Abstract
Purpose
To investigate the genetic linkage of primary open-angle glaucoma (POAG) in a Chinese family.
Methods
We have screened for myocilin (MYOC) gene mutations in a glaucoma family of five generations. There are fifty-six members of whom 11 were confirmed to have POAG , two with ocular hypertension were considered as POAG suspect, and the remaining 43 were asymptomatic. We also recruited 200 unrelated healthy Chinese subjects as normal control. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis and DNA sequencing were used to identify mutations in the three exons of MYOC. Presymptomatic diagnoses were made for the family members seeking consultation based on the results of both clinical examination and genetic analysis.
Results
Among three allelic variants identified in this pedigree (Pro13Leu [38 C→T], Arg76Lys [227G→A], and Gln337Stop [1009C del]), Pro13Leu and Gln337Stop were reported to be novel mutations while Arg76Lys has been previously documented. Our results show that all 11 POAG patients carry the Gln337Stop mutation and that four POAG patients and one POAG suspect (V:2) were found to have the Pro13Leu mutation. In addition, Arg76Lys polymorphism was identified in two patients and a POAG suspect (V:5).
Conclusions
Pro13Leu and Gln337Stop mutations of MYOC are likely responsible for the etiology of POAG in this pedigree, but the causative mechanism needs further research.
Introduction
Glaucoma is the second leading cause of blindness worldwide, affecting more than 70 million people. Primary open-angle glaucoma (POAG) is the most common form of this ocular disease. A population-based, cross-sectional study showed that glaucoma is the major cause of blindness in China, and POAG is a key form of the disease [1]. Noticeably, incidence rates of secondary glaucoma and congenital glaucoma are 0.52% and 0.02%, respectively. The prevalence of primary glaucoma is 1%-2% in the population over age 40.
POAG is usually asymptomatic until the late stage of the disease. This make early diagnosis almost impossible. And when POAG reaches the late stage, irreversible damages such as chronic, progressive apoptosis of optic ganglion cells and visual field damage usually occur. The most important risk factor for POAG is family history [2]. First-degree relatives of individuals affected with POAG are 10 times more likely to develop POAG [3]. Since its first implication in the genetic linkage to POAG in 1997, numerous mutations in the myocilin (MYOC) gene have been identified and their specific phenotypes have been characterized. Although the mechanism underlying glaucoma is poorly understood, a growing body of evidence suggests that there is a genetic link between MYOC mutations and the pathogenesis of glaucoma. So far, more than 70 mutations of MYOC have been documented in POAG families or sporadic POAG patients. Some of them such as Gln48His [4] in exon 1, Asp208Glu [5] in exon 2, and Pro370Leu [6] and Thr377Met [7] in exon 3 of MYOC were confirmed to correlate with POAG. Interestingly, MYOC mutations have been found to vary with different ethnic groups and geographic locations [8-14]. In the current study, we performed MYOC mutation screening in a large glaucoma family affected with POAG, and our results suggest that novel mutations of MYOC, Pro13Leu and Gln337Stop, may be associated with POAG. This study will also discuss the significance of our findings to genetic counseling.
Methods
Clinical examination and diagnosis of primary open-angle glaucoma
Clinical examinations were performed including visual acuity, slit lamp biomicroscopy, applanation tonometry, gonioscopy, funduscopy, and perimetry. Family members were divided into three groups: (1) affected individuals, (2) asymptomatic individuals, and (3) suspect individuals. POAG is defined by a normal appearing anterior chamber angle along with two of the following symptoms [15]: elevation of intraocular pressure (IOP>21 mmHg), characteristic visual field defects, and glaucomatous optic nerve head changes (cup-disc ratio>0.6 or notches). Subjects meeting only one of these symptoms were defined as suspect. Individuals without any manifestations were defined as asymptomatic. Patients were diagnosed and treated at the Eye and ENT Hospital (Fudan University, Shanghai, China). All participants in this research had given informed consent after receiving detailed explanation of the nature and possible consequences of the study.
