Skip to main content
BMC Research Notes logoLink to BMC Research Notes
. 2008 Aug 12;1:64. doi: 10.1186/1756-0500-1-64

Streptococcus pneumoniae early response genes to human lung epithelial cells

Xin-Ming Song 1,✉, Wayne Connor 1, Karsten Hokamp 2, Lorne A Babiuk 3, Andrew A Potter 1
PMCID: PMC2527573  PMID: 18710517

Abstract

Background

Streptococcus pneumoniae infection starts from colonization of the host respiratory tract where interaction with host respiratory tract epithelial cells occurs. To investigate pneumococcal genes that are involved in the early stage of interaction with host epithelial cells, transcriptional responses of an encapsulated pathogenic pneumococcal strain TIGR4 upon exposure to human lung epithelial cells A549 for 0.5 h and 1 h time periods were investigated by using TIGR (JCVI) microarray technology. Gene expression changes were validated by quantitative real-time PCR (qRT-PCR) analysis.

Findings

We observed different transcriptional profiles at two incubation time periods in which most gene expressions were down-regulated at 0.5 h but up-regulated at 1 h. Many genes associated with ribonucleotide biosynthesis were down-regulated at both time points, whereas the genes associated with cell envelope, energy metabolism, transport and protein synthesis were mostly up-regulated at 1 h. Furthermore, these profiles were compared to the transcriptomes of a TIGR4-derived strain in response to human macrophages for the same time periods. We found one set of genes that exhibited similar expression changes upon exposure to both types of host cells, including cell envelope-associated bgaA (SP0648) and nanA (SP1693), and uncharacterized gene clusters such as SP1677–SP1680 and SP1688–SP1690.

Conclusion

These data indicate that at the early stage of interaction with host epithelial cells, a complex gene regulation and expression change occur in bacteria. Some of them might play an essential role during pathogen-host interactions and for the establishment of infection.

Findings

Background

As a major bacterial pathogen, Streptococcus pneumoniae infection starts from colonization of the human upper respiratory tract, causing respiratory tract diseases such as pneumonia, bronchitis, otitis media and sinusitis. Under certain circumstances, bacteria invade host cells and evade host immunity, causing systemic infections such as bacteremia, sepsis and meningitis. Therefore, the interaction of S. pneumoniae with host respiratory tract epithelial cells is an initial step for infection. Many factors that contribute to the colonization and/or invasion of host epithelial cells have been characterized in S. pneumoniae (recently reviewed by: [1-3]). However, it is becoming obvious that multiple factors are involved in this complex process [4].

Microarray-based transcriptome studies have been used in many pathogens, investigating their transcriptional responses to host cells [5]. However, they were rarely performed at an early stage of interaction time period, a stage that might be critical for microbes to establish an infection. This is likely due to the difficulty of obtaining sufficient bacterial RNA from a mixture of bacteria and host cells. In S. pneumoniae, transcriptome studies were initiated by Orihuela et al. [6] in which an unencapsulated derivative of TIGR4 was investigated following exposure to human pharyngeal epithelial cells (Detroit 562) for 3 h. By using self-spotted pneumococcal oligonucleotide (oligo) microarrays we have also examined gene expression changes of an encapsulated serotype 3 clinical isolate and one unencapsulated avirulent laboratory strain following incubation with human lung epithelial cells (A549) for 1 h and 3 h, respectively [7]. Nevertheless, a lack of information exists regarding pneumococcal gene expression at an early stage of interaction with host cells. The strain-specific gene regulation features of S. pneumoniae [8] also prompted our research interests on other serotype strains.

In this study, we have developed a system which can be used to isolate enough bacterial RNA for microarray analysis from encapsulated pathogenic strains following incubation with A549 cells for a short time period. By using TIGR microarrays, we performed transcriptome studies on an encapsulated wild-type strain TIGR4. This study highlighted the gene transcriptional profiles in S. pneumoniae and revealed the potential roles of some target genes during pathogen-host interactions.

Methods

Incubation of bacteria and host cells

Culturing and incubation of pneumococcal strain TIGR4 (provided by Dr. Caroline A. Obert, St. Jude Children's Research Hospital) and human lung epithelial cells A549 were performed as previously described [7] with minor modifications. Briefly, bacteria grown to early logarithmic-phase at OD600 0.3 were collected by centrifugation, re-suspended in antibiotic-free MEM complete medium supplemented with 1% fetal bovine serum (FBS), and incubated with host cells in T75 flasks at a multiplicity of infection 120:1. After incubation, non-adherent bacteria were removed by washing 3 times with 5 ml of antibiotic-free cell culture medium. Host cells were removed by incubation with a host cell lysis buffer containing guanidine thiocyanate (Sigma), β-mercaptoethanol, phenol and ethanol at room temperature for 10 min. Bacterial samples were collected by centrifugation for RNA isolation. Bacteria incubated with cell culture medium for different time points, treated with RNALater (Ambion), were collected as medium control samples.

