Skip to main content
NCBI home page
International Journal of Experimental Pathology logoLink to International Journal of Experimental Pathology
. 2008 Apr;89(2):125–137. doi: 10.1111/j.1365-2613.2008.00579.x

Dysregulation of matrix metalloproteinases and their tissue inhibitors is related to abnormality of left ventricular geometry and function in streptozotocin-induced diabetic minipigs

Lin Lu *,†, Qi Zhang *, Li Jin Pu *, Wen Hui Peng *, Xiao Xiang Yan *, Lin Jie Wang †, Qiu Jing Chen †, Zheng Bing Zhu *, Jean-Baptiste Michel ‡, Wei Feng Shen *,†
PMCID: PMC2525761  PMID: 18336530

Abstract

This study aimed to characterize matrix metalloproteinases (MMPs) and their tissue inhibitors (TIMPs) in relation to changes in left ventricle (LV) geometry and function in a porcine model with streptozotocin (STZ)-induced diabetes. In 15 Chinese Guizhou minipigs with STZ-induced diabetes (diabetic group) and 15 age-matched normal controls (control group), Doppler tissue imaging was performed at 6 months of diabetes. Serum MMP-2, -9, TIMP-1, -4 and B-type natriuretic peptide (BNP) were determined. Expression of MMPs, TIMPs, urokinase type-plasminogen activator (uPA), its receptor (uPAR) and plasminogen activator inhibitor-1 (PAI-1) in aortic intima and LV myocardium was evaluated, with gelatinolytic activities of tissue MMP-2, -9 accessed by zymography. Left ventricle end-diastolic septum thickness (P < 0.05) and mass (P < 0.05) were increased, whereas peak systolic mitral annulus velocity (Sm, P < 0.001), LV systolic (P = 0.01) and diastolic strain (P < 0.001) were significantly decreased in diabetic group than in controls. Diabetic group showed higher expression of TIMP-1, -4 in aortic intima and LV myocardium (P < 0.01 or P < 0.05), with increased collagen content and elevated serum BNP level (P = 0.004) and lower gelatinolytic activities of tissue MMP-2, -9 (all P < 0.05). Semi-quantitative RT-PCR of those diabetic tissues revealed elevated mRNA levels of major TIMPs, uPA, uPAR and PAI-1. Reduction of serum MMP-2 and -9 levels was observed in diabetic group vs. control group (both P < 0.05). This study features elevated levels of TIMP-1, -4, uPA, uPAR and PAI-1, and decreased activities of MMP-2, -9 in aorta and myocardium in STZ-induced diabetic minipigs, indicating that MMP–TIMP dysregulation is associated with LV hypertrophy, cardiac dysfunction and increased cardiovascular fibrosis in diabetes.

Keywords: diabetes mellitus, echocardiography, hypertrophy, left ventricular function, matrix metalloproteinase, tissue inhibitor of matrix metalloproteinase, urokinase type-plasminogen activator

Patients with diabetes mellitus have a high risk of developing extensive vascular remodelling and diabetic cardiomyopathy, which are associated with increased morbidity and mortality. Diverse mechanisms contribute to diabetic cardiovascular pathology, including disturbed turnover of extracellular matrix mainly through dysregulation of matrix metalloproteinases (MMPs) and their tissue inhibitors (TIMPs) in diabetes (Portik-Dobos et al. 2002; Bell 2003; Harris et al. 2005).

Diabetic animal models and cell culture studies have indicated that hyperglycaemia, oxidative stress and advanced glycation end products altered expression and secretion of MMPs and TIMPs, associated with extracellular matrix remodelling (Kadoglou et al. 2005; Tayebjee et al. 2005). MMP-2 and MMP-14 (membrane type 1 MMP) expression and activity were found reduced in coronary circulation of insulin resistant rats, which was related to accompanying peri-vascular fibrosis (Jesmin et al. 2003). Other studies observed a significant increase in levels of MMPs and extracellular matrix proteins in macro- and micro-vascular beds in type 2 diabetic rats, and altered MMP-1, -2, -3 and -9 levels in internal mammary arteries from diabetic patients at the time of coronary artery bypass grafting (Portik-Dobos et al. 2002; Chung et al. 2006, 2007; Song & Ergul 2006).

Diabetic cardiomyopathy is defined as cardiac dysfunction independent of atherosclerosis, coronary artery disease or hypertension (Guertl et al. 2000; Bell 2003). Data remain limited regarding myocardial levels and activities of MMPs and TIMPs in diabetic cardiomyopathy. One study observed increased myocardial fibrosis formation, capillary basement membrane thickening and left ventricle (LV) end diastolic pressure, in association with a reduction in capillary density and MMP-2 activity in the hearts of OLTEF diabetic rats (Hayashi et al. 2003). These findings were supported by other experiments of streptozotocin (STZ)-induced diabetic rats where protein expression of myocardial MMP-2 was significantly diminished, whereas MMP-9, TIMP-1 and -2 were unchanged (Bollano et al. 2007; Westermann et al. 2007).

MMP activity is modified at three levels: expression, activation and inhibition by TIMPs. Since MMPs are secreted from cells as zymogens, stepwise activation of latent enzymes often requires proteolytic cleavage by proteinases such as plasmin. The generation of plasmin from plasminogen by the action of plasminogen activators occurs largely at the cell surface, where both plasminogen and urokinase-type plasminogen activators (uPA) are bound to plasminogen-binding sites and uPA receptors (uPAR) respectively (Creemers et al. 2001). uPA has been found to be closely related to cardiovascular fibrosis in end-stage heart failure (Stempien-Otero et al. 2006). However, less information has been known on regulation of uPA, uPAR and plasminogen activator inhibitor-1 (PAI-1), the endogenous inhibitor of uPA in cardiovascular system in diabetes.

Because tissue biopsy of myocardium and large vessels in humans is obviously less feasible, measurements of blood MMPs and TIMPs are desirable for assessing pathophysiological status and also for research purposes. Previous studies on circulating levels of MMPs and TIMPs in diabetic patients with or without macro- and micro-vascular complications have yielded conflicting results (Maxwell et al. 2001; Derosa et al. 2005, 2007; Lee et al. 2005), raising the questions as to how well the evaluation of blood MMPs and TIMPs reflects the localized pathophysiological status in myocardium and vascular wall.

This study aimed to further assess the relationship between MMP–TIMPs and diabetic cardiomyopathy, characterizing LV geometry and function for the first time by Doppler tissue imaging in an established porcine model with STZ-induced diabetes (Lu et al. 2007; Zhang et al. 2007), and comparing the expression of detailed MMP–TIMP profile in aortic intima and LV myocardium as well as serum levels of these proteins between diabetic models and controls. In clinical cardiology, increased serum B-type natriuretic peptide (BNP) has been used as a marker of impaired LV function (Tsutamoto et al. 1997; McDonagh et al. 1998; Lubien et al. 2002). Serum BNP was also determined to evaluate porcine cardiac function in the present study.

