Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2008 Sep 5.
Published in final edited form as: J Assist Reprod Genet. 2006 Aug 11;23(7-8):321–328. doi: 10.1007/s10815-006-9046-0

Analysis of the sex ratio in preimplantation embryos from B6.K1 and B6.K2 Ped gene congenic mice

Michael J Byrne 1, Judith A Newmark 2, Carol M Warner 3,
PMCID: PMC2529474  NIHMSID: NIHMS53951  PMID: 16902830

Abstract

Purpose

The mouse preimplantation embryo development (Ped) gene product, Qa-2, which is the homolog of human HLA-G, influences the rate of preimplantation embryonic development and overall reproductive success. The sex ratio in preimplantation embryos from Ped gene congenic mice was examined in order to determine whether embryo sex is a confounding factor in the control of the rate of preimplantation development.

Methods

B6.K1 (Ped slow) and B6.K2 (Ped fast) congenic mice differ only in the absence (B6.K1) or presence (B6.K2) of the genes encoding Qa-2 protein. We analyzed the sex of B6.K1 (n=221) and B6.K2 (n=260) preimplantation embryos by using Real-Time PCR with primers specific for the X and Y chromosomes.

Results

We found that there was no statistically significant difference in the ratio of male to female preimplantation embryos in either strain.

Conclusions

We conclude that the sex of the embryos is not a confounding factor that affects the Ped gene control of the rate of preimplantation development. Therefore, the Ped gene is entirely responsible for mediating the faster development of B6.K2 embryos compared to B6.K1 embryos.

Keywords: B6.K1, B6.K2, HLA-G, IVF, Ped gene, Preimplantation embryo, Qa-2, Sex ratio

Introduction

Survival of mammalian embryos during the preimplantation period is dependent on both environmental and genetic factors. In vitro fertilization (IVF) clinics rely upon the analysis of these factors and their effects on embryo development to identify healthy preimplantation embryos. In particular, a fast rate of preimplantation embryo development has been correlated with a higher chance of pregnancy success after IVF (reviewed in [1, 2]). Using the mouse as a model system our laboratory has identified a gene, the preimplantation embryo development (Ped) gene that influences the rate of preimplantation embryo development and subsequent embryo survival. The properties of the mouse Ped gene, and its human homolog HLA-G, have recently been reviewed [3, 4].

Qa-2 protein is encoded by four almost identical genes, Q6, Q7, Q8, and Q9, located in the Q region of the mouse major histocompatibility complex (MHC). The presence or absence of these genes and therefore the presence or absence of Qa-2 protein, confers a phenotype of fast or slow preimplantation development, respectively. As in human IVF embryos, mouse embryos with a fast rate of preimplantation development are more likely to give rise to live offspring than embryos with a slow rate of development [57]. The Ped gene phenotype is intrinsic to the embryos themselves, independent of the uterine environment, as demonstrated by the maintenance of differential cleavage rates when the embryos are cultured in vitro in a chemically defined medium [8].

The analysis of the properties of the Ped gene has been facilitated by the use of two congenic strains of mice, B6.K1 and B6.K2, which differ only in the presence or absence of the genes encoding Qa-2 protein (Table 1). Embryos from B6.K1 mice have a deletion of the Q6-Q9 genes, consequently do not express Qa-2 protein, and develop at a slow rate during the preimplantation period. Embryos from B6.K2 mice have all four Qa-2 encoding genes, but only express the Q9 gene in preimplantation embryos [9]. Therefore the Ped gene is synonymous with the Q9 gene in the B6.K2 mice. The presence of Qa-2 protein in the B6.K2 embryos results in a fast rate of preimplantation development.

Table 1.

MHC encoded Q region genes and Ped gene phenotype of the B6.K1 and B6.K2 congenic mouse strains

Strain Q Region genes Ped gene phenotype
B6.K1 Q1 Q2 Q3 Q4 Q5 Q10 slow
B6.K2 Q1 Q2 Q3 Q4 Q5 Q6 Q7 Q8 Q9a Q10 fast
a

Only the Q9 gene is expressed in B6.K2 preimplantation embryos and is therefore the sole gene that produces Qa-2 protein, the Ped gene product, in this strain (9)

Although the B6.K1 and B6.K2 congenic strains differ only in the expression of the Ped gene (Q9) product, Qa-2 protein, there is another genetic difference in the embryos from these strains, namely the sex of the embryos. We set up a study to determine whether or not the sex of preimplantation embryos from the B6.K1 and B6.K2 mice could be a confounding factor in influencing the rate of preimplantation development. Nested Real-Time PCR, using primers specific for the X and Y chromosomes, was used to determine the sex of the preimplantation embryos.