Preparation of bacterial RNA

Isolation of bacterial RNA was performed with RiboPure™-Bacteria Kit (Ambion) or a modified method using RNeasy MiniKit (Qiagen) as previously described [7]. From each flask of cell infection, about 2~4 μg bacterial total RNA with less than 10% of eukaryotic RNA contamination could be generated. Medium control RNA samples at each incubation time point were generated by pooling RNAs isolated from 3 separate assays. Genomic DNA contamination was removed by the treatment with RNase-free of DNase I (Ambion).

Microarray experiment and analysis

TIGR (J. Craig Venter Institute) S. pneumoniae 70-mer oligo microarray (version 6), provided by the Pathogen Functional Genomics Resource Center (PFGRC), was used in this study. The cDNA synthesis, Cy-dye labelling, and microarray hybridization were carried out according to TIGR's standard operating procedures (SOPs) http://www.tigr.org. Hybridization signals were captured with a GenePix 4200A scanner (Axon Instruments) and the data were processed and analyzed through ArrayPipe http://www.pathogenomics.ca/arraypipe[9]. This includes flagging of marker spots, background correction, printTip Loess normalization with Limma, and statistical analysis with Limma's eBayes moderated t-test [10]. Gene expressions of fold change ≥ 2.0 (bacteria incubated with host cells vs. bacteria incubated with media) with statistical significance (p ≤ 0.05) were classified as being significantly changed. In this study, eight independent hybridizations, including four labelled in dye flips, using RNA samples isolated from eight separate assays were performed for each incubation time point.

Quantitative real-time PCR (qRT-PCR) analysis

The oligo primers used for qRT-PCR analysis (Table 1) were designed from S. pneumoniae TIGR4 genome sequences by using Clone Manager Suite 7 (Scientific & Educational Software) and synthesized by Invitrogen. The qRT-PCR reaction and analysis were performed as previously described [7]. For each gene, duplicate reactions were performed on the RNA samples isolated from at least two separate assays for each incubation time point.

Table 1.

Oligonucleotide primers used for qRT-PCR analysis

Gene name TIGR4 genome acc. No. Oligonucleotide primers 5' to 3' Amplified product (bp)
purH SP0050 Sense: TCAAGCAACCAATGCGTTACGGTGAG 110
Anti-sense: TTTCCCGTTGAGCTGTTTGGCTGAAG
strH SP0057 Sense: GTGTCAGCCCAAGCAGCTACCATACCAC 128
Anti-sense: GGCCAAGGCTGGTACAATCTCGATCAGG
cbpI SP0069 Sense: GCTATGAAGACAGGCTGGTACAAG 133
Anti-sense: TCACAGCCAAAGCTCCTGAAC
nrdD SP0202 Sense: TGCAACCAAGCGGATGTATCCAGACG 99
Anti-sense: TGAAGGAAAGAACGGCAGCCCATAGG
SP0287 Sense: CAGTCGGTGCCATTGCAGGTACTTCAAAC 103
Anti-sense: GCTACAACCAAGGCTGTCAAACCAGTACG
caps4A SP0346 Sense: GTCAGAGTATCCAGACTACGCATCGAAG 159
Anti-sense: TCTGATCGCGACACCGAACTAATAGG
bgaA SP0648a Sense: CAAGCCAGCCGTGAACGCTATAAGG 128
Anti-sense: GAGTGGGCAGTCAGGGTGAATTTCC
gyrA SP1219a Sense: GTGCTGCCGCTCAACGTTATACCGAGG 142
Anti-sense: AAACGCGCTGGCAAGACCAAGGGTTCC
pyrR SP1278 Sense: GACAGACCGCGAAGTTATCTTGGTGG 115
Anti-sense: AACTGCTAAACTCACACGCGCAGGAC
SP1679 Sense: GGACAGGGGATTACAGTTGATGAGATGG 149
Anti-sense: GCAGTTGCAGCTACCCTACTTAAGATCG
SP1680 Sense: GCCTGCATAACCATTTGGCTGATGTG 127
Anti-sense: AGCATTCGACGAAGCGAGTGACATTG
SP1688 Sense: AAGTGAACGAAGGGCTACTGCTACTGTC 136
Anti-sense: GCTACCGATTGTAGCACCAGGTATTG
nanA SP1693 Sense: GACATATTCGAAAGCGGGCGTAACGG 117
Anti-sense: GCGTTCATCTGCACCTGCGATCAAAG
purR SP1979a Sense: AGGCAGCCGTGTCTTGATTGTGG 120
Anti-sense: TTGTCCGCAAAGACCGCTACACC

a. Obtained from [7].