Genetic analysis
Genomic DNA was extracted from peripheral blood leukocytes using standard procedures. The coding sequences of MYOC (GenBank AB006688) were amplified by polymerase chain reaction (PCR). Amplifications of three exons were performed in a 25 μl reaction containing 50 ng of genomic DNA mixed with 10X buffer, 50 pmol primers, 2.5 mM NTP, and 1 ul Taq polymerase. PCR conditions were as follows: initial denaturation at 94 °C for 5 min followed by 35 cycles of denaturation at 94 °C for 45 s, annealing at a temperature specific for each primer for 45 s (Table 1), and extension at 72 °C for 1 min. A final extension at 72 °C for 10 min completed the reaction. The reactions were performed with a GeneAmp PCR system 9600 (Applied Biosystems, Foster City, CA). Subsequently, 8 μl of the PCR product for each polymorphic site was digested completely with Bme1390 I, BselI, Eco721, MspI, Bpu11021, PagI, BsmaI, and BseD, according to instructions recommended by the manufacturer. Genotype analysis was determined by 12% polyacrylamide gel. Direct sequencing was performed on an Applied Biosystems 3730 DNA Analyzer (Applied Biosystems) according to the BigDye Terminator version 3.1 protocol. MYOC mutations were screened in each surviving individual. Presymptomatic genetic diagnoses were determined for family members who sought information and instruction about their disease status according to the phenotype of POAG, the pattern of inheritance, their clinical status, and genetic analysis results of their family. Follow-up plans were established after these diagnoses.
Table 1. Primers and sequences used in this study.
| ID | Position* | Tm (°C) | Sequence (5′→3′) | Size (bp) |
|---|---|---|---|---|
| MYOC1 |
353–509 |
62 |
F: GGCTGGCTCCCC AGTATATA |
174 |
| R: ACAGCTGGCATCTCAGGC |
||||
| MYOC2 |
491–658 |
62 |
F: ACG TTG CTG CAG CTT TGG |
196 |
| R: GATGACTGACATGGCCTGG |
||||
| MYOC3 |
603–772 |
65 |
F: AGTGGCCGATGCCAGTATAC |
189 |
| R: CTGGTCCAAGGTCAATTGGT |
||||
| MYOC4 |
670–864 |
62 |
F: AGGCCATGTCAGTCATCCAT |
214 |
| R: TCTCTGGTTTGGGTTTCCAG |
||||
| MYOC5 |
778–958 |
60 |
F: TGACCTTGGACCAGGCTG |
200 |
| R: CCTGGCCAGATTCTCATTTT |
||||
| MYOC6 |
928–1095 |
63 |
F: TGGAGGAAGAGAAGAAGCGA |
187 |
| R: CTGCTGAACTCAGAGTCCCC |
||||
| MYOC7 |
1416–1630 |
62 |
F: AACATAGTCAATCCTTGGGCC |
230 |
| R: TAAAGACCATGTGGGCACA |
||||
| MYOC8 |
1933–2091 |
60 |
F: TTATGGATTAAGTGGTGCTTCG |
177 |
| R: ATTCTCCACGTGGTCTCCTG |
||||
| MYOC9 |
2069–2232 |
64 |
F: AAGCCCACCTACCCCTACAC |
184 |
| R: AATAGAGGCTCCCCGAGTACA |
||||
| MYOC10 |
2195–2366 |
64 |
F: ATACTGCCTAGGCCACTGGA |
190 |
| R: CAATGTCCGTGTAGCCACC |
||||
| MYOC11 |
2335–2512 |
63 |
F: TGGCTACCACGGACAGTTC |
197 |
| R: CATTGGCGACTGACTGCTTA |
||||
| MYOC12 |
2480–2653 |
64 |
F: GAACTCGAACAAACCTGGGA |
195 |
| R: CATGCTGCTGTACTTATAGCGG |
||||
| MYOC13 |
2624–2783 |
62 |
F: AGCAAGACCCTGACCATCC |
179 |
| R: AGCATCTCCTTCTGCCATTG |
The asterisk indicates that all numbers correspond to the numbering scheme of GenBank AB006688
Secondary structure prediction
We also used Antheprot software to analyze the possible effects of these mutations on the secondary structure of the corresponding proteins.