Methods

Animals

Thirty-six Chinese Guizhou minipigs (male; age, 5–6 months; body weight, 20–25 kg) were obtained from Jiaotong University Agriculture College and raised in separated pens under controlled conditions in the Department of Animal for Scientific Research, Jiaotong University School of Medicine (Xi et al. 2004). All animals had normal day–night cycle, and room temperature was kept between 18 and 25 °C with continuous air changing. They were fed 200–250 g commercial plain porcine fodder (protein 15%; carbohydrate 50%; fat 5%, Shanghai Animal Fodder Factory, China) twice daily, and allowed to free access to water.

Four out of 19 STZ-induced diabetic minipigs and 2 out of 17 normal controls died of respiratory infection, and the remaining 30 minipigs constituted the study population (diabetic group, n = 15; control group, n = 15).

Six months after diabetic induction, the animals were euthanized while in anaesthetic status, with ketamine 5 mg/kg and metomidate 2–5 mg/kg after pre-medications.

Our investigation conformed to the Guide for the Care and Usage of Laboratory Animals published by the US National Institutes of Health (NIH Publication No 85-23, revised 1996).

Induction of diabetes with STZ

Diabetes mellitus was induced by intravenous administration of STZ (S0130, Sigma-Aldrich, St Louis, MO, USA) through an indwelling central venous catheter at a dose of 125 mg/kg after dissolving in sodium citrate buffer (pH 4.7), as previously described (Lu et al. 2007; Zhang et al. 2007). Blood glucose concentration was carefully monitored as severe hypoglycaemia usually appeared at 6–8 h after STZ dosing, requiring intravenous infusion of high concentration glucose solution.

Elevated blood glucose levels were always detected at the third or fourth day after STZ induction using one-touch SureStepPlus instrument (Johnson & Johnson Inc., Milpitas, CA, USA). Insulin therapy (Novolin@ 30R, Novo Nordisk A/S, Denmark) was initiated to maintain a fasting glucose level below 10 mmol/l.

Biochemical assessment and measurement of serum levels of MMP-2, -9 and TIMP-1, -4 and BNP

Blood sample was taken through the indwelling central venous catheter. Serum concentrations of glucose, alanine transaminase, asparagine transaminase, albumin, total protein, total cholesterol, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, lipoprotein (a), apoprotein A and apoprotein B, blood urea nitrogen and creatinine were measured by standard clinical laboratory methods before and 6 months after STZ administration. Commercially available ELISA kits specific for porcine MMP-2, -9, TIMP-1, -4, and BNP (Adlitteram Diagnostic Laboratories, San Diego, CA, USA) were used to measure serum proteins at 6 months.

Echocardiography and Doppler tissue imaging

The animals were anaesthetized during echocardiographic examination. Heart rate and arterial pressure were recorded with a multi-channel physiological system (Marquette, USA). M-mode, two-dimensional echocardiography and Doppler tissue imaging were performed with a 1.7/3.4 MHz transducer (GE Vivid 7, USA). All data were stored in disks for off-line analysis. Cardiac images were obtained in standard parasternal and apical views. Pulsed Doppler tissue imaging was acquired at the apical four-chamber view with the sample volume positioning at the septal side of mitral annulus (Feigenbaum 1999; Christoffersen et al. 2002; Xi et al. 2004). Gain was adjusted to yield velocity signals of maximal amplitude (Table 1).

Table 1.

Haemodynamics and echocardiographic measurements

Variables Control group Diabetes group P value
Heart rate (bpm) 118 ± 25 118 ± 24 0.58
Blood pressure (mmHg) 123 ± 27 155 ± 35 <0.01
Left ventricular
    End-diastolic diameter (mm) 30.8 ± 5.7 33.4 ± 5.2 0.35
    End-systolic diameter (mm) 18.6 ± 4.1 20.4 ± 6.8 0.51
    Ejection fraction (%) 67.2 ± 10.2 70.6 ± 12.9 0.56
    End-diastolic
    Septum thickness (mm) 7.8 ± 0.9 9.6 ± 2.1 0.03
    Posterior wall thickness(mm) 8.3 ± 1.3 9.7 ± 1.9 0.08
    Mass (g) 76.5 ± 25.7 118.4 ± 38.1 0.02
Peak early transmitral filling velocity (E) 69.9 ± 13.4 81.2 ± 22.1 0.21
Late transmitral filling velocity (A) 57.8 ± 14.8 48.4 ± 15.1 0.09
E/A ratio 1.2 ± 0.32 1.6 ± 0.45 0.02
Early diastolic mitral annular velocity (Em) 11.3 ± 3.7 8.4 ± 2.1 0.10
Late diastolic mitral annular velocity (Am) 11.8 ± 3.9 9.5 ± 1.8 0.09
Em/Am ratio 0.96 ± 0.25 0.91 ± 0.30 0.74
E/Em 6.5 ± 1.5 10.6 ± 5.3 0.03
Systolic mitral annular velocity (Sm) 11.6 ± 2.0 6.3 ± 0.92 <0.001
Systolic strain of left ventricular free wall −31.3 ± 10.3 −18.1 ± 6.2 0.01
Diastolic strain of left ventricular free wall −18.9 ± 5.1 −8.3 ± 2.9 <0.001
Open in a new tab

Left ventricular end-diastolic and end-systolic dimensions and wall thickness, peak early (E) and late (A) transmitral filling velocities were determined by standard method, and LV ejection fraction, mass and E/A ratio were calculated (Lubien et al. 2002). Early (Em), late diastolic (Am) and peak systolic (Sm) mitral annular velocities were measured, and Em/Am and E/Em (an index reflecting LV filling pressure) were calculated. Peak systolic and diastolic strain values of LV free wall were assessed (Feigenbaum 1999; Christoffersen et al. 2002; Moelker et al. 2006).

All echo-Doppler examinations were performed and images were interpreted by experienced cardiologists, who were blind to presence/absence of diabetes and biochemical, BNP and MMP measurements.

Evaluation of mRNA levels

After extraction of total RNA from aortic intima and LV myocardium using RNeasy Mini Kits (Qiagen, Valencia, CA, USA), 2 μg of RNA was then used as a template for cDNA synthesis with reverse transcription system kits (Promega, Madison, WI, USA). The cDNA PCR amplification was performed with primers specific for porcine MMPs and TIMPs as well as gene GAPDH. Oligonucleotide primer sets were designed based upon cDNA sequences of porcine MMPs and TIMPs from GeneBank or from previous literatures (Table 2) (Menino et al. 1997; Kimura et al. 2001; Fehrenbacher et al. 2003). Human or mouse cDNA sequence-based primers were used to amplify porcine MMP-15, -16 and uPAR gene since porcine counterparts were not available. As expected, the sequences of PCR products of porcine MMP-15, -16 and uPAR gene were highly homologue to those of human or mouse, determined by sequencing (data not shown).

Table 2.