Results and discussion

Transcriptional responses of S. pneumoniae to host epithelial cells

Microarray analysis revealed many gene expression changes following exposure to A549 cells (Table 2). At 0.5 h, most gene expressions were down-regulated (35 vs. 16) and a smaller number of genes changed (Fig. 1). At 1 h, more genes were changed and most of them were up-regulated (50 vs. 25) (Fig. 2). Furthermore, most of those changed genes were only defined at a certain incubation time period (Fig. 3). These data indicate divergent transcriptional profiles between 0.5 h and 1 h incubation time periods. Repressed transcriptional profiles at 0.5 h (Fig. 1) suggest that the interaction with human respiratory tract epithelial cells, a natural reservoir for S. pneumoniae, might be a favourable situation for pneumococci. This is in contrast to the S. pneumoniae transcriptomes to macrophages, where most genes that showed transcriptional changes at the early stage of interactions were up-regulated (Song XM, Connor W, Hokamp K, Babiuk LA, Potter AA: Transcriptome studies on Streptococcus pneumoniae, illustration of early response genes to THP-1 human macrophages, submitted). When incubated for 1 h, bacterial survival, growth and virulence mechanisms appear to be activated, apparent from an induced expression of genes in cell envelope, energy metabolism, transport, protein synthesis, and hypothetical proteins (Fig. 2).

Table 2.

Microarray identified genes in pneumococcal strain TIGR4 upon exposure to A549 cells for 0.5 h and 1 h time periods

Function/gene name Protein TIGR4 genome acc. No. Incubation time

0.5 h 1 h
Cell envelope
cbpI a choline binding protein I SP0069 2.8
cps4A capsular polysaccharide biosynthesis protein Cps4A SP0346 2.9
cps4B capsular polysaccharide biosynthesis protein Cps4B SP0347 2.0
cps4C capsular polysaccharide biosynthesis protein Cps4C SP0348 3.3
cps4E capsular polysaccharide biosynthesis protein Cps4E SP0350 2.9
cps4I UDP-N-acetylglucosamine-2-epimerase SP0357 2.4
bgaA β-galactosidase SP0648 17.0
nanA a neuraminidase A, authentic frameshift SP1693 16.5
Energy metabolism
agaS sugar isomerase domain protein AgaS SP0065 5.6
pyk pyruvate kinase SP0897 -2.7
glgA glycogen synthase SP1124 3.8
acetoin dehydrogenase complex, E2 component, dihydrolipoamide acetyltransferase, putative SP1162 2.7
zwf glucose-6-phosphate 1-dehydrogenase SP1243 -2.7
scrB sucrose-6-phosphate hydrolase SP1724 3.0 4.4
galT galactose-1-phosphate uridylyltransferase SP1852 2.7
galK galactokinase SP1853 2.3
recP transketolase SP2030 -3.6
arcA arginine deiminase SP2148 4.6
gplK glycerol kinase SP2186 3.0
Hypothetical proteins
conserved hypothetical protein SP0024 -2.6
hypothetical protein SP0026 -2.3
hypothetical protein SP0052 -3.5 -5.6
hypothetical protein SP0067 2.4 2.1
conserved hypothetical protein SP0095 -2.4
conserved hypothetical protein SP0159 -2.3
hypothetical protein SP0190 2.3
hypothetical protein SP0203 -2.5
conserved hypothetical protein SP0207 -2.1
conserved hypothetical protein SP0288 -4.2 -2.2
conserved hypothetical protein SP0742 -2.9
conserved hypothetical protein SP0951 2.4
conserved hypothetical protein SP1003 2.1
hypothetical protein SP1049 2.0
hypothetical protein SP1059 4.4
conserved hypothetical protein SP1174 2.4
hypothetical protein SP1198 2.7 2.6
hypothetical protein SP1199 2.9 2.0
conserved hypothetical protein SP1601 2.4
hypothetical protein SP1677 10.3
hypothetical protein SP1678 2.9 6.1
hypothetical protein SP1679 4.6 9.6
conserved hypothetical protein SP1680 5.3 11.5
hypothetical protein SP2183 2.7 4.1
Others
bacteriocin, putative SP0109 2.3
lactose phosphotransferase system repressor, degenerate SP0169 2.2
dihydropteroate synthase SP0289 -2.2 -2.1
acpP acyl carrier protein SP0418 -2.0
fabF 3-oxoacyl-(acyl-carrier-protein) synthase II SP0422 -2.4
accD acetyl-CoA carboxylase, carboxyl transferase subunit beta SP0426 -2.4
accA acetyl-CoA carboxylase, carboxyl transferase subunit alpha SP0427 -3.4
ilvB acetolactate synthase, large subunit, biosynthetic type SP0445 -2.8
zmpB zinc metalloprotease ZmpB SP0664 -2.1
ilvE branched-chain amino acid aminotransferase SP0856 -2.0
preprotein translocase, SecG subunit, putative SP0974 2.5
asd aspartate-semialdehyde dehydrogenase SP1013 -2.0
bta bacterocin transport accessory protein SP1499 -2.7 -2.4
transcriptional regulator, MerR family SP1856 2.0
groEL chaperonin, 60 kDa SP1906 -2.4
Protein synthesis
rpsD ribosomal protein S4 SP0085 2.7
rpsJ ribosomal protein S10 SP0208 4.1
rplW ribosomal protein L23 SP0211 2.9
rpsC ribosomal protein S3 SP0215 2.0
infA translation initiation factor IF-1 SP0232 2.4
valS valyl-tRNA synthetase SP0568 -2.1
rplK ribosomal protein L11 SP0630 2.5
infC translation initiation factor IF-3 SP0959 2.5
rpml ribosomal protein L35 SP0960 3.9
rpsR ribosomal protein S18 SP1539 2.8
rpsF ribosomal protein S6 SP1541 2.9 3.0
rpmH ribosomal protein L34 SP1993 2.4
rpmG ribosomal protein L33 SP2135 2.1
yfiA ribosomal subunit interface protein SP2206 -3.9
Purine and pyrimidine ribonucleotide biosynthesis
purA adenylosuccinate synthetase SP0019 -2.5
purC a phosphoribosylaminoimidazole-succinocarboxamide synthase SP0044 -5.1 -4.7
purH phosphoribosylaminoimidazolecarboxamide formyltransferase-IMP cyclohydrolase SP0050 -15.3 -4.1
purE a phosphoribosylaminoimidazole carboxylase, catalytic subunit SP0053 -6.4 -8.5
purK a phosphoribosylaminoimidazole carboxylase, ATPase subunit SP0054 -2.4
nrdD anaerobic ribonucleoside-triphosphate reductase SP0202 -4.4 -4.3
nrdG anaerobic ribonucleoside-triphosphate reductase activating protein SP0205 -3.4 -2.8
thyA thymidylate synthase SP0669 -2.2
pyrK dihydroorotate dehydrogenase, electron transfer subunit SP0963 -3.6
nrdH NrdH-redoxin SP1178 -2.1
carB carbamoyl-phosphate synthase, large subunit SP1275 -4.2
pyrR pyrimidine operon regulatory protein SP1278 -2.1 -7.8
guaA a GMP synthase SP1445 -2.4
purR pur operon repressor SP1979 -2.7 -2.3
Transport
PTS system, IIA component SP0064 2.2 3.4
PTS system, mannose-specific IID component SP0282 -3.7
xanthine-uracil permease family protein SP0287 -8.4 -5.3
O-antigen transporter RfbX, putative SP0356 2.5
PTS system, IIC component, putative SP0647 4.3
sugar ABC transporter, ATP-binding protein SP0846 -2.1
ABC transporter, permease protein SP1688 5.3
ABC transporter, permease protein SP1689 2.8
ABC transporter, substrate-binding protein SP1690 2.1
msmE sugar ABC transporter, sugar-binding protein SP1897 2.1
malD maltodextrin ABC transporter, permease protein SP2110 2.6
Unknown function
vanZ protein, putative SP0049 -2.9
ACT domain protein SP0238 -2.1 -3.4
HIT family protein SP0521 -2.4
gid Gid protein SP0943 -2.2
flavoprotein SP1231 -2.0
usp45 secreted 45 kd protein SP2216 2.1

