Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2008 Sep 8.
Published in final edited form as: Biochemistry. 2005 Aug 2;44(30):10388–10395. doi: 10.1021/bi0507074

Combinatorial Selection, Inhibition and Antiviral Activity of DNA Thioaptamers Targeting the RNase H Domain of HIV-1 Reverse Transcriptase†

Anoma Somasunderam ‡, Monique R Ferguson §, Daniel R Rojo §, Varatharasa Thiviyanathan ‡, Xin Li ‡, William A O’Brien §, David G Gorenstein ‡,*
PMCID: PMC2532674  NIHMSID: NIHMS60545  PMID: 16042416

Abstract

Despite the key role played by the RNase H of Human Immunodeficiency Virus-1 Reverse Transcriptase (HIV-1 RT) in viral proliferation, only a few inhibitors of RNase H have been reported. Using in vitro combinatorial selection methods and the RNase H domain of the HIV RT, we have selected double-stranded DNA thioaptamers (aptamers with selected thiophosphate backbone substitutions) that inhibit RNase H activity and viral replication. The selected thioaptamer sequences had a very high proportion of G residues. The consensus sequence for the selected thioaptamers showed G clusters separated by single residues at the 5′ end of the sequence. Gel electrophoresis mobility shift assays and nuclear magnetic resonance spectroscopy showed that the selected thioaptamer binds to the isolated RNase H domain, but did not bind to a structurally similar RNase H from E.coli. The lead thioaptamer, R12-2, showed specific binding to HIV-1 RT with a binding constant (Kd) of 70 nM. The thioaptamer inhibited the RNase H activity of intact HIV-1 RT. In cell culture, transfection of thioaptamer R12-2 (0.5 μg/ml) markedly reduced viral production and exhibited a dose response of inhibition with R12-2 concentrations ranging from 0.03 μg/ml to 2.0 μg/ml (IC50 <100 nM). Inhibition was also seen across a wide range of virus inoculum, ranging from multiplicity of infection (m.o.i) of 0.0005 to 0.05, with reduction of virus production by more than 50% at high m.o.i. Suppression of virus was comparable to that seen with AZT at m.o.i. ≦ 0.005.

Reverse transcription of viral genomic RNA into DNA, an essential step in the replication of Human Immunodeficiency Virus type 1 (HIV-1)1 and other retroviruses, is catalyzed by reverse transcriptase. The bifunctional HIV-1 RT is a heterodimer with 66 and 51 kDa subunits (1). Both subunits contain a DNA polymerase domain. The 66 kDa domain, p66, contains an RNase H domain in addition to the DNA polymerase domain. The DNA polymerase utilizes both RNA and DNA templates to accomplish viral genomic replication. RNase H catalyzes cleavage of the viral RNA strand from the DNA:RNA hybrid duplex, thereby releasing the viral DNA copy to ultimately integrate into the host cell’s genome.

HIV infection progresses to AIDS at variable rates in virtually every infected individual over a period of several years in the absence of therapy. RT inhibitors were the first class of antiretroviral drugs approved and used to treat HIV infection. Although newer drugs targeting the HIV protease and, more recently, the envelope proteins, have been approved for use, RT inhibitors remain an important component of combination therapy known as highly active anti-retroviral therapy (HAART). Most commonly used HAART regimens typically include two or three RT inhibitors. The use of HAART, rather than less intensive antiretroviral regimens, has dramatically reduced the rates of progression to AIDS and has improved survival (2). Currently available RT inhibitors target the polymerase activity and are either nucleoside analog drugs that bind at the polymerase active site or are non-nucleoside inhibitors that bind to a different region of the HIV-1 RT. Therapeutic benefits can be markedly diminished by the emergence of drug resistant strains and by the potential toxicity of the approved antiretroviral drugs (3, 4). Resistance to these drugs emerges rapidly because of the highly error-prone RT, and by the potential for recombination between different strains when cells are co-infected (5). Due to extensive cross-resistance within each drug class that reduces antiviral activity and clinical benefit of sequential HAART, there is an urgent need to develop new agents and treatment approaches to fight AIDS. This search for alternate targets and new agents has led to a new class of RT inhibitors known as Oligonucleotide Reverse Transcriptase Inhibitors (ONRTIs) (6, 7).