Materials and methods

Mice

The congenic B6.K1 and B6.K2 mouse strains were originally obtained from L. Flaherty (Wadsworth Center, Albany, NY) and subsequently bred in our laboratory. The mice were housed according to the NIH guidelines in an AAALAC approved facility with a 14 h day/10 h night cycled room (lights on 0400–1800 EST) with controlled temperature and food and water ad libitum. All experiments followed the NIH guidelines. The genetic properties of the B6.K1 and B6.K2 mice are shown in Table 1. Aside from the genes in the Q region of the MHC, all other genes in these congenic strains are identical.

Mouse embryos

Female mice were superovulated with 5 IU eCG (Sigma Chemical Co., St. Louis, MO) at the 9th hr of the light cycle, followed 48 h later by 10 IU of hCG (Sigma). Mice were mated, checked for vaginal plugs, and the plug-positive females were sacrificed by cervical dislocation. Embryos were collected at 89 h and 100 h post-hCG in KSOMAA (potassium simplex optimized medium + amino acids) (Specialty Medium, Phillipsburg, NJ) under 5% CO2, 5% O2, 90% N2 and then washed in KSOMAA. These time points were chosen for the collection of the preimplantation embryos because all morphologically normal embryos were at least at the morula stage of development, thereby having enough cells for the sex determination analysis as described below, and because implantation in mice starts about 104–106 h post-hCG [10]. Individual embryos were transferred in the smallest possible volume to a microfuge tube containing 4 µl lysis buffer [20 mM Tris (pH 8.0), 0.9% Tween 20, 0.9% Nonidet P-40, 0.4mg/mL of proteinase K] and centrifuged immediately for 60 sec at 14,000 × g. Samples were stored at −20°C until sexing by PCR analysis was performed. Prior to Ped gene (Q9) PCR analysis, blastocyst stage embryos were heated to 56°C for 45 min followed by 96°C for 10 min to inactivate proteinase K. This step was not necessary for embryo sex determination by PCR.

Isolation of spleen genomic DNA

B6.K1 and B6.K2 control DNA was extracted from male and female spleens. Extraction was performed following the protocol provided with the Qiagen DNeasy Tissue Extraction Kit (Qiagen Inc., Valencia, CA). The purity of the DNA was assessed by determining the 260/280 ratio using a Genosys 8 spectrophotometer (Thermo Spectronic, Madison, WI). The concentration of DNA was determined using a TBS-380 Mini-Fluorometer (Turner Biosystems Inc., Sunnyvale, CA). The DNA concentration of all samples was adjusted to give a total of 20 ng for each Real-Time PCR assay.

Ped gene (Q9) detection in splenocytes and blastocysts by Real-Time PCR

Primers designed to amplify a 200 bp fragment of exon 4 of the Ped gene (Q9) [11] were used at 900 nM each and were synthesized by Sigma-Genosys (Woodlands, TX) (Table 2). Twenty nanograms of splenocyte DNA was used for each splenocyte PCR sample and 5 blastocysts (about 800 pg of genomic DNA) were used for each blastocyst PCR sample for each strain. Briefly, as amplification of a PCR product occurs in the Real-Time PCR instrument, a fluorescent dye in the SYBR Green Master Mix (Applied Biosystems Inc.) binds to the double stranded DNA produced during each cycle. At the end of the PCR protocol the temperature is raised and the dissociation curve of melting temperature versus fluorescence derivative of the product is shown as a peak on the output screen. The thermal cycling conditions consisted of a 10 min hold at 95°C to activate the AmpliTaq Gold DNA Polymerase of the master mix followed by 55 cycles of 95°C for 15 sec to denature the sample, 55°C for 1 min for the annealing phase and 72°C for 30 sec to extend the product with a final step of 4°C for 2 min. The identity of the PCR products was confirmed by first determining the melting temperatures of the products from analysis of dissociation curves generated by the ABI Prism 7000 Real-Time PCR instrument (Applied Biosystems Inc., Foster City, CA), and then by confirming themolecular weights of the products by agarose gel electrophoresis.