a genes that are also involved in pathogenesis according to TIGR genome annotation

Figure 1.

Figure 1

Transcriptional profiles of functional categories of genes identified in microarray analysis at 0.5 h incubation time period. The number of differentially regulated genes (x-axis) identified in microarray analysis in S. pneumoniae TIGR4 following incubation with A549 cells for 0.5 h time period. They are represented in different functional categories (y-axis) and marked with up-regulated (open bars) and down-regulated (grey bars) expressions. No cell envelope genes were identified.

Figure 2.

Figure 2

Transcriptional profiles of functional categories of genes identified in microarray analysis at 1 h incubation time period. The number of differentially regulated genes (x-axis) identified in microarray analysis in S. pneumoniae TIGR4 following incubation with A549 cells for 1 h time period. They are represented in different functional categories (y-axis) and marked with up-regulated (open bars) and down-regulated (grey bars) expressions.

Figure 3.

Figure 3

Venn diagrams of microarray identified genes. The up-regulated (A) and down-regulated (B) genes in S. pneumoniae TIGR4 following incubation with A549 cells for 0.5 h (grey circles) and 1 h (open circles), respectively.

We also observed a common change between two incubation time points, that more than 10 purine and pyrimidine ribonucleotide biosynthesis genes, including purine and pyrimidine regulatory genes purR and pyrR, were consistently down-regulated (Table 2; Figs. 1, 2). The roles of ribonucleotide biosynthesis and their gene regulation mechanism in S. pneumoniae are largely unknown. However, down-regulation of these genes in pneumococci appears to occur only at an early stage of interaction with host epithelial cells, but not at 3 h [6,7]. It also might be specific to the pneumococcal strains and the types of host cells because most of those ribonucleotide biosynthesis genes were unchanged in a serotype 3 strain [7] or when the TIGR4-derived strain was exposed to the host macrophages (Song XM, Connor W, Hokamp K, Babiuk LA, Potter AA: Transcriptome studies on Streptococcus pneumoniae, illustration of early response genes to THP-1 human macrophages, submitted). Perhaps this is the shift of bacteria to parasitism enabling the uptake of substrates from the host cells [11], or the indication of metabolic changes in different pneumococcal strains in different host environment.