ODNs are emerging as potential therapeutic agents that can be attractive alternatives for the chemical drugs (8, 9). ODNs operate via different mechanisms, such as the sequence-specific translational arrest of mRNA expression (antisense), RNA inhibition using specific short double-stranded RNA (siRNA), or by binding to and inhibiting RT or other HIV proteins/cellular receptors (aptamers or decoys) (10-12). The antisense strategy, proposed for the potential treatment of several diseases including AIDS and cancer (13), is based on the binding of ODNs to the mRNA by complementary base pairing. The decoy (or sense) strategy relies on selective binding of the ODNs, possibly selected as aptamers, to a nucleic acid binding protein. The decoy aptamer mimics the protein’s natural ligand and, therefore, competes with it for complex formation with the protein. This association traps the protein in a nonfunctional complex. An advantage of aptamers over the antisense technology is that the aptamer ODNs do not have to overcome the thermodynamic penalty required for the unfolding of their own and the target’s secondary and tertiary structures. RNA and DNA aptamers targeting several HIV proteins have been reported. This includes the inhibition of HIV-1 RT’s polymerase (14, 15) and RNase H activities (16, 17), HIV-1 integrase function (18), and the capsid protein NCp7 (19, 20).

Backbone modifications in ODNs are essential to increase their resistance toward digestion by cellular nucleases. Sulfur substitutions of phosphoric oxygens of the DNA backbone, as in monothiophosphate and dithiophosphate aptamers, often enhance their binding to proteins (21, 22). One can also take advantage of the increased affinity of the ODNs generally associated with sulfur substitutions, however, complete substitution of the backbone could lead to non-specific binding and therefore to a loss in specificity of the ODN to the target protein. Therefore, the number and position of sulfur substitutions in these thioaptamers need to be optimized to decrease binding to non-target proteins while enhancing binding to the target protein.

Despite the key role played by HIV RT RNase H in viral proliferation, aptamers that specifically target this domain have not yet been reported. Although aptamers inhibiting RNase H activity have been reported, they were selected against the entire HIV RT. We have used the RNase H domain of HIV-1 RT in our selection process to select, by definition, thioaptamers that bind directly to RNase H. In this paper, we report the in-vitro combinatorial selection of monothio-phosphate modified DNA thioaptamers that selectively bind to the RNase H domain of HIV-1 RT, inhibit RNase H activity, and exhibit antiretroviral activity.

MATERIALS AND METHODS

Materials

NTPs and HIV-1 RT were purchased from Amersham Bioscience (Piscataway, NJ). 3H-UTP was purchased from NEN (Boston, MA). The chirally pure Sp isomer of dATP (αS) was obtained from Biolog Life Science Institute (Bremen, Germany). TOPO TA cloning kits were obtained from Invitrogen (Carlsbad, CA), the plasmid isolation kits were obtained from Qiagen (Foster City, CA), and AmpliTaq DNA polymerase and other PCR consumables were purchased from Applied Biosystems (Foster City, CA). The transfection agent Oligofectamine (OF) was purchased from Invitrogen.

Preparation of HIV-1 RNase H

We have constructed a new T7 RNA polymerase/IPTG-inducible plasmid whose insert encodes the 15 kDa RNase H domain of HIV-1 RT. The plasmid containing the coding region of HIV-1 RNase H (strain HXB2) was cloned into pET30a(+) vector (Novagen), transformed and expressed E.coli, and purified as described previously (23). Both unlabeled and uniformly 15N-labeled protein were purified to homogeneity after the over expression in minimal media or minimal media containing 15NH4Cl. This procedure yields excellent quantities of pure RNase H (ca. 20 mg/L in an E. coli expression system). Expression tests in rich, minimal and 15N-labeled minimal media provided the 15 kDa fragment (by SDS PAGE). The authenticity of the protein was confirmed by N-terminal sequencing and NMR spectroscopy.