Table 2.

Primer sequences, melting temperatures and molecular weights of Ped gene (Q9), Sry, and DXNds3 PCR products

Primer Sequence 5′-3′ Product Melting Temperature (°C) Molecular Weight
Ped gene (Q9)
  Forward CAGGTCTTATGGTGCTGTCA 85 200 bp
  Reverse GCATGTGTAATTCTGCTCCTTC
Sry gene
Outer N/A 404 bp
  Sry2 TCTTAAACTCTGAAGAAGAGAC
  Sry4 GTCTTGCCTGTATGTGATGG
Inner 82 147 bp
  Sry1 GTGAGAGGCACAAGTTGGC
  Sry3 CTCTGTGTAGGATCTTCAATC
DXNds3 microsatellite
Outer N/A 244 bp
  DXNds3 GAGTGCCTCATCTATACTTACAG
  DXNds4 TCTAGTTCATTGTTGATTAGTTGC
Inner 83 111 bp
  DXNds1 ATGCTTGGCCAGTGTACATAG
  DXNds2 TCCGGAAAGCAGCCATTGGAGA

Sex determination in splenocytes and embryos by Real-Time PCR

Primers amplifying the polymorphic X chromosome microsatellite locus DXNds3 and the Y chromosome Sry gene were used for the sexing nested PCR assay [1216]. Table 2 presents the sequence, expected size, and melting temperature of the products. Nested PCR performed on male embryos is expected to produce a Sry product and a DXNds3 product. The same nested PCR performed on female embryos is expected to produce only the DXNds3 product. Inner and outer primer pairs were synthesized by Sigma-Genosys (Woodlands, TX).

Each embryo lysate was subjected to two separate nested PCR reactions using the Real-Time PCR instrument along with splenocyte genomic DNA from mice whose sex was known serving as controls. The final 50 µl reaction volume consisted of 25 µl SYBR Green Master Mix (containing AmpliTaq Gold DNA Polymerase), 2 µl of the frozen, lysed embryo or 2 µl [100 pg and 50 pg in duplicate] of splenocyte genomic DNA from mice of known sex, and 300 nM of each primer for each outer primer set. The thermal cycling conditions consisted of a 10 min hold at 95°C to activate the AmpliTaq Gold DNA Polymerase of the master mix followed by 50 cycles of 95°C for 15 sec to denature the sample, 60°C for 1 min for the annealing phase and 72°C for 30 sec to extend the product. In the second round of PCR, 5 µl of the first round product were used as template DNA and 300 nM and 300 nM, and 600 nM and 900 nM of the inner primers were used for DXNds3 and Sry amplification, respectively. The secondary PCR conditions were the same as the primary PCR conditions with two exceptions: the annealing temperature was raised to 64°C and the cycle number was increased to 55. All samples analyzed showed the presence of DXNds3. The sex of each embryo was determined by the presence (males) or absence (females) of Sry.

Statistical analysis

As part of our pre-investigation procedure, we used a statistical power analysis to determine the sample size required for accurate results [17]. We determined that the minimum sample size needed was 50. We used a chi-square analysis to test the hypothesis that the number of male and female embryos should be equal.

Results

Prior to sexing the embryos, we performed Real-Time PCR on splenocytes and blastocysts from the B6.K1 and B6.K2 strains of mice to confirm that the B6.K1 strain does not possess the Ped gene (Q9) while the B6.K2 strain does possess the Ped gene (Q9). Figure 1 shows that the Ped gene (Q9) is present in B6.K2 splenocytes (lane 3) and B6.K2 blastocysts (lane 4) but absent in B6.K1 splenocytes (lane 5) and B6.K1 blastocysts (lane 6).

Fig. 1.