Microarray data have been deposited in the ArrayExpress microarray database http://www.ebi.ac.uk/arrayexpress under accession No. E-FPMI-15.

Microarray data validation

To confirm gene expression changes identified in microarray analysis, we performed qRT-PCR analysis on 16 selected genes at different incubation time point, most of them associated with cell envelope, ribonucleotide biosynthesis, SP1677-SP1680 and SP1688-SP1690 gene clusters. Except for the unchanged SP1680 at 0.5 h, all the other gene expressions changed in accordance to the microarray data, but at a greater average fold change in the qRT-PCR analysis (Figs. 4, 5). Expression change of SP0057 at 1 h was only obtained from qRT-PCR assay because the strain-specific oligo probes were absent on the microarrays (Fig. 5).

Figure 4.

Figure 4

Validation of up-regulated genes by qRT-PCR. The up-regulated genes identified in microarray (open bars) and qRT-PCR (grey bars) analyses. The characterized genes incubated with A549 cells for different time periods (0.5 h or 1 h) are marked on the x-axis. For consistency, each gene is indicated by the TIGR4 genome accession number (SP), not the gene name. The fold changes (mean) from all the repeated assays with standard deviations are marked on the y-axis. Scales on the y-axis (0~5, 5~250) are not continuous due to large changes for some genes.

Figure 5.

Figure 5

Validation of down-regulated genes by qRT-PCR. The down-regulated genes identified in microarray (open bars) and qRT-PCR (grey bars) analyses. The characterized genes incubated with A549 cells for different time periods (0.5 h or 1 h) are marked on the x-axis. For consistency, each gene is indicated by the TIGR4 genome accession number (SP), not the gene name. The fold changes (mean) from all the repeated assays with standard deviations are marked on the y-axis. Scales on the y-axis (0~-5, -5~-80) are not continuous due to large changes for some genes.

Common response genes to host cells

In a separate transcriptome study, we have investigated gene expression changes of a TIGR4-derived unencapsulated strain following incubation with human THP-1 derived macrophages for different time points (0.5 h, 1 h and 3 h) (Song XM, Connor W, Hokamp K, Babiuk LA, Potter AA: Transcriptome studies on Streptococcus pneumoniae, illustration of early response genes to THP-1 human macrophages, submitted). As similar experimental procedures and microarray technology were applied, we compared these two studies and revealed many common response genes at early interaction time periods, including well characterized virulence genes such as bgaA and nanA, and uncharacterized gene clusters such as SP1677-SP1680 (hypothetical) and SP1688-SP1690 (ABC transporter) (Table 3). It indicates common features in pneumococcal gene responses to different types of host cells. Although the interactions with host epithelial cells and macrophages are mainly associated with different pathogenesis processes, reflected by the colonization of host epithelial cells and the survival from host phagocytic cells, we assume these processes are closely related and some of those genes might be assigned with multiple functions.

Table 3.

Common response genes to both A549 cells and THP-1 derived macrophages at 0.5 h and 1 h incubation time periods