Results
Phenotypes of the patients
The five-generation family exhibited an autosomal dominant pattern of inheritance (Figure 1). A total of 11 patients were identified with POAG (Table 2). The information for III:8, III:14, and III:15 were not complete. Their diagnoses were based on medical histories, which included elevation of intraocular pressure (IOP >21 mmHg) and characteristic visual field defects.
Figure 1.
Pedigree with variances of MYOC. Solid symbols and open symbols represent affected and unaffected disease status, respectively. Suspects are marked with a question mark inside the squares. Roman numerals and Arabian numerals indicate generations and orders, respectively. Squares and circles represent males and females, respectively. A slash indicates a deceased family member. The arrow indicates the proband.
Table 2. Clinical appearance of the affected members.
| Family member | Sex | Age (years) | Age of onset (years) | Visual acuity | Maximum IOP (mmHg) | Cup-disc ratio | VF grading score | Severity | Medical therapy |
|---|---|---|---|---|---|---|---|---|---|
| III:1 |
M |
66 |
23 |
OD: NLP |
46 |
** |
# |
End stage |
Surgery## |
| OS: NLP |
44 |
** |
# |
End stage |
Surgery |
||||
| III:3 |
F |
63 |
24 |
OD: NLP |
* |
** |
# |
End stage |
Surgery |
| OS: NLP |
* |
** |
# |
End stage |
Surgery |
||||
| III:8 |
F |
56 |
26 |
OD: NLP |
* |
** |
# |
End stage |
Surgery## |
| OS: NLP |
* |
** |
# |
End stage |
Surgery |
||||
| III:14 |
F |
38 |
21 |
OD: NLP |
* |
** |
# |
End stage |
Surgery |
| OS: NLP |
* |
** |
# |
End stage |
Surgery |
||||
| III:15 |
M |
35 |
19 |
OD: NLP |
* |
** |
# |
End stage |
Surgery |
| OS: NLP |
* |
** |
# |
End stage |
Surgery |
||||
| IV:2 |
F |
42 |
41 |
OD: 0.5 |
28 |
0.7 |
1 |
Mild |
No |
| OS: 0.4 |
22 |
0.6 |
2 |
Mild |
No |
||||
| IV:4 |
M |
36 |
26 |
OD: NLP |
* |
** |
# |
End stage |
Surgery |
| OS: NLP |
* |
** |
# |
End stage |
Surgery |
||||
| IV:10 |
M |
30 |
22 |
OD:0.01 |
29 |
1 |
8 |
Severe |
Surgery |
| OS: NLP |
28 |
1 |
# |
End stage |
Surgery |
||||
| IV:14 |
M |
40 |
16 |
OD: NLP |
29 |
0.8 |
# |
End stage |
No |
| OS: NLP |
32 |
0.8 |
# |
End stage |
No |
||||
| IV:20 |
M |
33 |
26 |
OD: NLP |
28 |
** |
# |
End stage |
No |
| OS: NLP |
* |
** |
# |
End stage |
Surgery |
||||
| IV:22 |
M |
35 |
30 |
OD: 1.0 |
18 |
0.4 |
0 |
Mild |
No |
| OS: 0.25 | 35 | 0.6 | 3 | Moderate | No |
The asterisk indicates that the maximum intraocular pressure (IOP) was not certain because of relatively advanced glaucoma at the time of first presentation. The double asterisk indicate that the cup/disc ratio was not certain because of eyeball atrophy or cornea opacity. The sharp (hash mark) indicates that the visual field was not available because the patient had no light perception. The double sharp (hash marks) indicates that the member had surgery twice. The visual fields (VF) were graded for severity of visual field loss with a level grading scale. Severity classification is leveled by the visual field score: mild (0–2), moderate (3–5), severe (6–8), and end stage (no light perception). NLP, no light perception.
Onset ages of patients ranged from16 to 41 years. Most patients had typical glaucoma changes in the optic disc and the visual field (Figure 2). All patients showed more damage to the optic nerve head in the right eye than in the left. All affected family members had a noticeable increase in intraocular pressure (IOP) higher than 22 mmHg. The IOP of these patients could not be controlled with available antiglaucoma medication. Most of the patients underwent antiglaucoma surgeries, and subjects III:1 and III:8 had repeated operations due to the failure of the first procedure but still couldn’t control the development of the pathogenetic condition.