Primers used to detect MMP genes

Gene Primer sequence (5′–3′) GeneBank accession number Product size (bp)
MMP-1 Sense CTAGTACTGTGAAGAATATCGATGC Antisense TCCTGCAGTTGAACCAGCTAT X54724 291
MMP-2 Sense GACAGTGACACCACGTGAC Antisense CAGGCGTCTGCAATGAGCT AF295805 345
MMP-3 Sense TGGCCACCTCTTCCTTCAAG Antisense GGAAAGTCTTCCACTATTTGCT AF069641 296
MMP-7 Sense GAGATGCTCACTTTGATGAGGA Antisense GAAACAAGGATGGAGGCAGT AB031323 364
MMP-9 Sense GGACGCCAAGTGTGGGTG Antisense GTCCACCTGATTCACCTCGT NM001038004 326
MMP-13 Sense CATGAGTTTGGCCATTCCTT Antisense GTGGCTTTTGCCAGTGTAGG AF069643 100
MMP-14 Sense CCCTACCCTCCCAAATGTTA Antisense CTAACTAGGTGGTTGCTCTCACT AF067419 486
MMP-15 Sense GTGGTGCAGATGGAGGAGGT Antisense TCCTGCAGCGAGCGCTTGCAGT BC036495 161
MMP-16 Sense GTGATGGACCAACAGACAGAG Antisense CACCCACTCTTGCATAGAGCG BC075004 227
TIMP-1 Sense CATAGCTGGACAACTGTGGA Antisense AGGTGCACATTCCTGGCTC NM213857 275
TIMP-2 Sense CAAAGCCGTCAGCGAGAAG Antisense CCAGTCCATCCAGAGACACT AF156030 391
TIMP-3 Sense CTCTGCAACTCCGACATCGT Antisense ATTGGAGAGCATGTCTGTCC AF156031 411
TIMP-4 Sense ACAGACCCAGGTGACACTCAA antisense GCTTCATGCAGACATAATGCTGG AF156032 415
uPA Sense GTCTGGTGAATCGAACTGTGGC Antisense GGCTGCAAACCAAGGCTG Stempien-Otero et al. 2006; 538
uPAR Sense GAGCTGTGAGAGGGGC Antisense GTTCCCCTCACAGCTGTAACACTGG NM011113 274
PAI-1 Sense CCATTACTACGACATCCTGGA Antisense GTTGTGCCGCACCACGAACAG Y11347 421
GAPDH Sense ACGACCATGGAGAAGGCTG Antisense TCGTACGAGGAAATGAGCTTG AF017079 638
Open in a new tab

MMP, matrix metalloproteinases; TIMP, tissue inhibitor of metalloproteinases; uPA, UPAR, urokinase type-plasminogen activator; UPAR, urokinase type-plasminogen activator receptor; PAI-1, plasminogen activator inhibitor-1.

Semi-quantitative PCR amplification was performed as described previously (Gillespie et al. 2002). Briefly, in a final volume of 50 μL, PCR buffer, 10 pmol of sense and antisense primers, 2.5 units of Taq DNA polymerase (Promega, Madison, WI, USA), and 2–10 μL of template cDNA were mixed. The reaction profile for amplification in exponential phase consisted of an initial denaturation at 94 °C for 3 min, followed by a range of cycles at 94 °C for 30 s, 50–62 °C for 45 s, 72 °C for 45 s, and finally with a elongation step at 72 °C for 5 min. The PCR products of interest were visualized on 1.8% agarose gels, stained with ethidium bromide. These PCR conditions were determined empirically in two series of experiments, which were conducted to confirm that all amplifications increased exponentially and the plateau phase of the reaction had not been reached. For this purpose, we amplified 2–10 μL of cDNA and chose a range of cycles starting from the minimum number necessary to visualize the product on 1.8% agarose gel (for MMPs, TIMPs and GAPDH).

Densitometry was performed using SigmaGel measurement software (Jandel Corporation, San Rafael, CA, USA) in order to calculate the normalized band intensity for each PCR product at the different experimental conditions.

Tissue explant incubation

Incubation of tissue explants (aortic intima and LV myocardium) in RPMI medium with 1% BSA and 2% HEPES buffer solution (IM) supplement was made under sterile conditions (37 °C, 5% CO2) for 24 h. Medium was then collected and stored at −70 °C before usage. Exploration of secreted proteins in the conditioned medium contributed to understanding of pathophysiological role of MMP–TIMP in the diseased process, and could also bypass the influence of structural proteins in vessel wall and artefacts formed in the extraction procedures.

Gel zymography

Samples of tissue culture medium were processed for analysis by gelatin zymography. Rat lung conditioned medium was used as positive control for MMP-2 and -9. This method detected the primary gelatinases, including MMP-2 and -9, secreted by the tissue. Briefly, culture medium was diluted in 1:1 with SDS sample buffer (0.5 M Tris [pH 6.8], 2.0%SDS, 10% glycerol and bromophenol blue) without proteinase inhibitors, and were subjected to electrophoresis in a 7.5% polyacrylamide gel containing 0.1% gelatin. Gels were then washed in 2.5% Triton X-100 buffer twice for 30 min at room temperature to remove SDS, permitting renaturation of the proteins. Finally, the gels were incubated in buffer (0.05 M Tris [pH 7.8], 10 mM CaCl2) at 37 °C for 16 h and then stained with Coomassie blue R-250. Gels were subsequently scanned with an imaging densitometer, with transmittance correlating to activity (Badier-Commander et al. 2000; Carvalho et al. 2006).

Western blotting

Aortic intima and LV myocardium were homogenized with a polytron homogenizer in Mammalian Protein Extraction Reagent (Pierce, Rockford, IL, USA). The supernatant containing the protein was collected, and protein concentrations were determined according to the method of Bradford (Bradford 1976). Western blotting of proteins in extraction reagent and conditioned medium separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA) was conducted as previously described (Bradford 1976). Equal loading was verified with Ponceau Red staining on the membranes following protein transfer. Anti-human/rat antibody MMP-2 (sc-10736, Santa Cruz, USA), MMP-9 (sc-6841, Santa Cruz, USA), TIMP-1 (sc-5538, Santa Cruz, USA) and TIMP-4 (sc-30076, Santa Cruz, USA), according to Santa Cruz Biotech, cross-react with porcine counterparts. Therefore, they were used to detect protein expression in porcine aorta and myocardium, and in culture medium of these tissues, while using rat heart tissue as positive controls. Membrane was incubated with primary antibody and horseradish peroxidase-conjugated secondary antibody was detected using ECL chemiluminescent system (Amersham Biosciences, Piscataway, NJ, USA). Band intensity was quantified by scanning densitometry. Blots of proteins in extraction reagent were probed with α-tubulin antibody (sc-51503, Santa Cruz, USA) to ensure equal loading.