Function/gene name Protein TIGR4 genome acc. No. A549a THP-1b

0.5 h 1 h 0.5 h 1 h
Cell envelope
cbpIc choline binding protein I SP0069 2.8 8.4
bgaA beta-galactosidase SP0648 17.0 3.4 26.9
nanAc neuraminidase A, authentic frameshift SP1693 16.5 3.9 47.1
Energy metabolism
agaS sugar isomerase domain protein AgaS SP0065 5.6 10.3
glgA glycogen synthase SP1124 3.8 5.4
acetoin dehydrogenase complex, E2 component, dihydrolipoamide acetyltransferase, putative SP1162 2.7 4.9 6.0
scrB sucrose-6-phosphate hydrolase SP1724 3.0 4.4 2.4 4.7
galT galactose-1-phosphate uridylyltransferase SP1852 2.7 2.6 4.4
galK galactokinase SP1853 2.3 2.3 2.8
recP transketolase SP2030 -3.6 -2.0 -2.5
gplK glycerol kinase SP2186 3.0 4.1
Hypothetical proteins
hypothetical protein SP0052 -3.5 -5.6 -2.6 -3.5
hypothetical protein SP0067 2.4 2.1 4.1
conserved hypothetical protein SP0159 -2.3 -2.0
conserved hypothetical protein SP0742 -2.9 -6.5 -3.2
conserved hypothetical protein SP1003 2.1 2.1 3.4
hypothetical protein SP1059 4.4 56.3 16.0
conserved hypothetical protein SP1174 2.4 2.7 4.4
hypothetical protein SP1198 2.7 2.6 2.8
hypothetical protein SP1199 2.9 2.0 2.2
hypothetical protein SP1677 10.3 14.6
hypothetical protein SP1678 2.9 6.1 6.9
hypothetical protein SP1679 4.6 9.6 6.6
conserved hypothetical protein SP1680 5.3 11.5 2.0 14.6
Others
lactose phosphotransferase system repressor, degenerate SP0169 2.2 15.4 6.0
acpP acyl carrier protein SP0418 -2.0 -2.3
fabF 3-oxoacyl-(acyl-carrier-protein) synthase II SP0422 -2.4 -5.1
bta bacterocin transport accessory protein SP1499 -2.7 -2.4 -4.2 -2.2
Protein synthesis
rpsD ribosomal protein S4 SP0085 2.7 2.4
rpsJ ribosomal protein S10 SP0208 4.1 2.9
rpsC ribosomal protein S3 SP0215 2.0 2.2
infC translation initiation factor IF-3 SP0959 2.5 2.2 2.3
rpmI ribosomal protein L35 SP0960 3.9 2.2
rpsF ribosomal protein S6 SP1541 2.9 3.0 2.2
yfiA ribosomal subunit interface protein SP2206 -3.9 -2.6 -2.5
Purine and pyrimidine ribonucleotide biosynthesis
purCc phosphoribosylaminoimidazole-succinocarboxamide synthase SP0044 -5.1 -4.7 -2.4 -7.8
purH phosphoribosylaminoimidazolecarboxamide formyltransferase-IMP cyclohydrolase SP0050 -15.3 -4.1 -4.3 -5.5
purEc phosphoribosylaminoimidazole carboxylase, catalytic subunit SP0053 -6.4 -8.5 -4.2
carB carbamoyl-phosphate synthase, large subunit SP1275 -4.2 -2.6
pyrR pyrimidine operon regulatory protein SP1278 -2.1 -7.8 -2.3 -4.4
Transport
PTS system, IIA component SP0064 2.2 3.4 6.5
PTS system, mannose-specific IID component SP0282 -3.7 -2.4
xanthine-uracil permease family protein SP0287 -8.4 -5.3 -2.3
PTS system, IIC component, putative SP0647 4.3 3.5 8.2
ABC transporter, permease protein SP1688 5.3 2.4 13.6
ABC transporter, permease protein SP1689 2.8 3.7 18.9
ABC transporter, substrate-binding protein SP1690 2.1 3.9 21.6
msmE sugar ABC transporter, sugar-binding protein SP1897 2.1 4.1
malD maltodextrin ABC transporter, permease protein SP2110 2.6 2.1 6.4
Unknown function
vanZ protein, putative SP0049 -2.9 -3.4 -4.9
ACT domain protein SP0238 -2.1 -3.4 -2.3
HIT family protein SP0521 -2.4 -2.1
flavoprotein SP1231 -2.0 -2.3

a Genes identified in this study.

b Genes identified in Song XM, Connor W, Hokamp K, Babiuk LA, Potter AA: Transcriptome studies on Streptococcus pneumoniae, illustration of early response genes to THP-1 human macrophages, submitted.

c Genes that are also involved in pathogenesis according to TIGR genome annotation.

The exoglycosidase family genes

In S. pneumoniae, the bgaA-encoded β-galactosidase (BgaA) and the nanA-encoded neuraminidase (NanA) belong to a family of exoglycosidases exposed on the bacterial surface. Studies have demonstrated that both enzymes, especially NanA, are involved in adherence to host respiratory tract epithelial cells, possibly by clearing host cell surface structures and secreted components to enhance pathogen-host interactions [12-15]. Recently, it was demonstrated that BgaA and NanA, together with StrH (β-N-aceylglucosaminidase), act sequentially to remove sialic acid, galactose and N-acetylglucosamine [15]. These reports demonstrated the importance of S. pneumoniae to deglycosylate human targets during colonization and/or pathogenesis.

In this study, expression of bgaA (SP0648) and nanA (SP1693) was highly induced when incubated with A549 cells for 1 h in both microarray and qRT-PCR analyses (Table 2; Fig. 4). Further qRT-PCR assay revealed an unchanged expression of strH (SP0057) (Fig. 5), correlated to the previous observation that StrH was not involved in the adherence [15]. The enhanced expression of bgaA and nanA was also observed in a TIGR4-derived strain when exposed to human macrophages for 0.5 h and 1 h time periods (Table 3). It suggests that both bgaA and nanA belong to a family of conserved early response genes. Clearing host cell surface components and accessing to the host cells are a priority for bacteria at the early stage of pathogen-host interactions.

Other genes

The cbpI (SP0069), encoding choline binding protein I, was also up-regulated in expression (Table 2; Fig. 4). The choline binding proteins (CBPs) are a family of surface proteins, many of them are involved in colonization of nasopharynx [16]. However, cbpI was the only CBP gene that was identified in this study. The function of CbpI is still unclear but its crystal structure has been solved [17]. Whether it is important in colonization, most CBPs might not be required at the early stage of interaction with host epithelial cells.