Figure 2.
Optic disc and visual field of individual IV:22. Glaucomatous optic disc atrophy is seen with visual field defects in the right eye. Panel A shows the optic disc atrophy of the right eye while panel B shows visual field defects of the right eye.
Clinical examination of the consulters
There were altogether 26 consulters with no visible optic head damage and visual field defects (Table 3), and two of whom (III:16 and IV:25) were marked as suspects since their maximum IOP was higher than 21 mmHg. No evidence for glaucoma was found in the other 24 consulters.
Table 3. Clinical features and gene screening results of the consulters.
| Family member | Sex | Age (years) | Maximum IOP (mmHg) | Cup-disc ratio (OD/OS) | Visual field score (OD/OS) | Diagnosis |
|---|---|---|---|---|---|---|
| III:10 |
M |
54 |
19 |
0.3/0.4 |
0/0 |
Unaffected |
| III:12 |
M |
51 |
20 |
0.5/0.4 |
0/0 |
Unaffected |
| III:16 |
F |
30 |
21 |
0.4/0.4 |
0/0 |
Suspect |
| III:17 |
M |
27 |
18 |
0.4/0.3 |
0/0 |
Unaffected |
| IV:6 |
F |
34 |
17 |
0.4/0.3 |
0/0 |
Unaffected |
| IV:8 |
M |
32 |
15 |
0.3/0.2 |
0/0 |
Unaffected |
| IV:12 |
M |
25 |
19 |
0.3/0.3 |
0/0 |
Unaffected |
| IV:16 |
M |
38 |
20 |
0.5/0.5 |
0/0 |
Unaffected |
| IV:18 |
M |
36 |
20 |
0.5/0.5 |
0/0 |
Unaffected |
| IV:25 |
M |
35 |
21 |
0.4/0.3 |
0/0 |
Suspect |
| IV:27 |
F |
30 |
15 |
0.4/0.3 |
0/0 |
Unaffected |
| IV:28 |
M |
25 |
19 |
0.3/0.3 |
0/0 |
Unaffected |
| IV:29 |
F |
28 |
16 |
0.3/0.2 |
0/0 |
Unaffected |
| IV:30 |
F |
24 |
18 |
0.4/0.3 |
0/0 |
Unaffected |
| V:1 |
F |
19 |
18 |
0.4/0.3 |
0/0 |
Unaffected |
| V:2 |
M |
13 |
16 |
0.3/0.5 |
0/0 |
Unaffected |
| V:3 |
M |
11 |
17 |
0.4/0.5 |
0/0 |
Unaffected |
| V:4 |
M |
9 |
16 |
0.4/0.4 |
0/0 |
Unaffected |
| V:5 |
M |
9 |
16 |
0.5/0.5 |
0/0 |
Unaffected |
| V:6 |
F |
16 |
17 |
0.4/0.3 |
0/0 |
Unaffected |
| V:7 |
F |
15 |
18 |
0.4/0.4 |
0/0 |
Unaffected |
| V:8 |
F |
13 |
20 |
0.4/0.3 |
0/0 |
Unaffected |
| V:9 |
M |
10 |
18 |
0.4/0.3 |
0/0 |
Unaffected |
| V:10 |
M |
4 |
20 |
0.5/0.5 |
0/0 |
Unaffected |
| V:11 |
F |
12 |
19 |
0.2/0.4 |
0/0 |
Unaffected |
| V:12 | F | 8 | 17 | 0.3/0.4 | 0/0 | Unaffected |
Mutation screen of MYOC
With polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and gene sequencing technologies, we identified one known mutation, Arg76Lys (227G→A), that was reported as a polymorphism by Alward et al. [15], and two novel mutations, Pro13Leu (38 C→T) and Gln337Stop (1009C del), that are likely responsible for the pathogenesis of POAG since these mutations result in either a change in the amino acid sequence or a frame shift. The three mutations were summarized in Table 4. The results of PCR-RFLP and gene sequencing are shown in Figure 3. Other mutations i.e., Gln48His (144G→T), Gly246Arg (736G→A), Gln337Arg (1009C→G), Ile345Met (1036 A→G), Pro370Leu (1109C→T), Asp380Asn (1138G→A), Asp380Ala (1139A→C), Ile477Ser (1430T→A), Pro481Thr (1441C→A), and Pro481Leu (1442C→T), were not detected.