Immunohistochemical examination

Aorta, left ventricle and pancreas in both groups were isolated and fixed in neutral paraformaldehyde for several days. The fixed specimens were embedded in paraffin and sectioned into slices (3 μm) with a Leica RM 2165 microtome. Tissue sections were de-paraffinized and treated with hydrogen peroxide before blockade with serum. Primary antibody against MMP, TIMP or porcine insulin (sc-8033, Santa Cruz, USA) was incubated with tissue sections at a dilution of 1/100. Immunoblotting was observed after addition of horseradish peroxidase coupled secondary antibodies and DAB (DAKO, Denmark). Sirius red staining was used to visualize the collagen fibres in aorta and myocardium (Koike et al. 2007).

Statistical analysis

Biochemical data and band intensity for autoradiographic and zymographic experiments were quantified and graphically expressed as mean ± SD. All experiments were replicated at least three times, with each replicate employing independent aorta and myocardium isolations. Quantified image data in experiments from normal or diabetic minipigs were compared using anova, whereas differences in serum biochemical data before and after STZ induction and between groups were assessed by t-test using spss for Windows 13.0 (SPSS Inc., Chicago, IL, USA). A value of P < 0.05 was considered statistically significant.

Results

Baseline characteristics

At 6 months, body weight was lower (22.4 ± 5.1 kg vs. 38.5 ± 5.9 kg, P < 0.01) and, in contrast, fasting glucose level was higher (7.18 ± 4.83 mmol/l vs. 2.3 ± 0.85 mmol/l, P < 0.001) in diabetic group than in controls. White blood cell counts, liver and kidney function, and lipid profiles did not differ significantly between the two groups (data not shown). In diabetic group, immunohistochemical examination displayed critically impaired pancreatic islet with almost disappearance of islet β cells (data not shown). Significant difference was observed in fasting and 2-h postprandial glucose levels after vs. those before STZ induction in diabetic group (P < 0.01), similar to our previous results (Lu et al. 2007).

Echocardiographic measurements

At 6 months, blood pressure was significantly elevated in diabetic group than in controls (155 ± 35 mmHg vs. 123 ± 27 mmHg, P < 0.01), but heart rate was similar. No apparent differences in LV end-diastolic and end-systolic dimensions, ejection fraction and posterior wall thickness were observed between the two groups. However, end-diastolic inter-ventricular septum thickness was greater in diabetic group (P < 0.05), resulting in an increase in LV mass (P < 0.05). Notably, Doppler tissue imaging showed a remarkable reduction in Sm, peak systolic and diastolic strain of LV free wall in the diabetic group (all P < 0.01), coinciding with an associated increase in E/Em ratio (P < 0.05), jointly indicating abnormal systolic and diastolic function. E/A ratio was unexpectedly increased in diabetic group (P < 0.05), which occurred less likely in the same stage of human diabetes but concurring with previous findings in C57BL/6 mice with STZ-induced diabetes (Yu et al. 2007).

Gelatinolytic activities of MMPs and levels of MMPs and TIMPs in conditioned medium of aorta and myocardium

To investigate functional activities of major proteinases in extracellular matrix, zymography of MMP-2 and MMP-9 produced in aortic intima and LV myocardium was performed (Figure 1). The gelatinolytic activities of the active and pro-forms of MMP-2 and MMP-9 were greatly suppressed in conditioned medium of diabetic aortic intima (all P < 0.05, Figure 1a,c) and LV myocardium (all P < 0.05, Figure 1b,d), compared with controls. Moreover, lower MMP-2 level was evident in conditioned medium of aortic intima (P < 0.01, Figure 2a) and LV myocardium (P < 0.01, Figure 2b) in diabetic group, while MMP-9 level was similar (Figure 2c,d). Significant elevation of TIMP-1 (P < 0.01, Figure 2f) and TIMP-4 levels (P < 0.05, Figure 2h) was observed in conditioned medium of LV myocardium in diabetic group. These TIMP protein levels, however, did not differ greatly from controls in aortic intima (Figure 2e,g).

Figure 1.

Figure 1

Open in a new tab

Zymography of MMP-2 and -9 in aortic intima and left ventricular (LV) myocardium. Conditioned medium of aortic intima and LV containing equal amount of protein was diluted with sodium dodecyl sulphate sample buffer and subjected to electrophoresis in a 7.5% polyacrylamide gel containing 0.1% gelatin for 4 h. After washing in 2.5% Triton X-100 buffer, the gels were incubated in buffer (0.05 M Tris [pH 7.8], 10 mM CaCl2) at 37 °C for 16 h and then stained with Coomassie blue R-250 to observe active (lower band) and pro MMP-2 (two upper bands), active MMP-9 (lower band) and pro MMP-9 (upper band). Aortic intima (a,c), LV myocardium (b, d); C+, control; #P < 0.01, &P < 0.05.

Figure 2.

Figure 2

Open in a new tab

Levels of MMP-2, -9 and TIMP-1, -4 in conditioned medium of aortic intima and left ventricular myocardium. Equal amount of proteins in conditioned medium was separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane. The membrane was incubated with primary antibody (MMP-2, -9, TIMP-1 and -4) and horseradish peroxidase-conjugated secondary antibody was detected using ECL chemiluminescent system. Aortic intima (a, c, e, g), left venticular myocardium (b, d, f, h); C+, control; #P < 0.01, &P < 0.05.

Expression and mRNA levels of MMP and TIMP in aorta and myocardium

Expression of MMP-2, -9, TIMP-1 and -4 in aortic intima and LV myocardium is shown in Figure 3. Marked elevation of blood glucose for 6 months alters MMP–TIMP expression to a large extent. Interestingly, TIMP-1 and -4 levels increased significantly in aortic intima (both P < 0.01, Figure 3e,g) and LV myocardium (P < 0.01 and P < 0.05, respectively, Figure 3f,h) in diabetic group, basically similar to the results of conditioned medium study. However, MMP-2 and -9 levels did not differ in LV myocardium between the two groups.

Figure 3.

Figure 3

Open in a new tab

Expression of MMP-2, -9 and TIMP-1, -4 in aortic intima and left ventricular (LV) myocardium. Aortic intima and LV myocardium in extraction buffer were homogenized. Equal amount of proteins was separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane. The membrane was incubated with primary antibody and horseradish peroxidase-conjugated secondary antibody was detected using ECL chemiluminescent system. Aortic intima (a, c, e, g), left venticular myocardium (b, d, f, h); C+, control; #P < 0.01, &P < 0.05.

Immunohistochemistry disclosed more abundant expression of TIMP-1 and -4 in aortic intima and LV myocardium of diabetic minipigs (Figure 4), where distinct collagen formation unfolded (Figure 5), as compared with controls. In contrast, limited difference was noted with respect to MMP-2 and -9 expression in these tissues between the two groups (Figure 5), which parallel to data obtained by Western blots. Furthermore, substantial expression of TIMP-1 and TIMP-4 was discovered in adventitia of diabetic aorta, associated with critical collagen accumulation (data not shown). However, their expression did not appear discrepant between aortic intima and adventitia in controls (data not shown).