Because of strain-specific gene regulations in S. pneumoniae [7,8], different microarray technologies and experimental conditions, some potential gene targets might be missed in our transcriptome studies. For example, the pspC (SP1417) gene was reported to be up-regulated in a serotype 2 strain D39 within 1 h post-infection in mice [18]. However, expression change of pspC was not identified in our assays, despite of a degenerated PspC carried by the TIGR4 genome (TIGR). Another unchanged gene cluster was the rlrA pathogenicity islet genes (SP0461-SP0468) encoding pneumococcal pili [19,20]. All of these TIGR4-specific oligo probes were carried by the TIGR microarrays, and they were clearly identified in our studies of the regulation mechanisms for the pilus locus genes (Song XM, Connor W, Hokamp K, Babiuk LA, Potter AA: The growth phase-dependent regulation of the pilus locus genes by two-component system TCS08 in Streptococcus pneumoniae, submitted). We could therefore exclude the technical concern for these genes in our microarray analysis. Earlier studies suggested that pneumococcal pili were mainly involved in the host cell adhesion [21]. Recently, Rosch, et al. defined the restricted functions of pili in invasion of host lung epithelial cells [22], suggesting its roles at a late stage of pathogen-host interactions. If this is the case, also supported by our negative findings, the rlrA pilus locus genes are not likely to be involved in the early stage of interaction with host epithelial cells.

Conclusion

The data presented here provide the first assessment of S. pneumoniae early response genes to human lung epithelial cells. It revealed gene expression changes that might be associated with bacterial adaptation, survival, growth and colonization. Up-regulation of several cell envelope genes, such as bgaA and nanA, and the genes with unknown functions, is likely required for a successful colonization. The specific roles of the identified genes and the functions of coordinated regulation of multiple genes have yet to be further investigated.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

XS designed project, obtained funding support, performed microarray and qRT-PCR assays, data analysis, manuscript preparation and editing. WC contributed to the microarray experimental assays and RNA isolation. KH provided critical support for the microarray data analysis and MIAME compliance. LAB and AAP provided funding support and participated discussions and manuscript preparation. All authors have read and approved the final manuscript.

Acknowledgments

Acknowledgements

We thank Dr. Caroline A. Obert, St. Jude Children's Research Hospital, Memphis, for providing S. pneumoniae strain TIGR4.

This work was gratefully supported by the Saskatchewan Health Research Foundation (SHRF) and the Delfari Bridging Fund of the University of Saskatchewan. Microarray slides and experimental protocols were kindly provided by the Pathogen Functional Genomics Resource Center (PFGRC) through NIAID. We also acknowledge the support of Genome Canada, Genome BC and Genome Prairie for the "Pathogenomics of Innate Immunity" research program.

Published with permission of the Director of VIDO as journal series No. 489

Contributor Information

Xin-Ming Song, Email: xinming.song@usask.ca.

Wayne Connor, Email: wayne.connor@usask.ca.

Karsten Hokamp, Email: karsten_hokamp@sfu.ca.

Lorne A Babiuk, Email: lorne.babiuk@ualberta.ca.

Andrew A Potter, Email: andrew.potter@usask.ca.