Synthesis of DNA Libraries

The chemically synthesized random combinatorial library is a 62 nucleotide long single strand DNA containing a 22 nucleotide random region flanked by 19- and 21-nucleotide long PCR primer regions (Figure 1). The library was annealed with the reverse primer, subjected to Klenow reaction for 5 hrs at 37 °C, and amplified by PCR using AmpliTaq DNA polymerase and a mixture of dATP(αS), dTTP, dCTP, and dGTP to give the thioaptamer-substituted library. Reaction conditions for the PCR-amplifications were: oligonucleotide library (40 nM), dATP(αS) (160 μM), mixture of dTTP, dCTP, and dGTP (80 μM each), MgCl2 (2 mM), primer (400 nM of each) and AmpliTaq DNA polymerase (1 U) in a total volume of 100 μl. PCR was run for 35 cycles of 94 °C (2 min), 55 °C (2 min) and 72 °C (2 min). The resulting 62-mer library contained monothiophosphate substitutions at the phosphate 5′ to every dA residue, in the Sp configuration with the exception of the primer region on the non-template strand. Standard phosphoryl PCR amplification was carried out with a mixture of dNTPs (80 μM each) along with the other reagents for 25 cycles of 94 °C (1 min), 45 °C (1 min) and 72 °C (1 min). For the EMSA, 5′-fluorescein labeled thioaptamers were synthesized using a PCR primer labeled with fluorescein at the 5′- end. We observed incomplete amplification of the thioaptamers resulting in shorter sequences. This is caused by the formation of secondary structures particularly in GC rich regions (24). To minimized this formation of secondary structures of the DNA template we used Betaine solution (1M, Sigma) and DMSO (5%v/v, Sigma) in the PCR reaction mixture.

FIGURE 1.

FIGURE 1

Open in a new tab

The DNA library sequence. The random region is marked as N22. The sequence has a 19-mer forward primer and a 21-mer reverse primer.

Combinatorial Selection of Thioaptamers

Purified RNase H protein was incubated with the previously nitrocellulose-filtered (to exclude sequences that bind to nitrocellulose) PCR-amplified, monothio DNA library in a binding buffer containing 50 mM Tris-HCl, 1.25 mM MgCl2, 25-400 mM KCl and 10 mM DTT in a total volume of 50 μl for 1 hr at ambient temperature, then passed over nitrocellulose filters. The filters were washed (4 × 1ml) with binding buffer to remove the unbound and weakly-bound DNA. After the washes, thioaptamers bound strongly to the protein are retained on the filter. A 0.5 ml solution of 8 M urea and 2 M KCl was added to elute the thioaptamers bound to the protein. A negative control experiment without the protein was performed simultaneously to monitor any nonspecific binding of the thiophosphate library to the filter. The eluted DNA was extracted and PCR amplified for use in the next round of selection. The amplified DNA was analyzed by non-denaturing 15% polyacrylamide gel electrophoresis. The stringency of selection was tightened at each selection round by decreasing the amount of protein and by gradually increasing the salt concentration (from 25 to 400 mM) in the binding buffer. A subset of sequences from the initial library and from selection rounds 5, 8, 12 and 14, were determined. A chemically synthesized double stranded 62-mer, 5′ATAGTTACTAACTGACAGTACACTAGTGAACTTGATGTTAGACTG AAGTACTTTAACATACC3′, was used as a control for the inhibition experiments. The sequence of this random 62-mer does not have any transcription factor binding sites. Since NF-κB and AP-1 transcription factor binding sites are found in the promotor region of the HIV-1 LTR (25, 26), ODNs able to bind to these sites would interfere with viral replication. We also tested the effect of an AP-1 specific ODN, XBY-S2. Thioaptamer XBY-S2 (27) is a 14-mer with 6 dithio-phosphate substitutions (5′CCAGTGACTCAGTG-3′) that includes a consensus AP-1 binding site.

Electrophoresis Mobility Shift Assay

One of the selected thioaptamers, R12-2, was used to test the specific binding to RNase H. R12-2 was enzymatically labeled at the 5′-end with fluorescein and was incubated with increasing concentrations of the protein (isolated RNase H domain or intact HIV-1 RT RNase H) in 50 mM Tris-HCl buffer (pH 8), 10 mM MgCl2 and 40 mM DTT at 37 °C for 30 minutes. The reaction mixture was loaded onto a native 8% polyacrylamide gel, which was electrophoresed and analyzed on a FluorChem 8800 imager (Alpha Innotech, CA). A similar experiment was performed with the E.coli RNase H, to test whether R12-2 binds to the RNase H from E.coli.