Figure 4.

Figure 4

Open in a new tab

Immunohistochemistry of MMP-2, -9, TIMP-1 and -4 in aortic intima and left (LV) ventricular myocardium. Aorta and LV sample were fixed, processed and sectioned. Tissue sections were incubated with primary antibody against MMP or TIMP. Immunoblotting was observed after addition of horseradish peroxidase coupled secondary antibodies and DAB. Ao, aortic intima; V, LV myocardium. Significant increased TIMP-1 and -4 expression was observed in aortic intima and LV myocardium of diabetic minipigs.

Figure 5.

Figure 5

Open in a new tab

Histological evaluation of collagen in aortic intima and left ventricular myocardium. Sections of aorta and left ventricular (LV) myocardium were stained with Sirius red to visualize the collagen fibres. Ao, aortic intima; V, left ventricular myocardium. Increased collagen I (yellowish) and collage III (greenish) content was observed in aortic intima and LV myocardium of diabetic minipigs.

The mRNA levels of MMP–TIMPs in aortic intima and LV myocardium were summarized in Table 3 and Figure 6. In diabetic group, mRNA levels of major TIMPs were significantly elevated, including TIMP-1 (all P < 0.01) and TIMP-2 (all <0.01) in aortic intima and LV myocardium, and TIMP-3 (P < 0.01) and TIMP-4 (P < 0.01) in LV myocardium (TIMP-4 mRNA in aortic intima was too lower to be detected). The expression of major MMPs was nevertheless discordant. Increased mRNA levels of MMP-1 (P < 0.01), MMP-7 (P < 0.05) and MMP-13 (P < 0.001) were distinct in aortic intima, so was MMP-9 (P = 0.05) in myocardium, while decreased MMP-7 level (P < 0.05) concomitantly occurred in LV myocardium, with no obvious changes in MMP-2 and -3 levels in tissue. As some proteinase such as MMP-2 and -9 can be induced by membrane type MMP, further analysis was made on mRNA levels of MMP-14 (MT1-MMP), MMP-15 (MT2-MMP) and MMP-16 (MT3-MMP). Interestingly, these three MT-MMPs were consistently elevated in aortic intima (MMP-14, P < 0.001; MMP-15, P < 0.05; MMP-16, P < 0.01, respectively), but not in LV myocardium in diabetic group. In addition, the mRNA levels of uPA, uPAR and PAI-1 were increased in both aortic intima (P < 0.01 or P < 0.05) and LV myocardium in diabetic group (P < 0.01 or P < 0.05).

Table 3.

Densitometry data corresponding to histograms in Figure 6

mRNA/ GAPDH ratio Controls Diabetes P value
MMP-1
    Aorta 0.893 ± 0.075 1.267 ± 0.072 0.003
    Ventricle 0.891 ± 0.061 0.897 ± 0.075 0.955
MMP-2
    Aorta 1.065 ± 0.181 1.18 ± 0.111 0.402
    Ventricle 1.033 ± 0.112 1.14 ± 0.115 0.315
MMP-3
    Aorta 0.939 ± 0.081 0.94 ± 0.125 0.991
    Ventricle 0.842 ± 0.235 1.05 ± 0.213 0.318
MMP-7
    Aorta 0.134 ± 0.037 0.992 ± 0.183 0.012
    Ventricle 0.264 ± 0.044 0.177 ± 0.018 0.034
MMP-9
    Aorta NA NA
    Ventricle 0.44 ± 0.07 0.736 ± 0.171 0.050
MMP-13
    Aorta 1.498 ± 0.297 3.68 ± 0.256 <0.001
    Ventricle 0.838 ± 0.131 0.756 ± 0.157 0.524
MMP14
    Aorta 0.059 ± 0.010 0.691 ± 0.027 <0.001
    Ventricle 0.101 ± 0.010 0.095 ± 0.025 0.730
MMP-15
    Aorta 0.094 ± 0.020 0.689 ± 0.125 0.013
    Ventricle 0.258 ± 0.054 0.273 ± 0.012 0.670
MMP-16
    Aorta 0.844 ± 0.098 1.88 ± 0.165 0.002
    Ventricle 0.587 ± 0.052 0.575 ± 0.136 0.900
TIMP-1
    Aorta 0.683 ± 0.144 1.405 ± 0.152 0.004
    Ventricle 0.526 ± 0.080 0.887 ± 0.100 0.008
TIMP-2
    Aorta 0.578 ± 0.094 1.507 ± 0.192 0.002
    Ventricle 0.758 ± 0.120 1.437 ± 0.204 0.008
TIMP-3
    Aorta 1.197 ± 0.372 1.387 ± 0.240 0.497
    Ventricle 0.927 ± 0.101 1.483 ± 0.180 0.009
TIMP-4
    Aorta NA NA
    Ventricle 0.36 ± 0.082 0.990 ± 0.140 0.003
uPA
    Aorta 0.246 ± 0.023 0.749 ± 0.203 0.013
    Ventricle 0.122 ± 0.024 0.503 ± 0.072 0.007
uPAR
    Aorta 0.515 ± 0.045 0.63 ± 0.0436 0.034
    Ventricle 1.037 ± 0.111 1.261 ± 0.073 0.042
PAI-1
    Aorta 0.827 ± 0.087 1.14 ± 0.082 0.010
    Ventricle 0.983 ± 0.148 1.507 ± 0.180 0.018
Open in a new tab

NA, not detected because of low expression. See Table 2 for details of abbreviations.

Figure 6.

Figure 6

Open in a new tab

mRNA levels of MMPs and TIMPs in aortic intima and left ventricular (LV) myocardium by RT-PCR. Total RNA of aortic intima and LV myocardium was extracted using RNeasy Mini Kits and RT was done. Semi-quantitative PCR amplification was performed to amplify porcine MMPs, TIMPs, uPA, uPAR and PAI-1 as well as gene GAPDH with primers (listed in Table 2). The PCR products of interest were visualized on 1.8% agarose gels, stained with ethidium bromide.

Serum levels of BNP, MMP and TIMP

Serum BNP level was significantly higher in diabetic group than in controls (269.9 ± 58.2 vs. 183.7 ± 62.2 pg/ml, P < 0.01). In diabetic group, serum levels of MMP-2 (0.41 ± 0.45 vs. 2.78 ± 3.01 ng/ml, P < 0.05) and MMP-9 (7.1 ± 3.4 vs. 18.4 ± 13.3 ng/ml, P < 0.05) were significantly decreased, but serum TIMP-1 level was, in contrast to determination of conditioned medium or tissue lysate, only slightly increased.