Table 4. Summary of MYOC mutations found in this study.
| Mutation | Pedigree members | Controls | Reference |
|---|---|---|---|
| Arg76Lys (227G→A) |
3/56 (5.3%) |
0 |
[15] |
| Pro13Leu (38 C→T) |
5/56 (8.9%) |
0 |
Present study |
| Gln337Stop (1009C del) | 12/56 (21.4%) | 0 | Present study |
Figure 3.
Electrophoretic mobility assays of PCR-RFLP and sequence results. A: PCR products were separated on 12% polyacrylamide gel from three representative samples, and the genotypes are shown for (1) Arg76Lys (227G→A), (2) Pro13Leu (38 C→T), and (3) Gln337Stop (1009C del). The sizes of the molecular weight marker and DNA fragments are shown in the left and the right sides of the gel, respectively. B: The representative chromatogram contains the sequence from the mutant DNA sequence strand for (1) Arg76Lys and (2) Pro13Leu as well as from the (3) wild-type and (4) mutant DNA sequence of Gln337Stop.
Presymptomatic diagnosis for consulters
Of the 26 consulters, two (III:16 and IV: 25) were classified as suspects because their maximum IOPs were higher than 21 mmHg. Another two (V:2 and V:10) at high risk for POAG since they carried the mutation considered to be disease-causing. One adolescent (V:2) carrying the Arg76Lys (38 C→T) mutation and another adolescent (V:10) carrying the Gln337Stop (1009 C del) mutation were defined as preclinical status and as having a high risk of developing glaucoma. To prescribe appropriate medication to carriers at an early stage of glaucoma, follow-up plans were established. The adolescents were asked to accept applanation tonometry and funduscopy every month and perimetry every six months.
Prediction of two-dimensional structure
Protein analysis using Antheprot suggested that Pro13Leu (38 C→T) and Arg76Lys (227 G→A) mutations resulted in the modification of the corresponding amino acid, but the predicted secondary structures of the encoded proteins were not different from those of the wild-types (Table 5). However, the frame shift introduced by Gln337stop (1009C del) creates a premature termination codon thereby resulting in a truncated product.
Table 5. Antheprot analysis results of the wild-type and mutant protein comparison using different secondary structure prediction methods.
| Methods | MYOC mutations | Alpha Helix (%) | Sheet (%) | Beta turn Random (%) | Coil (%) |
|---|---|---|---|---|---|
| GOR |
Wild-type |
36 |
23 |
19 |
22 |
| Arg76Lys (227G->A) |
36 |
23 |
19 |
22 |
|
| Pro13Leu (38 C->T) |
36 |
23 |
20 |
21 |
|
| Gln337Stop (1009C del) |
36 |
20 |
20 |
24 |
|
| DMP |
Wild-type |
38 |
28 |
9 |
25 |
| Arg76Lys (227G->A) |
38 |
28 |
9 |
25 |
|
| Pro13Leu (38 C->T) |
39 |
28 |
9 |
24 |
|
| Gln337Stop (1009C del) |
42 |
24 |
10 |
24 |
|
| PRD |
Wild-type |
39 |
13 |
0 |
47 |
| Arg76Lys (227G->A) |
39 |
13 |
0 |
47 |
|
| Pro13Leu (38 C->T) |
39 |
13 |
0 |
47 |
|
| Gln337Stop (1009C del) | 44 | 11 | 0 | 45 |
Discussion
MYOC consists of three exons separated by two introns and encodes a protein of 504 amino acids. Myocilin is a secreted, 55–57 kDa glycoprotein that forms dimers and multimers and has several characteristic structural motifs including a myosin-like domain, a leucine zipper region, and an olfactomedin domain [16]. More than 70 mutations in MYOC have been reported, 90% of which occur within exon 3. Mutations in MYOC are found in 3.86% of Caucasian patients with POAG, including normal tension glaucoma or ocular hypertension, 3.30% of patients of African descendants including African Americans and black residents in Africa, and 4.44% of Asian patients [17].