HIV-1 RT RNase H Activity Assay

A DNA: RNA heteroduplex containing radiolabeled RNA was prepared as a substrate for RNase H. A tritium-labeled 18-mer RNA molecule, the stem loop 2 of the HIV-1 psi-RNA (28), was made by in-vitro transcription using T7 RNA polymerase with a mixture of ATP, CTP, GTP and 3H-UTP. Transcribed RNA was purified by centrifugation using Microcon YM-3 filters (Amicon) to remove unused NTPs and short RNA sequences. The purified RNA was annealed with the complementary DNA strand to form an RNA:DNA hybrid in which the RNA strand was 3H-labeled. HIV-1 RT (0.35 μM) was incubated with R12-2 thioaptamer (0.5 to 2.0 μM) in a buffer containing 50 mM Tris-HCl (pH 8.0), 6 mM MgCl2, 10 mM DTT and 80 mM KCl for 30 min at 37 °C. To this mixture, labeled RNA:DNA hybrid (40 000 cpm) was added to a final volume of 50 μl and incubated at 37 °C for 20 min. The reaction was quenched by the addition of 150 μl of 10% trichloroacetic acid, and the mixture was placed on ice for 10 min. The reaction mixture was filtered and washed, and the amount of radioactivity in the filtrate was measured using a scintillation counter (Beckman Coulter, CA). Radioactivity in the filtrate would be proportional to RNase H activity. A control experiment was performed without any HIV-1 RT, and 100% RNase H activity is assumed in the absence of any R12-2 thioaptamer.

NMR Spectroscopy

Uniformly 15N-labeled RNase H and chemically synthesized R12-2 were used to monitor the binding of the R12-2 thioaptamer to the isolated RNase H domain. The oligonucleotide concentrations were calculated from the absorbance values and the molar absorption coefficients calculated using the nearest neighbor parameters. 15N-HSQC spectra (29) of the isolated RNase H in the presence of 25 mM MgCl2 were acquired on a Varian UnityPlus 750 MHz instrument equipped with pulse field gradients and triple resonance probes. One dimensional proton NMR and 2D NOESY spectra (250 ms mixing time) of R12-2 thioaptamer in 95% H2O/ 5% D2O were collected. The signals from the R12-2 imino protons, which are very sensitive to changes in the DNA conformation, were monitored during the titration of RNase H to the R12-2.

Viruses and Cells

HIV-1 SF162-R5 is a primary isolate that uses CCR5 as a co receptor (R5), and was obtained from the NIH AIDS Research and Reference Reagent Program. U373-MAGI-CCR5 cells have modifications of the U373 astrocytoma adherent cells that are used for HIV transfection and infection experiments. U373-MAGI-CCR5 cells express β-gal under the control of HIV LTR, which is trans-activated by the HIV Tat protein in relation to the level of virus replication. In addition, these cells express CD4 and the human chemokine receptor CCR5 on its surface, which allow infection by primary HIV-1 strains. U373 cells are propagated in 90% Dulbecco’s Modified Eagle Medium (DMEM), 10% fetal bovine serum, 0.2 mg/ml G418, 0.1 mg/ml hydromycin B, and 1.0 μg/ml puromycin. For transfection and infection experiments, U373 cells were maintained in 90% DMEM, 10% fetal bovine serum, and 1% penicillin/streptomycin. Thioaptamer R12-2, AP-1-specific XBY-S2 or the random 62-mer ODNs were transfected into the cells 24 hr prior to infection using Oligofectamine (OF) liposomes, according to the manufacturer’s instructions (Invitrogen).

Infection of ODN-Transfected U373-MAGI-CCR5 Cells

Transfected cells and control cells were infected with HIV-1 at m.o.i. of 0.003 (which consistently gives high levels of viral production) for 2 hr. Equal volumes of medium were then added and the infection was continued for 48 hr. HIV-1 replication was quantified in cell lysates by measurement of β-gal activity, as determined by luminometry using the β-Glo kit (Promega) according to the manufacturer’s guidelines. β-gal activity is expressed as relative light units (RLU). To determine HIV-1 TCID50 (50% tissue culture infective dose) in U373-MAGI-CCR5 cells, serial dilutions (10x) of SF162-R5 virus supernatant were inoculated onto a 24-well plate containing 3×104 U373 cells for 2 hr, then equal volumes of complete medium were added, and the infection was continued for 48 hr. Cells then were lysed and assayed for HIV-directed β-gal expression, and TCID50 values were calculated from quadruplicates. The p24 antigen concentrations were measured (p24 antigen capture assay, Beckman-Coulter) to determine virus production in culture supernatants harvested at day 7 post-infection.