Fig. 1

Agarose gel electrophoresis of the product from Real-Time PCR amplification of the Ped gene (Q9) in B6.K1 and B6.K2 splenocytes and blastocyst stage embryos. Lane 1, 100 bp DNA ladder (MW); Lane 2, no template control (NTC); Lanes 3 and 4, B6.K2 splenocyte and blastocyst samples, respectively; Lanes 5 and 6, B6.K1 splenocyte and blastocyst samples, respectively

The sensitivity of the embryo sexing nested Real-Time PCR assay was tested by performing PCR on diluted control samples of both male and female B6.K1 and B6.K2 spleen genomic DNA. These experiments revealed that as little as 15 pg of genomic male and female DNA could be accurately distinguished using the nested Real-Time PCR protocol (data not shown). Since a 16 cell embryo (morula) contains about 80 pg of genomic DNA, the sensitivity of this assay was acceptable for sex determination of the individual embryos used in this study because all embryos tested were at least at the morula stage of development.

We determined the sex of 221 embryos from B6.K1 mice and 260 embryos from B6.K2 mice by using Real-Time PCR. Figure 2 presents Real-Time PCR data from the nested (second) round of PCR. Figures 2a and b show control amplification of B6.K2 spleen genomic DNA for the Sry gene (Y chromosome) and the DXNds3 microsatellite (X chromosome), respectively. As expected, amplification of Sry occurred only in the male DNA samples, while amplification of DXNds3 occurred in both the male and female DNA samples. Figures 2c and d show the same control samples but include examples of both male (n=3) and female (n=3) embryos. Male embryos showed both Sry and DXNds3 amplification while female embryos showed only DXNds3 amplification. Figure 3 is a representative gel showing control PCR products as well as examples of male and female embryo PCR products. Only the male control (lane 2) and the male embryos (lanes 4–6) had a Sry product of the expected size (Table 2) while all samples had the DXNds3 product of the expected size. Female embryo samples (lanes 7–9) have a minor band (<50 bp) when subjected to amplification of the Sry gene. This is most likely a dimerization between the primers due to a lack of template to bind to in these samples, which also accounts for the small nonspecific hump seen in the dissociation curve of these samples (Fig. 2c).

Fig. 2.

Fig. 2

Dissociation curves of nested Real-Time PCR of Sry and DXNds3 amplification. A) B6.K2 control genomic DNA amplification of the Sry gene product. B) B6.K2 control genomic DNA amplification of the DXNds3 product. C) B6.K2 control genomic DNA amplification of the Sry gene product plus representative male (n=3) and female (n=3) embryo amplification results. D) B6.K2 control genomic DNA amplification of the DXNds3 product plus representative male (n=3) and female (n=3) embryo amplification results. NTC=no template control

Fig. 3.

Fig. 3

Representative agarose gel confirming results presented in Fig. 2. Lane 1, 100 bp DNA ladder (MW); Lanes 2 and 3, male and female B6.K2 genomic DNA control samples, respectively; Lanes 4–6, male embryo samples; Lanes 7–9, female embryo samples

We compared the number of male embryos to the number of female embryos in each strain by using chi-square analysis. The null hypothesis was that 50% of the total embryos sexed were expected to be male and 50% were expected to be female. The observed values were the actual number of male and female embryos as determined by Real-Time PCR. As shown in Table 3, there was no significant difference in the number of male or female embryos at either time point post-hCG in either strain or when total embryos were compared from the combination of both time points.

Table 3.

Sexing of preimplantation mouse embryos

Number of Embryos
Mouse Strain Experiment Total Male Female P valuea
Total embryos sexed
  B6.K1 Total (4 expts) 221 110 111 P=0.95
  B6.K2 Total (6 expts) 260 137 123 P=0.39
Embryos sexed 89 h post-hCG
  B6.K1 1 34 14 20
2 56 30 26
Total 90 44 46 P=0.83
  B6.K2 1 9 3 6
2 16 8 8
3 79 44 35
Total 104 55 49 P=0.56
Embryos sexed 100 h post-hCG
  B6.K1 1 67 39 28
2 64 27 37
Total 131 66 65 P=0.93
  B6.K2 1 39 15 24
2 29 19 10
3 88 48 40
Total 156 82 74 P=0.52
a