We have screened a Chinese POAG family for MYOC base-pair variants and identified three allelic variants, Pro13Leu (38 C→T), Arg76Lys (227G→A), and Gln337Stop (1009C del). Since the Arg76Lys mutation in POAG was first reported in 1998 [15], numerous studies have investigated the role of MYOC in the etiology of POAG in various ethnic groups and found that the mutation rate of MYOC ranges from 12% to 18% [18-22]. In contrast to 0% in normal controls, a mutation frequency of 5.3% (3/56) in Arg76Lys was identified in the present study, which is lower than previously reported. Moreover, these mutations do not result in significant alterations in either the predicted secondary structure or the physico-chemical property. Of course, more samples should be collected and analyzed to draw a conclusion to precisely represent the data generated from the present study.
Here, we have identified two novel mutations, Pro13Leu (38C→T) and Gln337stop (1009 C del), in prevalence rates of 8.9% and 21.4%, respectively, in this family. POAG in one patient carrying the Pro13Leu mutation eventually developed into blindness. One subject (IV:25; without the Pro13Leu mutation) who showed a normal appearance without visible optic head damage and visual field defects had an IOP of 21 mmHg. Whether this switch of amino acid residue has a dominant negative effect remains unknown and must be further studied. The other mutation, Gln337stop, was identified in all clinically confirmed patients and an asymptomatic subject V:10 (Gln337stop genotype frequency: 21.4%, 12/56). In this family, Gln337stop was shown to be one of the most severe and common gene defects that result in POAG. The present study reveals that the Gln337stop mutation of MYOC is deemed to largely contribute to the early onset glaucoma in this pedigree. Median onset age of affected individuals with Gln337stop was 24.9 years. Nearly all patients had to accept surgery due to intraocular pressure. In addition, the one suspect (V:10) harboring the Gln337stop mutation was only four years old but had a high IOP and cup-disc ratio, which made it highly likely to be predisposed to POAG. Genetically, the loss of cytosine at 1009 creates a premature stop codon. The resulting truncated product may have a severe dominant negative effect, which plays a critical role in etiology of POAG.
Ethnic difference in the frequency and types of MYOC mutations among patients with POAG has been examined by case control studies. At present, screening tests in whole populations for MYOC defects are not feasible due to the low prevalence of MYOC-associated glaucoma. However, people at high risk of developing glaucoma may benefit from genetic testing, especially in early onset type of glaucoma pedigrees.
In summary, mutations in MYOC strongly correlate with the pathogenicity of POAG. Future studies on glaucoma will be focused on developing an early genetic diagnosis. Such a test will allow evaluating the penetrance of MYOC and bypassing limitations of the present clinical based methods, thus providing a chance to prevent the irreversible damages.
Acknowledgments
We sincerely appreciate the help of the patients, their family members, and the control subjects for participating in this study. This work is supported by grants from the National Natural Science Foundation of China (30672012) and the Wuhan Municipal Department of Science and Technology (20016009107) to X.Z. It is also supported by the Hunan Provincial Natural Science Foundation of China (07JJ6047) to X.X.