RESULTS

PCR Amplification of Thioaptamers

For the amplification of DNA sequences with monothio phosphate substitutions, dATP(αS) was used in the PCR reaction mixture (thio-PCR) along with dGTP, dTTP and dCTP. Only the Sp isomer of the dNTP(αS) is used as a substrate by the AmpiliTaq DNA Polymerase enzyme to yield the pure Rp stereoisomer (30). Yields from the thio-PCR were 20-35% lower compared to yields obtained using all four normal dNTPs. To compensate for the loss of yield in the thio-PCR, reaction conditions were changed by doubling the concentrations of dATP(αS), increasing the annealing temperature by 10 °C from 45 °C to 55 °C and by increasing the number of PCR cycles from 25 to 35.

Sequences of Selected Thioaptamers

After twelve rounds of selection, the monothio library converged to a few predominant sequences out of the starting library containing (hypothetically) 1014 different sequences. Sequences from the variable region of the thioaptamers selected after the 12th and 14th rounds shown in Figure 2, were grouped into three classes based on primary sequence alignment by the Clustal W program (31). Sequences that showed very high degrees of alignment are placed in class I, while those that do not align well are listed under class II. The aptamers with truncated variable regions are listed under class III. These truncated thioaptamers had 10-15 base pairs in the variable region as opposed to 22 base pairs in the original library. It is possible that the shorter thioaptamers (Class III) could have been formed by inefficient or incomplete amplification of the library during the PCR cycles. However, sequences in all three classes showed similar sequence motifs. The sequences of the selected thioaptamers showed G-rich sequences at their 5′ ends. These G rich sequences, with a minimum of four interspersed G nucleotides, are known to have the potential to form G-quartet structures (32, 33, 34). Recent reports of single strand DNA aptamers selected against HIV-1 RT, HIV-1 integrase, and human RNase H also showed G-rich sequences that could form G-quartet structures (16, 17, 18, 35).

FIGURE 2.

FIGURE 2

Open in a new tab

Sequences of the selected thioaptamers after the 12th and 14th rounds of selection. Only the variable region of the thioaptamer is shown. Sequences showing higher degrees of alignment are grouped in class I and those with lower degrees of alignment are in class II. Truncated sequences are listed under class III.

EMSAs Showed Selective Binding of R12-2 to the RNase H Domain of HIV-1 RT

In EMSA experiments, the lead thioaptamer R12-2 showed specific binding to the isolated RNase H domain of HIV-1 RT (Figure 3). The intensity of the free DNA band (lower band) decreased with increasing RNase H concentration, showing the increased binding of R12-2 with the increase in protein concentration. Under identical conditions, however, the R12-2 did not show any significant binding to the RNase H of E.coli, a structurally similar protein. Similarly, the initial library did not show any binding to the isolated RNase H domain of HIV-1 RT nor to the intact HIV-1 RT (Figure 3).We also tested the binding of R12-2 to the intact HIV-1 RT. Two bands were visible in these gels (Figure 4A). The lower band corresponds to the free oligonucleotide, and the shifted upper band corresponds to the oligonucleotide bound to the protein. Presence of protein in the upper band was detected by staining the gel with Coomasie blue. With increasing protein concentrations, the intensity of the protein-bound DNA band (upper band) increased while the intensity of the free DNA band (lower band) decreased. This observation shows that R12-2 is binding to the HIV-1 RT. The quantitative binding of R12-2 to the HIV-1 RT is shown in the plot of bound band intensity vs. protein concentration (Figure 4B). The dissociation constant (Kd), determined from non-linear regression analysis with the Hill Plot method using the Origin software was 70 nM.

FIGURE 3.

FIGURE 3

Open in a new tab

Binding of thioaptamer R12-2 to different proteins. EMSA of R12-2 shows binding to the RNase H domain of HIV-1 RT protein (■) but not to the E.coli RNase H (●). Initial library clone (▲) did not show binding to the HIV-1 RT. The intensity of the free-DNA band is plotted against the protein concentrations.

FIGURE 4.

FIGURE 4

Open in a new tab

EMSA of the lead thioaptamer R12-2 to HIV-1 RT. (A) Gel electrophoresis mobility shift assay showing binding of R12-2 to the HIV-1 RT. The arrows show the positions of upper and lower bands. Lane 1, no protein. Lanes 2-8 contain proteins in increasing concentrations (0.05, 0.1, 0.2, 0.4, 0.6, 0.8 and 1μM, respectively). (B) Quantitative measurement of the intensity of the DNA band bound to the protein. Intensity of the upper band is plotted against the HIV RT concentration in μM. (Bound band intensities are blanked against the intensity of the band at the HIV RT concentration of 0.0)

NMR Spectroscopy Showed R12-2 Interacts with the RNase H Domain of HIV-1 RT

We used NMR spectroscopic methods to demonstrate the binding of R12-2 to the isolated RNase H domain (data not shown). Imino proton signals of R12-2, the most sensitive indicators of the structural perturbations in DNA conformation, showed broadening with the addition of RNase H, indicating the binding of R12-2 to the protein. The line widths of the imino proton signals increased with the increase in protein concentration and these signals eventually disappeared.