P value of males compared to females by chi-square analysis

Discussion

The B6.K1/B6.K2 model system is ideal for studying the effects of the Ped gene on development and reproduction because these mice are genetically identical except for the absence (B6.K1) or presence (B6.K2) of the Ped gene. Previous work using the congenic B6.K1 and B6.K2 mice has shown that the presence of Qa-2 protein in the B6.K2 mice confers a faster rate of preimplantation development, larger litter size, larger birth weight, and larger weaning weight to the pups compared to the B6.K1 mice [5, 6]. In addition, embryos that express Qa-2 protein have a higher chance of surviving to birth than those that do not [7]. In this paper we tested the hypothesis that embryo sex might be a confounding factor in mediating the rate of preimplantation cleavage. We found that there was no skewing of the sex ratio in preimplantation embryos from either strain, showing that only the Ped gene is involved in the genetic control of the rate of preimplantation development in B6.K1 and B6.K2 mice.

Embryo sex has been the subject of a number of studies both on embryos cultured in vitro and on embryos allowed to develop in vivo. Previous work on in vitro cultured preimplantation embryos from the mouse and other species generally supports the idea that male embryos often develop faster than female embryos during the culture period. This phenomenon has been observed in mouse [1820], cow [21, 22], sheep [23], and human embryos [2426]. In contrast to these in vitro studies, two studies on the sex ratio of preimplantation mouse embryos analyzed after in vivo development, show conflicting results. The first study found that female mouse embryos developed faster than male embryos [20], while the second study found that male mouse embryos developed faster than female embryos [27]. In the present study, we also analyzed preimplantation embryos after development in vivo, but we have used a rigorously defined genetic system unlike the previous two studies, which used several different mouse strains. Interestingly, our results on the preimplantation sex ratio of the preimplantation embryos from the B6.K1 and B6.K2 mice are consistent with the 50:50 sex ratios that we found at weaning for both of these strains [5].

The human homolog of Qa-2 isHLA-G[2830]. The presence of soluble isoforms of HLA-G in the culture medium of embryos created after IVF or ICSI has been reported to be correlated with an enhanced chance of pregnancy success [3135], although this finding has been called into question by others [3640]. However, regardless of whether or not soluble HLA-G ultimately turns out to be a clinically useful predictor of pregnancy outcome, expression of membrane-bound HLA-G, as well as membrane-bound Qa-2, is associated with an enhanced rate of preimplantation development and overall reproductive success (reviewed in [41]).

Studies on the rate of development of preimplantation embryos are particularly relevant to the assisted reproduction technology (ART) clinic. It has long been recognized that embryos that develop at a fast rate have a higher chance of leading to pregnancy success (reviewed in [1, 2]). For this reason the Ped gene has been of great interest to clinicians working in ART. The B6.K1/B6.K2 mouse system described in this paper should provide an excellent model for future research on how the Ped gene product, Qa-2 protein, mediates a fast rate of development independent of the sex of the embryos.

Conclusions

In conclusion, the present study has shown that in the B6.K1 and B6.K2 congenic strains of mice, which differ only in the presence of the Ped gene, there is no statistically significant difference in the sex ratio of their preimplantation embryos. Therefore, genetic control of the rate of preimplantation development in these strains is solely mediated by the Ped gene product, Qa-2 protein. The B6.K1 and B6.K2 congenic strains of mice provide a unique opportunity to further elucidate the mechanisms by which the Ped gene, and only the Ped gene, influences the rate of preimplantation embryo development and pregnancy success.

Acknowledgements

We thank Marie Amato for helping with the literature search and we thank Michele Mammolenti for managing the mouse husbandry. This study was supported by NIH grant HD39215.

Footnotes

Publisher's Disclaimer: This PDF receipt will only be used as the basis for generating PubMed Central (PMC) documents. PMC documents will be made available for review after conversion (approx. 2–3 weeks time). Any corrections that need to be made will be done at that time. No materials will be released to PMC without the approval of an author. Only the PMC documents will appear on PubMed Central -- this PDF Receipt will not appear on PubMed Central.

There is no confounding effect of the sex of preimplantation embryos on the rate of preimplantation development controlled by the Ped gene.