References
- 1.Foster PJ, Oen FT, Machin D, Ng TP, Devereux JG, Johnson GJ, Khaw PT, Seah SK. The prevalence of glaucoma in Chinese residents of Singapore: a cross-sectional population survey of the Tanjing Paper district. Arch Ophthalmol. 2000;118:1105–11. doi: 10.1001/archopht.118.8.1105. [DOI] [PubMed] [Google Scholar]
- 2.Fan BJ, Leung YF, Wang N, Lam SC, Liu Y, Tam OS, Pang CP. Genetic and environmental risk factors for primary open-angle glaucoma. Chin Med J (Engl) 2004;117:706–10. [PubMed] [Google Scholar]
- 3.Alward WL. The genetics of open-angle glaucoma: the story of GLC1A and myocilin. Eye. 2000;14:429–36. doi: 10.1038/eye.2000.127. [DOI] [PubMed] [Google Scholar]
- 4.Mukhopadhyay A, Acharya M, Mukherjee S, Ray J, Choudhury S, Khan M, Ray K. Mutations in MYOC gene of Indian primary open angle glaucoma Patients. Mol Vis. 2002;8:442–8. [PubMed] [Google Scholar]
- 5.Lam DS, Leung YF, Chua JK, Baum L, Fan DS, Choy KW, Pang CP. Truncations in the TIGR gene in individuals with and without primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 2000;41:1386–91. [PubMed] [Google Scholar]
- 6.Adam MF, Belmouden A, Binisti P, Brézin AP, Valtot F, Bechetoille A, Dascotte JC, Copin B, Gomez L, Chaventre A, Bach JF, Garchon HJ. Recurrent mutations in a single exon encoding the evolutionarily conserved olfactomedin-homology domain of TIGR in familial open-angle glaucoma. Hum Mol Genet. 1997;6:2091–7. doi: 10.1093/hmg/6.12.2091. [DOI] [PubMed] [Google Scholar]
- 7.Wiggs JL, Allingham RR, Vollrath D, Jones KH, De La Paz M, Kern J, Patterson K, Babb VL, Del Bono EA, Broomer BW, Pericak-Vance MA, Haines JL. Prevalence of mutations in TIGR/Myocilin in patients with adult and juvenile primary open-angle glaucoma. Am J Hum Genet. 1998;63:1549–52. doi: 10.1086/302098. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Jansson M, Marknell T, Tomic L, Larsson LI, Wadelius C. Allelic variants in the MYOC/TIGR gene in patients with primary openangle, exfoliative glaucoma and unaffected controls. Ophthalmic Genet. 2003;24:103–10. doi: 10.1076/opge.24.2.103.13997. [DOI] [PubMed] [Google Scholar]
- 9.Fingert JH, Heon E, Liebmann JM, Yamamoto T, Craig JE, Rait J, Kawase K, Hoh ST, Buys YM, Dickinson J, Hockey RR, Williams-Lyn D, Trope G, Kitazawa Y, Ritch R, Mackey DA, Alward WL, Sheffield VC, Stone EM. Analysis of myocilin mutations in 1703 glaucoma patients from five different populations. Hum Mol Genet. 1999;8:899–905. doi: 10.1093/hmg/8.5.899. J.10196380. [DOI] [PubMed] [Google Scholar]
- 10.Faucher M, Anctil JL, Rodrigue MA, Duchesne A, Bergeron D, Blondeau P, Cote G, Dubois S, Bergeron J, Arseneault R, Morissette J, Raymond V, Quebec Glaucoma Network. Founder TIGR/myocilin mutations for glaucoma in the Quebec population. Hum Mol Genet. 2002;11:2077–90. doi: 10.1093/hmg/11.18.2077. [DOI] [PubMed] [Google Scholar]
- 11.Aldred MA, Baumber L, Hill A, Schwalbe EC, Goh K, Karwatowski W, Trembath RC. Low prevalence of MYOC mutations in UK primary open-angle glaucoma patients limits the utility of genetic testing. Hum Genet. 2004;115:428–31. doi: 10.1007/s00439-004-1171-1. [DOI] [PubMed] [Google Scholar]
- 12.Petersen MB, Kitsos G, Samples JR, Gaudette ND, Economou-Petersen E, Sykes R, Rust K, Grigoriadou M, Aperis G, Choi D, Psilas K, Craig JE, Kramer PL, Mackey DA, Wirtz MK. A large GLC1C Greek family with a myocilin T377M mutation: inheritance and phenotypic variability. Invest Ophthalmol Vis Sci. 2006;47:620–5. doi: 10.1167/iovs.05-0631. [DOI] [PubMed] [Google Scholar]