Discussion

Diabetes is associated with accelerated vasculo- and cardiomyopathy in which extracellular matrix undergoes structural and functional changes. To our knowledge, few studies have been done to explore MMP–TIMP in diabetic porcine models with LV geometric and functional abnormalities resembling clinical status. The present study demonstrated detailed information regarding dysregulation of MMP–TIMP profile, uPA, its receptor and PAI-1 in aorta and LV myocardium in STZ-induced diabetic minipigs at 6 months, associated with systolic and diastolic cardiac dysfunction unravelled by Doppler tissue imaging and increased cardiovascular collagen content as well.

Association of decreased MMPs and increased TIMPs with LV hypertrophy and dysfunction

In the present study, diabetic minipigs manifested a significant increase in end-diastolic septum thickness and LV mass at 6 months. Doppler tissue imaging showed a remarkable reduction in Sm and systolic/diastolic strain of LV free wall, with a consequent elevation in E/Em ratio as compared with controls, indicating the occurrence of LV hypertrophy and dysfunction. These findings were further substantiated by an almost 50% increase in serum BNP level in diabetic group vs. controls. Jointly, these results suggest that STZ-induced diabetes for 6 months is sufficient to engender cardiovascular remodelling with obvious functional impairment.

Our results showed that protein expression and mRNA levels of major TIMPs were significantly increased in aortic intima, LV myocardium and in tissue conditioned media. In contrast, gelatinolytic activities as well as levels of MMP-2 and -9 were reduced remarkably. Studies of diabetic rats observed similar alterations of localized MMP and TIMP levels in key areas of the arterial tree, accompanying with perivascular fibrosis (Song & Ergul 2006; Westermann et al. 2007). As cardiovascular extracellular matrix displays a dynamic equilibrium where there is constant synthesis, degradation and reorganization, it is warrant to believe that a decrease in MMP activity and/or an increase in TIMP level contribute to extracellular matrix accumulation and fibrosis in diabetic minipigs.

Differential regulation of MMP genes in diabetic minipigs

Our study showed discordant regulation of various MMP genes in the same tissue specimen and dissimilar expression of the same MMP gene between the aortic intima and LV myocardium. Other study also noted opposite regulation of MMP-2 and -9 vs. MMP-1 and -3 in human type 2 diabetic arterial vasculature (Guertl et al. 2000; Chung et al. 2006). Whether these features were caused by pathophysiological mechanisms or due to sample variation remains uncertain.

Relation between increased uPA, uPAR and PAI-1 and diabetic cardiomyopathy

Our study demonstrates increased mRNA levels of uPA, uPAR and PAI-1 in diabetic aorta and myocardium. Similar alteration has been observed in diabetic nephropathy in STZ-treated rats, where mesangial expansion occurred with type IV collagen protein accumulation (Kenichi et al. 2004). Because uPA, uPAR and PAI-1 are key regulators in the generation of plasmin from plasminogen, and plasmin plays a major role in extracellular matrix degradation through activation of MMPs, altered expression of these factors are potentially related to abnormal MMP activity, which subsequently contributes to disturbed turnover of extracellular matrix.

Discrepancy of MMP and TIMP levels between serum and tissues in diabetes

In the present study, serum MMP-2 and -9 levels were found lower in diabetic group, consistent with the results from conditioned medium and zymography study. However, no statistical difference was observed in serum TIMP-1 level between the two groups, indicating that distortion could occur when only serum levels were used to reflect local pathophysiology. Circulating MMPs and TIMPs have been studied for years in the presence/absence of diabetes to explore feasibility of predicting existing or upcoming cardiovascular events as markers (Jesmin et al. 2003; Derosa et al. 2005, 2007; Lee et al. 2005; Stempien-Otero et al. 2006). One disappointing aspect of these studies has been the conflicting results. Our results suggest that caution should be taken in assessing pathology of coronary arterial tree solely based upon serum levels of MMPs and TIMPs, as these proteins exist ubiquitously and differentially regulated in pathologic lesion of different organs.

Clinical implications

It is clear that diabetic cardiomyopathy is accompanied by excessive cardiac fibrosis. This pathologic process, based upon the findings from studies including ours, was associated with attenuated proteolysis and augmented collagen production in extracellular matrix mediated by dysregulation of MMP–TIMP, activation of inflammatory cytokines and rennin–angiotensin system, increased endothelin production and decreased myocardial nitric oxide content (Tyaqi & Hayden 2003; Kenichi et al. 2004; Asbun et al. 2005; Sachidanandam et al. 2007). Hyperglycaemia, hyperhomocysteinaemia, oxidative stress and formation of advanced glycation end products in diabetes are major causes, jointly contributing to above-mentioned pathophysiology among which MMP–TIMP dysregulation is generated through complex signalling in various cells (Jesmin et al. 2003).

Till now, no explicit clinical information has been available regarding whether patients with diabetic cardiomyopathy benefit from early intervention of MMP–TIMP dysregulation. Established cardiovascular drugs are associated with changes in structure and turnover of extracellular matrix. Ramipril, an angiotensin-converting enzyme inhibitor, reduced MMP-2 and increased TIMP-4 in rat models of systolic heart failure associated with a marked reduction of LV dilatation (Seeland et al. 2002). Beta-blocker therapy in paced dogs receiving angiotensin II as a model of diastolic heart failure demonstrated improvement of LV relaxation and decreased tissue MMP concentration and activation (Senzaki et al. 2000). It is also evident that lipid-lowering therapy could significantly reduce circulating MMP-9 and TIMP-1 in diabetic patients with end-stage arterial and renal disease (Nakamura et al. 2003). However, effect of therapeutic intervention on diabetic cardiovascular remodelling associated with inhibition of MMP–TIMP changes merits further investigations.

Finally, our results have come from works with STZ-induced diabetic porcine models, it is, therefore, important to bear in mind that the toxin itself may have an effect on tissue structure, and proteinase concentration and function. In addition, this study did not separate specific effects of diabetes from secondary hypertension. As secondary hypertension alone could be a significant contributor to altered collagen metabolism resulting in relative cardiac fibrosis.

Conclusion

The present study demonstrates reduced activities and expression of MMP-2, -9 and elevated levels of TIMP-1, -4, uPA, uPAR and PAI-1 in aortic intima and LV myocardium in STZ-induced diabetic minipigs at 6 months, associated with LV hypertrophy, increased collagen content and cardiac dysfunction. Circulating levels of MMPs or TIMPs may not reflect veritably their local features in cardiovascular system. These results should provide a better understanding of pathophysiology, which may ultimately lead to effective treatment of diabetic vasculo- and cardiomyopathy in humans.

Competition of interest

None.