Contributor Information

Michael J. Byrne, Department of Biology, Northeastern University, 134 Mugar Hall, 360 Huntington Avenue, Boston, Massachusetts, 02115

Judith A. Newmark, Department of Biology, Northeastern University, 134 Mugar Hall, 360 Huntington Avenue, Boston, Massachusetts, 02115

Carol M. Warner, Department of Biology, Northeastern University, 134 Mugar Hall, 360 Huntington Avenue, Boston, Massachusetts, 02115, e-mail: c.warner@neu.edu

References

  • 1.Boiso I, Veiga A, Edwards RG. Fundamental of human embryonic growth in vitro and the selection of high-quality embryos for transfer. Reprod BioMed Online. 2002;5:328–350. doi: 10.1016/s1472-6483(10)61841-x. [DOI] [PubMed] [Google Scholar]
  • 2.Wharf E, Dimirakopoulos A, Khalaf Y, Pickering S. Early embryo development is an indicator of implantation potential. Reprod BioMed Online. 2004;8:212–218. doi: 10.1016/s1472-6483(10)60518-4. [DOI] [PubMed] [Google Scholar]
  • 3.Warner CM, Brenner CA. Genetic regulation of preimplantation embryo survival. Curr Top Dev Biol. 2001;52:151–192. doi: 10.1016/s0070-2153(01)52011-6. [DOI] [PubMed] [Google Scholar]
  • 4.Warner CM, Newmark JA, Comiskey M, De Fazio SR, O’Malley DM, Rajadhyaksha M, et al. Genetics and imaging to assess oocyte and preimplantation embryo health. Reprod Fertil Develop. 2004;16:729–741. doi: 10.1071/rd04088. [DOI] [PubMed] [Google Scholar]
  • 5.Warner CM, Brownell MS, Rothschild MF. Analysis of litter size and weight in mice differing in Ped gene phenotype and the Q region of the H-2 complex. J Reprod Immunol. 1991;19:303–313. doi: 10.1016/0165-0378(91)90042-o. [DOI] [PubMed] [Google Scholar]
  • 6.Warner CM, Panda P, Almquist CD, Xu Y. Preferential survival of mice expressing the Qa-2 antigen. J Reprod Fertil. 1993;99:145–147. doi: 10.1530/jrf.0.0990145. [DOI] [PubMed] [Google Scholar]
  • 7.Exley GE, Warner CM. Selection in favor of the Ped fast haplotype occurs between mid-gestation and birth. Immunogenetics. 1999;49:653–659. doi: 10.1007/s002510050661. [DOI] [PubMed] [Google Scholar]
  • 8.Brownell MS, Warner CM. Ped gene expression by embryos cultured in vitro. Biol Reprod. 1988;39:806–811. doi: 10.1095/biolreprod39.4.806. [DOI] [PubMed] [Google Scholar]
  • 9.Wu L, Exley GE, Warner CM. Differential expression of Ped gene candidates in preimplantation mouse embryos. Biol Reprod. 1998;59:941–952. doi: 10.1095/biolreprod59.4.941. [DOI] [PubMed] [Google Scholar]
  • 10.Dey SK, Lim H, Das SK, Reese J, Paria BC, Diakoku T, et al. Molecular cues to implantation. Endocr Rev. 2004;25(3):341–373. doi: 10.1210/er.2003-0020. [DOI] [PubMed] [Google Scholar]
  • 11.Newmark JA, Sacher F, Jones GS, Warner CM. Ped gene deletion polymorphism frequency in wild mice. J Exptl Zool. 2002;293:179–185. doi: 10.1002/jez.10117. [DOI] [PubMed] [Google Scholar]
  • 12.Mardon G, Page DC. The sex-determining region of the mouse Y chromosome encodes a protein with a highly acidic domain and 13 zinc fingers. Cell. 1989;56:765–770. doi: 10.1016/0092-8674(89)90680-6. [DOI] [PubMed] [Google Scholar]
  • 13.Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Munsterberg A, Vivian N, Goodfellow P, Lovell-Badge R. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature. 1990;346:245–250. doi: 10.1038/346245a0. [DOI] [PubMed] [Google Scholar]
