coli but only to low levels of spiramycin in E. faecalis and in S. aureus (MIC = 8 μg/ml). (iii) Combination of mph(B) and rdmC-like genes contributed in a more-than-additive fashion to the high level of resistance to spiramycin and tylosin in E. coli (MICs > 128 μg/ml), S. aureus (MICs of 32 and 16 μg/liter, respectively), and E. faecalis (MICs of 64 and 16 μg/ml, respectively). No effect of the combination of genes against erythromycin and josamycin was observed. (iv) Clindamycin activity was not affected by rdmC-like or mph(B).

TABLE 2.

MICs of macrolides and clindamycin for E. coli AG100A, S. aureus RN4220, and E. faecalis JH2-2 transformants

Bacterial strain	Plasmid	MIC (μg/ml) of:
		Erythromycin	Josamycin	Tylosin	Spiramycin	Clindamycin
E. coli AG100A	pAT392	2	8	16	8	2
	pAT392::rdmC	2	8	16	200	2
	pAT392::mph(B)	64	16	128	400	2
	pAT392::rdmC+mph(B)	64	16	>128	1000	2
S. aureus RN4220	pAT392	0.25	1	1	4	0.06
	pAT392::rdmC	0.25	1	1	4	0.06
	pAT392::mph(B)	0.25	1	1	8	0.06
	pAT392::rdmC+mph(B)	0.25	1	16	32	0.06
E. faecalis JH2-2	pAT392	0.25	1	1	0.5	2
	pAT392::rdmC	0.25	1	1	2	2
	pAT392::mph(B)	0.25	1	1	8	2
	pAT392::rdmC+mph(B)	0.25	1	16	64	2

DISCUSSION

The mph(B) gene was initially reported for E. coli to inactivate macrolides by O phosphorylation of the 2′ hydroxyl group of the amino sugar of these molecules. For the first time, we report the presence of this gene in a gram-positive clinical isolate, S. uberis UCN60. It is interesting to note that the G+C content of mph(B) (38%) is more closely related to that of the S. uberis genome (34.8 to 37%) than to that of the E. coli genome (50%). Possibly, the gene might originate from S. uberis, or, alternatively, S. uberis UCN60 might have acquired the gene from an unknown gram-positive donor.

The mph(B) gene conferred resistance by inactivation to erythromycin, josamycin, tylosin, and spiramycin in E. coli AG100A but only to spiramycin in E. faecalis JH2-2 and in S. aureus RN4220. A similar expression of resistance has already been described by Noguchi et al. (18). It can be presumed that the activity of a given macrolide against a given bacterial strain producing an MPH-(2′)-II enzyme would result from a competition between the ribosome and the enzyme for binding the drug. Hypothetically, the difference between the various macrolides might reflect different affinities of the molecules for the ribosomes of gram-positive and gram-negative organisms and for the Mph(B) enzyme.

As in plasmids pTZ3721 and pTZ3723 of E. coli BM2506, an rdmC-like and a putative regulator acrR-like gene are located upstream from the mph(B) gene (11, 17). The product of rdmC-like is related to RdmC, a methyl esterase involved in the biosynthesis of aklavonone antibiotic that has never been reported as conferring antibiotic resistance, and to acetyltransferases conferring resistance to the streptothricin antibiotic (8, 11, 29). The product of the acrR-like gene belongs to the AcrR/TetR family of transcriptional repressor (21). Subcloning experiments confirmed that the rdmC-like gene was able to confer resistance to spiramycin by inactivation in E. coli and E. faecalis but not in S. aureus. Combination of the rdmC-like gene and of mph(B) in the three recipients resulted in MICs of spiramycin and tylosin higher than those expected from just an additive effect. Clinically significant levels of resistance to both macrolides might be achieved only when the resistance genes are combined. Surprisingly, in the original host, S. uberis, the presence of the rdmC-like and mph(B) genes did not confer resistance to tylosin. Despite repeated attempts, we were unable to introduce the rdmC-like gene with or without mph(B) into a susceptible strain of S. uberis and therefore to confirm the difference of expression in this genetic background. The gene combination was already widespread in S. uberis, since we identified by PCR the presence of both genes in 10 isolates from bovine mastitis resistant to spiramycin by inactivation (data not shown). Other genes that were characterized in plasmids pTZ3721 and pTZ3723, in particular a transposase gene, were not found in our isolate.

The mechanism of inactivation of spiramycin by Mph(B) and RdmC-like was not characterized in this study. The function of Mph(B) should be similar to that previously reported, whereas the function of RdmC-like remained obscure (18). Dual modification of spiramycin molecules by RdmC-like and Mph(B) enzymes might explain the marked increase in MIC of the antimicrobial (≥32 μg/ml). However, this hypothesis remains to be confirmed.