- 13.Weisschuh N, Neumann D, Wolf C, Wissinger B, Gramer E. Prevalence of myocilin and optineurin sequence variants in German normal tension glaucoma patients. Mol Vis. 2005;11:284–7. J.15851979. [PubMed] [Google Scholar]
- 14.Vazquez CM, Herrero OM, Bastus BM, Perez VD. Mutations in the third exon of the MYOC gene in Spanish patients with primary open angle glaucoma. Ophthalmic Genet. 2000;21:109–15. doi: 10.1076/1381-6810(200006)2121-8ft109. [DOI] [PubMed] [Google Scholar]
- 15.Alward WL, Fingert JH, Coote MA, Johnson AT, Lerner SF. Clinical features associated with mutations in the chromosome 1 open-angle glaucoma gene (GLC1A). N Engl J Med. 1998;338:1022–7. doi: 10.1056/NEJM199804093381503. [DOI] [PubMed] [Google Scholar]
- 16.Gobeil S, Letartre L, Raymond V. Functional analysis of the glaucoma-causing TIGR/myocilin protein: integrity of amino-terminal coiled-coil regions and olfactomedin homology domain is essential for extracellular adhesion and secretion. Exp Eye Res. 2006;82:1017–29. doi: 10.1016/j.exer.2005.11.002. [DOI] [PubMed] [Google Scholar]
- 17.Gong G, Kosoko-Lasaki O, Haynatzki GR, Wilson MR. Genetic dissection of myocilin glaucoma. Hum Mol Genet. 2004;13 Spec No 1:R91–102. doi: 10.1093/hmg/ddh074. [DOI] [PubMed] [Google Scholar]
- 18.Lam DS, Leung YF, Chua JK, Baum L, Fan DS, Choy KW, Pang CP. Truncations in the TIGR gene in individuals with and without primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 2000;41:1386–91. [PubMed] [Google Scholar]
- 19.Pang CP, Leung YF, Fan B, Baum L, Tong WC, Lee WS, Chua JK, Fan DS, Liu Y, Lam DS. TIGR/MYOC gene sequence alterations in individuals with and without primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 2002;43:3231–5. [PubMed] [Google Scholar]
- 20.Aroca-Aguilar JD, Sanchez-Sanchez F, Ghosh S, Coca-Prados M, Escribano J. Myocilin mutations causing glaucoma inhibit the intracellular endoproteolytic cleavage of myocilin between amino acids Arg226 and Ile227. J Biol Chem. 2005;280:21043–51. doi: 10.1074/jbc.M501340200. J.15795224. [DOI] [PubMed] [Google Scholar]
- 21.Petersen MB, Kitsos G, Samples JR, Gaudette ND, Economou-Petersen E, Sykes R, Rust K, Grigoriadou M, Aperis G, Choi D, Psilas K, Craig JE, Kramer PL, Mackey DA, Wirtz MKA. Large GLC1C Greek family with a myocilin T377M mutation: inheritance and phenotypic variability. Invest Ophthalmol Vis Sci. 2006;47:620–5. doi: 10.1167/iovs.05-0631. [DOI] [PubMed] [Google Scholar]
- 22.Wang DY, Fan BJ, Canlas O, Tam PO, Ritch R, Lam DS, Fan DS, Pang CP. Absence of myocilin and optineurin mutations in a large Philippine family with juvenile onset primary open angle glaucoma. Mol Vis. 2004;10:851–6. [PubMed] [Google Scholar]
- 23.Deléage G, Roux B. An algorithm for protein secondary structure prediction based on class prediction. Protein Eng. 1987;1:289–94. doi: 10.1093/protein/1.4.289. [DOI] [PubMed] [Google Scholar]
- 24.Frishman D, Argos P. Incorporation of non-local interactions in protein secondary structure prediction from the amino acid sequence. Protein Eng. 1996;9:133–42. doi: 10.1093/protein/9.2.133. [DOI] [PubMed] [Google Scholar]
- 25.Garnier J, Osguthorpe DJ, Robson B. Analysis of the accuracy and implications of simple methods for predicting the secondary structure of globular proteins. J Mol Biol. 1978;120:97–120. doi: 10.1016/0022-2836(78)90297-8. [DOI] [PubMed] [Google Scholar]