References

  1. Bergmann S, Hammerschmidt S. Versatility of pneumococcal surface proteins. Microbiology. 2006;152:295–303. doi: 10.1099/mic.0.28610-0. [DOI] [PubMed] [Google Scholar]
  2. Hammerschmidt S. Adherence molecules of pathogenic pneumococci. Curr Opin Microbiol. 2006;9:12–20. doi: 10.1016/j.mib.2005.11.001. [DOI] [PubMed] [Google Scholar]
  3. Mitchell TJ. Streptococcus pneumoniae : infection, inflammation and disease. Adv Exp Med Biol. 2006;582:111–124. doi: 10.1007/0-387-33026-7_10. [DOI] [PubMed] [Google Scholar]
  4. Hammerschmidt S, Wolff S, Hocke A, Rosseau S, Muller E, Rohde M. Illustration of pneumococcal polysaccharide capsule during adherence and invasion of epithelial cells. Infect Immun. 2005;73:4653–4667. doi: 10.1128/IAI.73.8.4653-4667.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Waddell SJ, Butcher PD, Stoker NG. RNA profiling in host-pathogen interactions. Curr Opin Microbiol. 2007;10:297–302. doi: 10.1016/j.mib.2007.05.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Orihuela CJ, Radin JN, Sublett JE, Gao G, Kaushal D, Tuomanen EI. Microarray analysis of pneumococcal gene expression during invasive disease. Infect Immun. 2004;72:5582–5596. doi: 10.1128/IAI.72.10.5582-5596.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Song XM, Connor W, Jalal S, Hokamp K, Potter AA. Microarray analysis of Streptococcus pneumoniae gene expression changes to human lung epithelial cells. Can J Microbiol. 2008;54:189–200. doi: 10.1139/w07-133. [DOI] [PubMed] [Google Scholar]
  8. Hendriksen WT, Silva N, Bootsma HJ, Blue CE, Paterson GK, Kerr AR, de Jong A, Kuipers OP, Hermans PW, Mitchell TJ. Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent. J Bacteriol. 2007;189:1382–1389. doi: 10.1128/JB.01144-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hokamp K, Roche FM, Acab M, Rousseau ME, Kuo B, Goode D, Aeschliman D, Bryan J, Babiuk LA, Hancock RE, Brinkman FS. ArrayPipe: a flexible processing pipeline for microarray data. Nucleic Acids Res. 2004;32:W457–9. doi: 10.1093/nar/gkh446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Smyth GK. Limma: linear models for microarray data. In: Gentleman RCVDSIRHW, editor. Bioinformatics and computational biology solutions using R and bioconductor. Springer, New York ; 2005. p. 397420. [Google Scholar]
  11. Cecchini KR, Gorton TS, Geary SJ. Transcriptional responses of Mycoplasma gallisepticum strain R in association with eukaryotic cells. J Bacteriol. 2007;189:5803–5807. doi: 10.1128/JB.00667-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Orihuela CJ, Gao G, Francis KP, Yu J, Tuomanen EI. Tissue-specific contributions of pneumococcal virulence factors to pathogenesis. J Infect Dis. 2004;190:1661–1669. doi: 10.1086/424596. [DOI] [PubMed] [Google Scholar]
  13. Manco S, Hernon F, Yesilkaya H, Paton JC, Andrew PW, Kadioglu A. Pneumococcal neuraminidases A and B both have essential roles during infection of the respiratory tract and sepsis. Infect Immun. 2006;74:4014–4020. doi: 10.1128/IAI.01237-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Tong HH, Blue LE, James MA, DeMaria TF. Evaluation of the virulence of a Streptococcus pneumoniae neuraminidase-deficient mutant in nasopharyngeal colonization and development of otitis media in the chinchilla model. Infect Immun. 2000;68:921–924. doi: 10.1128/iai.68.2.921-924.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. King SJ, Hippe KR, Weiser JN. Deglycosylation of human glycoconjugates by the sequential activities of exoglycosidases expressed by Streptococcus pneumoniae . Mol Microbiol. 2006;59:961–974. doi: 10.1111/j.1365-2958.2005.04984.x. [DOI] [PubMed] [Google Scholar]
  16. Gosink KK, Mann ER, Guglielmo C, Tuomanen EI, Masure HR. Role of novel choline binding proteins in virulence of Streptococcus pneumoniae . Infect Immun. 2000;68:5690–5695. doi: 10.1128/iai.68.10.5690-5695.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Paterson NG, Riboldi-Tunicliffe A, Mitchell TJ, Isaacs NW. Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae . Acta Crystallogr Sect F Struct Biol Cryst Commun. 2006;62:672–675. doi: 10.1107/S1744309106020616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Quin LR, Moore QC, 3rd, Thornton JA, McDaniel LS. Peritoneal challenge modulates expression of pneumococcal surface protein C during bacteremia in mice. Infect Immun. 2008;76:1122–1127. doi: 10.1128/IAI.01066-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Nelson AL, Ries J, Bagnoli F, Dahlberg S, Falker S, Rounioja S, Tschop J, Morfeldt E, Ferlenghi I, Hilleringmann M, Holden DW, Rappuoli R, Normark S, Barocchi MA, Henriques-Normark B. RrgA is a pilus-associated adhesin in Streptococcus pneumoniae . Mol Microbiol. 2007;66:329–340. doi: 10.1111/j.1365-2958.2007.05908.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hilleringmann M, Giusti F, Baudner BC, Masignani V, Covacci A, Rappuoli R, Barocchi MA, Ferlenghi I. Pneumococcal pili are composed of protofilaments exposing adhesive clusters of Rrg A. PLoS Pathog. 2008;4:e1000026. doi: 10.1371/journal.ppat.1000026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Barocchi MA, Ries J, Zogaj X, Hemsley C, Albiger B, Kanth A, Dahlberg S, Fernebro J, Moschioni M, Masignani V, Hultenby K, Taddei AR, Beiter K, Wartha F, von Euler A, Covacci A, Holden DW, Normark S, Rappuoli R, Henriques-Normark B. A pneumococcal pilus influences virulence and host inflammatory responses. Proc Natl Acad Sci U S A. 2006;103:2857–2862. doi: 10.1073/pnas.0511017103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Rosch JW, Mann B, Thornton J, Sublett J, Tuomanen E. Convergence of Regulatory Networks on the Pilus Locus of Streptococcus pneumoniae . Infect Immun. 2008. [DOI] [PMC free article] [PubMed]

Articles from BMC Research Notes are provided here courtesy of BMC

RESOURCES