  • 14.Love JM, Knight AM, McAleer MA, Todd JA. Towards construction of a high resolution map of the mouse genome using PCR-analyzed microsatellites. Nucleic Acids Res. 1990;8:4123–4130. doi: 10.1093/nar/18.14.4123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kunieda T, Xian M, Kobayashi E, Imamichi T, Moriwaki K, Toyoda Y. Sexing of mouse preimplantation embryos by detection of Y chromosome-specific sequences using polymerase chain reaction. Biol Reprod. 1992;46:692–697. doi: 10.1095/biolreprod46.4.692. [DOI] [PubMed] [Google Scholar]
  • 16.Greenlee AR, Krisher RL, Plotka ED. Rapid sexing of murine preimplantation embryos using a nested multiplex polymerase chain reaction (PCR) Mol Reprod Dev. 1998;14:261–267. doi: 10.1002/(SICI)1098-2795(199803)49:3<261::AID-MRD6>3.0.CO;2-M. [DOI] [PubMed] [Google Scholar]
  • 17.Cohen, Cohen . Applied multiple regression/Correlation analysis for the behavioral science. 2nd ed. Vol. 529. New Jersey: Lawrence Erlbaum Associates, Inc.; 1983. pp. 59–61. [Google Scholar]
  • 18.Tsunoda Y, Tokunaga T, Sugie T. Altered sex ratio of live young after transfer of fast- and slow-developing mouse embryos. Gamete Res. 1985;12:301–304. [Google Scholar]
  • 19.Valdivia RPA, Kunieda T, Azuma S, Toyoda T. PCR sexing and developmental rate differences in preimplantation mouse embryos fertilized and cultured in vitro. Mol Reprod Dev. 1993;35:121–126. doi: 10.1002/mrd.1080350204. [DOI] [PubMed] [Google Scholar]
  • 20.Peippo P, Bredbacka P. Sex-related growth rate differences in mouse preimplantation embryos in vivo and in vitro. Mol Reprod Dev. 1995;40:56–61. doi: 10.1002/mrd.1080400108. [DOI] [PubMed] [Google Scholar]
  • 21.Avery B, Jorgensen CB, Madison V, Greve T. Morphological development and sex of bovine in vitro-fertilized embryos. Mol Reprod Devel. 1992;32:265–270. doi: 10.1002/mrd.1080320312. [DOI] [PubMed] [Google Scholar]
  • 22.Xu KP, Yadav BR, King WA, Betteridge KJ. Sex-related differences in developmental rates of bovine embryos produced and cultured in vitro. Mol Reprod Dev. 1992;31:240–252. doi: 10.1002/mrd.1080310404. [DOI] [PubMed] [Google Scholar]
  • 23.Bernardi ML, Delouis C. Sex-related differences in the developmental rate of in vitro matured/in vitro fertilized ovine embryos. Hum Reprod. 1996;11(3):621–626. doi: 10.1093/humrep/11.3.621. [DOI] [PubMed] [Google Scholar]
  • 24.Pergament E, Fiddler M, Cho N, Johnson D, Holmgren WJ. Sexual differentiation and preimplantation cell growth. Hum Reprod. 1994;9:1730–1732. doi: 10.1093/oxfordjournals.humrep.a138783. [DOI] [PubMed] [Google Scholar]
  • 25.Menezo YJ, Chouteau J, Torello J, Girard A, Veiga A. Birth weight and sex ratio after transfer at the blastocyst stage in humans. Fertil Steril. 1999;72(2):221–224. doi: 10.1016/s0015-0282(99)00256-3. [DOI] [PubMed] [Google Scholar]
  • 26.Tarin JJ, Bernabeu R, Baviera A, Bonada M, Cano A. Sex selection may be inadvertently performed in in-vitro fertilization-embryo transfer programmes. Hum Reprod. 1995;10:2992–2998. doi: 10.1093/oxfordjournals.humrep.a135835. [DOI] [PubMed] [Google Scholar]
  • 27.Burgoyne P. A Y-chromosomal effect on blastocyst cell number in mice. Development. 1993;117:341–345. doi: 10.1242/dev.117.1.341. [DOI] [PubMed] [Google Scholar]