References

  1. Asbun J, Manso AM, Villarreal FJ. Profibrotic influence of high glucose concentration on cardiac fibroblast functions: effects of losartan and vitamin E. Am. J. Physiol. Heart Circ. Physiol. 2005;288:H227–H234. doi: 10.1152/ajpheart.00340.2004. [DOI] [PubMed] [Google Scholar]
  2. Badier-Commander C, Verbeuren T, Lebard C, Michel JB, Jacob MP. Increased TIMP/MMP ratio in varicose veins: a possible explanation for extracellular matrix accumulation. J. Pathol. 2000;192:105–112. doi: 10.1002/1096-9896(2000)9999:9999<::AID-PATH670>3.0.CO;2-1. [DOI] [PubMed] [Google Scholar]
  3. Bell DS. Diabetic cardiomyopathy. Diabetes Care. 2003;26:2949–2951. doi: 10.2337/diacare.26.10.2949. [DOI] [PubMed] [Google Scholar]
  4. Bollano E, Omerovic E, Svensson H, Waagstein F, Fu M. Cardiac remodeling rather than disturbed myocardial energy metabolism is associated with cardiac dysfunction in diabetic rats. Int. J. Cardial. 2007;114:195–201. doi: 10.1016/j.ijcard.2006.01.027. [DOI] [PubMed] [Google Scholar]
  5. Bradford MM. Rapid and sensitive method for quantification of microgram quantities of protein utilizing principle of protein–dye binding. Anal. Biochem. 1976;72:248. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  6. Carvalho RF, Dariolli R, Justulin Junior LA, et al. Heart failure alters matrix metalloproteinase gene expression and activity in rat sheletal muscle. Int. J. Exp. Pathol. 2006;87:437–443. doi: 10.1111/j.1365-2613.2006.00497.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Christoffersen C, Goetze JP, Bartels ED, et al. Chamber-dependent expression of brain natriuretic peptide and its mRNA in normal and diabetic pig heart. Hypertension. 2002;40:54–60. doi: 10.1161/01.hyp.0000021780.21830.dd. [DOI] [PubMed] [Google Scholar]
  8. Chung AW, Hsiang YN, Matzke LA, McManus BM, van Breemen C, Okon EB. Reduced expression of vascular endothelial growth factor paralleled with the increased angiostatin expression resulting from the upregulated activities of matrix metalloproteinase-2 and -9 in human type 2 diabetic arterial vasculature. Circ. Res. 2006;99:140–148. doi: 10.1161/01.RES.0000232352.90786.fa. [DOI] [PubMed] [Google Scholar]
  9. Chung AW, Luo H, Tejerina T, van Breemen C, Okon EB. Enhanced cell cycle entry and mitogen-activated protein kinase-signaling and downregulation of matrix metalloproteinase-1 and -3 in human diabetic arterial vasculature. Atherosclerosis. 2007;195:e1–e8. doi: 10.1016/j.atherosclerosis.2007.01.011. [DOI] [PubMed] [Google Scholar]
  10. Creemers E, Cleutjens J, Smits J, Daemen M. Matrix metalloproteinase inhibition after myocardial infarction: a new approach to prevent heart failure? Circ. Res. 2001;89:201–210. doi: 10.1161/hh1501.094396. [DOI] [PubMed] [Google Scholar]
  11. Derosa G, Avanzini MA, Geroldi D, et al. Matrix metalloproteinase 2 may be a marker of microangiopathy in children and adolescents with type 1 diabetes mellitus. Diabetes Res. Clin. Pract. 2005;70:119–125. doi: 10.1016/j.diabres.2005.03.020. [DOI] [PubMed] [Google Scholar]
  12. Derosa G, Cicero AF, Scalise F, et al. Metalloproteinase-2 and -9 in diabetic and nondiabetic subjects during acute coronary syndromes. Endothelium. 2007;14:45–51. doi: 10.1080/10623320601177064. [DOI] [PubMed] [Google Scholar]
  13. Fehrenbacher A, Steck E, Rickert M, Roth W, Richter W. Rapid regulation of collagen but not metalloproteinase 1, 3, 13, 14 and tissue inhibitor of metalloproteinase 1, 2, 3 expression in response to mechanical loading of cartilage explants in vitro. Arch. Biochem. Biophys. 2003;410:39–47. doi: 10.1016/s0003-9861(02)00658-6. [DOI] [PubMed] [Google Scholar]
  14. Feigenbaum H. Echocardiography. 6. Philadephia, Pa: Lea and Febiger; 1999. [Google Scholar]
  15. Gillespie DL, Fileta APB, Chang A, et al. Varicose veins possess greater quantities of MMP-1 than normal veins and demonstrate regional variation in MMP-1 and MMP-13. J. Surg. Res. 2002;106:233–238. doi: 10.1006/jsre.2002.6455. [DOI] [PubMed] [Google Scholar]
  16. Guertl B, Noehammer C, Hoefler G. Metabolic cardiomyopathies. Int. J. Exp. Pathol. 2000;81:349–372. doi: 10.1046/j.1365-2613.2000.00186.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Harris AK, Hutchinson JR, Sachidanandam K, et al. Type 2 diabetes causes remodeling of cerebrovasculature via differential regulation of matrix metalloproteinase and collagen synthesis: role of endothelin-1. Diabetes. 2005;54:2638–2644. doi: 10.2337/diabetes.54.9.2638. [DOI] [PubMed] [Google Scholar]
  18. Hayashi T, Sohmiya K, Ukimura A, Endoh S, Mori T, Shimomura H. Angiotensin II receptor blockade prevents microangiopathy and preserved diastolic function in the diabetic rat heart. Heart. 2003;89:1236–1242. doi: 10.1136/heart.89.10.1236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jesmin S, Sakuma I, Hattori Y, Kitabatake A. Role of angiotensin II in altered expression of molecules responsible for coronary matrix remodelling in insulin-resistant diabetic rats. Arterioscler. Thromb. Vasc. Biol. 2003;23:2021–2026. doi: 10.1161/01.ATV.0000094235.78783.D1. [DOI] [PubMed] [Google Scholar]
  20. Kadoglou NP, Daskalopoulou SS, Perrea D, Liapis CD. Matrix metalloproteinases and diabetic vascular complications. Angiology. 2005;56:173–189. doi: 10.1177/000331970505600208. [DOI] [PubMed] [Google Scholar]
  21. Kenichi M, Masanobu M, Takehiko K, et al. Renal synthesis of urokinase type-plasminogen activatior, its receptor, and plasminogen activator inhibitor-1 in diabetic nephropathy in rats: modulation by angiotensin-converting-enzyme inhibitor. J. Lab. Clin. Med. 2004;144:69–77. doi: 10.1016/j.lab.2004.04.002. [DOI] [PubMed] [Google Scholar]
  22. Kimura A, Kihara T, Ohkura R, Ogiwara K, Takahashi T. Localization of bradykinin B2 receptor in the follicles of porcine ovary and increased expression of matrix metalloproteinase-3 and -20 in cultured granulose cells by bradykinin treatment. Biol. Reprod. 2001;65:146–1470. doi: 10.1095/biolreprod65.5.1462. [DOI] [PubMed] [Google Scholar]