  • 28.Jurisicova A, Casper RF, MacLusky NJ, Mills GB, Librach CL. HLA-G expression during preimplantation human embryo development. Proc Natl Acad Sci USA. 1996;A93:161–165. doi: 10.1073/pnas.93.1.161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Comiskey M, Goldstein CY, De Fazio SR, Mammolenti M, Newmark JA, Warner CM. Evidence that HLA-G is the functional homolog of Qa-2, the Ped gene product. Hum Immunol. 2003;64:999–1004. doi: 10.1016/j.humimm.2003.08.352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Clements CS, Kjer-Nielsen L, Kostenko L, Hoare HL, Dunstone MA, Moses E, et al. Crystal structure of HLA-G: a nonclassical MHC class I molecule expressed at the fetal-maternal interface. Proc Natl Acad Sci USA. 2005;102(9):3360–3365. doi: 10.1073/pnas.0409676102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Fuzzi B, Rizzo R, Criscuoli L, Noci I, Melchiorri L, Scarselli B, et al. HLA-G expression in early embryos is a fundamental prerequisite for the obtainment of pregnancy. Eur J Immunol. 2002;32:311–315. doi: 10.1002/1521-4141(200202)32:2<311::AID-IMMU311>3.0.CO;2-8. [DOI] [PubMed] [Google Scholar]
  • 32.Noci I, Fuzzi B, Rizzo R, Melchiorri L, Criscuoli L, Dabizzi S, et al. Embryonic soluble HLA-G as a marker of developmental potential in embryos. Hum Reprod. 2004;20(1):138–146. doi: 10.1093/humrep/deh572. [DOI] [PubMed] [Google Scholar]
  • 33.Sher G, Keskintepe L, Nouriani M, Roussev R, Batzofin J. Expression of sHLA-G in supernatants of individually cultured 46-h embryos: a potentially valuable indicator of ‘embryo competency‘ and IVF outcome. Reprod Biomed Online. 2004;9(1):74–78. doi: 10.1016/s1472-6483(10)62113-x. [DOI] [PubMed] [Google Scholar]
  • 34.Yie SM, Balakier H, Motamedi G, Librach CL. Secretion of human leukocyte antigen-G by human embryos is associated with a higher in vitro fertilization pregnancy rate. Fertil Steril. 2005;83(1):30–36. doi: 10.1016/j.fertnstert.2004.06.059. [DOI] [PubMed] [Google Scholar]
  • 35.Sher G, Keskintepe L, Fisch JD, Acacio BA, Ahlering P, Batzofin J, et al. Soluble human leukocyte antigen G expression in phase I culture media at 46 hours after fertilization predicts pregnancy and implantation from day 3 embryo transfer. Fertil Steril. 2005;83(5):1410–1413. doi: 10.1016/j.fertnstert.2004.11.061. [DOI] [PubMed] [Google Scholar]
  • 36.Warner CM, Comiskey M, Clisham PR, Brenner CA. Soluble HLA-G (sHLA-G)-A predictor of IVF outcome? J Asst Reprod Gen. 2004;21:315–316. doi: 10.1023/B:JARG.0000045469.08910.1e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Van Lierop MJ, Wijnands F, Loke YW, Emmer PM, Lukassen HG, Braat DD, et al. Detection of HLA-G by a specific sandwich ELISA using monoclonal antibodies G233 and 56B. Mol Hum Reprod. 2002;8(8):776–784. doi: 10.1093/molehr/8.8.776. [DOI] [PubMed] [Google Scholar]
  • 38.Noriko S, Horotsugu H, Masanori Y, Takanori S, Motoko O, Katsuhiko H, et al. Are in virto fertilized eggs able to secrete soluble HLA-G? Am J Reprod Immunol. 2004;52(Suppl 1):8. [Google Scholar]
  • 39.Blaschitz A, Juch H, Volz A, Hutter H, Daxboeck C, Desoye G, et al. The soluble pool of HLA-G produced by human trophoblasts does not include detectable levels of the intron 4-containing HLA-G5 and HLA-G6 isoforms. Mol Hum Reprod. 2005;11(10):699–710. doi: 10.1093/molehr/gah185. [DOI] [PubMed] [Google Scholar]
  • 40.Sargent I. Does ‘soluble’ HLA-G really exist? Another twist to the tail. Mol Hum Reprod. 2005;11(10):695–698. doi: 10.1093/molehr/gah196. [DOI] [PubMed] [Google Scholar]
  • 41.Hviid TVF. HLA-G in human reproduction: aspects of genetics, function and pregnancy complications. Hum Reprod Update. 2005 Nov 9; doi: 10.1093/humupd/dmi048. [Epub ahead of print] [DOI] [PubMed] [Google Scholar]

RESOURCES