  23. Koike MK, Frimm Cde C, Curi M. Low coronary driving pressure early in the course of myocardial infarction is associated with subendocardial remodelling and left ventricular dysfunction. Int. J. Exp. Pathol. 2007;88:279–290. doi: 10.1111/j.1365-2613.2007.00540.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lee SW, Song KE, Shin DS, et al. Alterations in peripheral blood levels of TIMP-1, MMP-2 and MMP-9 in patients with type 2 diabetes. Diabetes Res. Clin. Pract. 2005;69:175–179. doi: 10.1016/j.diabres.2004.12.010. [DOI] [PubMed] [Google Scholar]
  25. Lu L, Zhang Q, Pu LJ, et al. Elevation of tumor necrosis factor-alpha, interleukin-1beta and interleukin-6 levels in aortic intima of Chinese Guizhou Minipigs with streptozotocin-induced diabetes. Chin. Med. J. 2007;120:479–484. [PubMed] [Google Scholar]
  26. Lubien E, DeMaria A, Krishnaswamy P, et al. Utility of B-natriuretic peptide in detecting diastolic dysfunction : comparison with doppler velocity recordings. Circulation. 2002;105:595–601. doi: 10.1161/hc0502.103010. [DOI] [PubMed] [Google Scholar]
  27. Maxwell P, Timms P, Chandran S, Gordon D. Peripheral blood level alterations of TIMP-1, MMP-2 and MMP-9 in patients with Type 1 diabetes. Diabet. Med. 2001;18:777–780. doi: 10.1046/j.1464-5491.2001.00542.x. [DOI] [PubMed] [Google Scholar]
  28. McDonagh TA, Robb SD, Murdoch DR. Biochemical detection of left ventricular systolic dysfunction. Lancet. 1998;351:9–13. doi: 10.1016/s0140-6736(97)03034-1. [DOI] [PubMed] [Google Scholar]
  29. Menino AR, Hogan A, Schultz GA, Novak S, Dixon W, Foxcroft GH. Expression of proteinases and proteinase inhibitors during embryo-uterine contact in the pig. Dev. Genet. 1997;21:68–74. doi: 10.1002/(SICI)1520-6408(1997)21:1<68::AID-DVG8>3.0.CO;2-6. [DOI] [PubMed] [Google Scholar]
  30. Moelker AD, Baks T, van den Bos EJ, et al. Reduction in infarct size, but no functional improvement after bone marrow cell administration in a porcine model of reperfused myocardial infarction. Eur. Heart J. 2006;27:3057–3064. doi: 10.1093/eurheartj/ehl401. [DOI] [PubMed] [Google Scholar]
  31. Nakamura T, Matsuda T, Suzuki Y, Ureda Y, Koide H. Effects of low-density lipoprotein apheresis on plasma matrix metalloproteinase-9 and serum tissue inhibitor of metalloproteinase-1 levels in diabetic haemodialysis patients with arteriosclerosis obliterans. ASAIO J. 2003;49:430–434. [PubMed] [Google Scholar]
  32. Portik-Dobos V, Anstadt MP, Hutchinson J, Bannan M, Ergul A. Evidence for a matrix metalloproteinase in induction/activation system in arterial vasculature and decreased synthesis and activity in diabetes. Diabetes. 2002;51:3063–3068. doi: 10.2337/diabetes.51.10.3063. [DOI] [PubMed] [Google Scholar]
  33. Sachidanandam K, Portik-Dobos V, Harris AK, et al. Evidence for vasculoprotective effects of ETB receptors in resistance artery remodeling in diabetes. Diabetes. 2007;56:2753–2758. doi: 10.2337/db07-0426. [DOI] [PubMed] [Google Scholar]
  34. Seeland U, Kouchi I, Zolk O, Itter G, Linz W, Bohm M. Effect of ramipril and furosemide treatment on interstitial remodeling in post-infarction heart failure rat hearts. J. Mol. Cell Cardiol. 2002;34:151–163. doi: 10.1006/jmcc.2001.1497. [DOI] [PubMed] [Google Scholar]
  35. Senzaki H, Paolocci N, Gluzband YA, et al. Beta-blockade prevents sustained metalloproteinase activation and diastolic stiffening induced by angiotensin II combined with evlving cardiac dysfunction. Circ. Res. 2000;86:807–815. doi: 10.1161/01.res.86.7.807. [DOI] [PubMed] [Google Scholar]
  36. Song WW, Ergul A. Type 2 diabetes-induced changes in vascular extracellular matrix gene expression: Relation to vessel size. Cardiovasc. Diabetol. 2006;5:3. doi: 10.1186/1475-2840-5-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Stempien-Otero A, Plawman A, Meznarich J, Dvamenahalli T, Otsuka G, Dichek DA. Mechanisms of cardiac fibrosis induced by urokinase plasminogen activator. J. Biol. Chem. 2006;281:15345–15351. doi: 10.1074/jbc.M512818200. [DOI] [PubMed] [Google Scholar]
  38. Tayebjee MH, Lip GYH, MacFadyen RJ. What role do extracellular matrix changes contribute to the cardiovascular disease burden of diabetes mellitus? Diabet. Med. 2005;22:1628–1635. doi: 10.1111/j.1464-5491.2005.01675.x. [DOI] [PubMed] [Google Scholar]
  39. Tsutamoto T, Wada A, Maeda K. Attenuation of compensation of endogenous cardiac natriuretic peptide system in chronic heart failure: prognostic role of plasma brain natriuretic peptide concentration in patients with chronic symptomatic left ventricular dysfunction. Circulation. 1997;350:1347–1351. doi: 10.1161/01.cir.96.2.509. [DOI] [PubMed] [Google Scholar]
  40. Tyaqi SC, Hayden MR. Role of nitric oxide in matrix remodeling in diabetes and heart failure. Heart Fail Rev. 2003;8:23–28. doi: 10.1023/a:1022138803293. [DOI] [PubMed] [Google Scholar]
  41. Westermann D, Rutschow S, Jager S, et al. Contributions of inflammation and cardiac matrix metalloproteinase activity to cardiac failure in diabetic cardiomyopathy: the role of angiotensin type 1 receptor antagonism. Diabetes. 2007a;56:641–646. doi: 10.2337/db06-1163. [DOI] [PubMed] [Google Scholar]
  42. Xi S, Yin W, Wang Z, et al. A minipig model of high-fat/high-sucrose diet-induced diabetes and atherosclerosis. Int. J. Exp. Pathol. 2004;85:223–231. doi: 10.1111/j.0959-9673.2004.00394.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Yu X, Tesiram YA, Towner RA, et al. Early myocardial dysfunction in streptozotocin-induced diabetic mice : a study using in vivo magnetic resonance imaging (MRI) Cardiovasc. Diabetol. 2007;6:6. doi: 10.1186/1475-2840-6-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zhang Q, Lu L, Pu LJ, et al. Neointimal hyperplasia persists at six months after sirolimus-eluting stent implantation in diabetic porcine. Cardiovasc. Diabet. 2007;6:16. doi: 10.1186/1475-2840-6-16. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from International Journal of Experimental Pathology are provided here courtesy of Wiley

RESOURCES