Inhibition of RNase H Activity by Thioaptamer R12-2

The ability of R12-2 to inhibit the RNase H activity was tested using a radio-labeled RNA:DNA hybrid duplex, as described in the methods. Although the RNase H domain can be expressed and isolated as a stable protein, the isolated protein is inactive or very weakly active (23, 36, 37). Therefore, for the inhibition assay (Figure 5), we used the intact HIV-1 RT instead of the isolated RNase H domain. The assay was based on the ability of the RNase H catalytic function in intact HIV-1 RT to cleave the RNA strand in the RNA:DNA hetero-duplex. Addition of 0.5 μM of R12-2 decreased the RNase H activity to 47% compared to the control, where no R12-2 was present. Additional R12-2 decreased the RNase H activity further down to 39%. However, when the R12-2 concentration was increased higher than 2 μM, no further reduction in RNase H activity was observed.

FIGURE 5.

FIGURE 5

Open in a new tab

Effect of the selected aptamer R12-2 on RNase H activity of HIV-1 RT. Radioactivity retained in the filtrate, considered as a measure of RNase H activity, is plotted against the thioaptamer concentration.

R12-2 showed dose-dependent inhibition of HIV-1 replication in vitro

Incubation of U373-MAGI-CCR5 cells, which had been transfected with Oligofectamine (OF) and thioaptamer R12-2 24 h prior to infection with HIV-SF162 (R5; 2 ng, at m.o.i. of 0.003), a prototypic primary HIV strain, resulted in significant reduction of infection, as compared to the cells transfected with the random 62-mer (Figure 6). Inhibition of the HIV-1 infection by AZT is shown for comparison. The ODN specific to the human AP-1, XBY-S2, also showed modest effects on HIV infection (Figure 7). However, the inhibition by the R12-2 is significantly stronger than the inhibition by XBY-S2. The sequence of XBY-S2 includes a consensus AP-1 binding site, and would influence the expression of immune responses in the cell by sequestering AP-1 proteins. The modest inhibition exhibited by XBY-S2 may be due to its ability to serve as a decoy to bind to AP-1 transcription factors. A dose-dependent inhibitory response was demonstrated, with R12-2 doses ranging from 0.03 to 2.0 μg/ml (IC50 < 100 nM) to the same low level as 10 μM AZT (Figure 8). However, the AP-1 specific thioaptamer XBY-S2 did not show significant change in inhibition up to the dose level of 0.25 μg/ml. At higher concentrations (> 0.5 μg/ml) both the XBY-S2 and R12-2 did not exhibit significant change in the percentage of inhibition. Transfection of R12-2 (0.05 μg/ml) resulted in the inhibition of viral replication across a broad range of SF162 (R5) HIV-1 inocula ranging from an m.o.i. of 0.0005 (0.3 ng) to 0.05 (30 ng) as shown in Figure 9. R12-2 showed significant inhibition of the virus at high m.o.i., and viral replication is comparable to that seen with AZT at m.o.i. ≤ 0.005 (0.3 ng p24 as measured by the p24 antigen capture ELISA method). R12-2 does not show any cytotoxicity to the cells (data not shown).

FIGURE 6.

FIGURE 6

Open in a new tab

Effect of R-12-2 in cell infection. U373-R5 indicator cells were transfected with R-12-2 or random 62-mer and then infected the next day with SF-162 virus strain. Viral replication was determined after 48h measuring β-gal activity in cell lysates by luminometry. Controls include mock transfected cells (OF only), thioaptamers without transfection reagent and AZT 10 μM at the time of infection. Significant differences compared to the mock-transfected controls are indicated by asterisks.

FIGURE 7.

FIGURE 7

Open in a new tab

Comparison of inhibition by thioaptamers R12-2 and XBY-S2. Viral replication was determined after 48h measuring β-gal activity in cell lysates by luminometry. Controls include mock transfected cells (OF only), thioaptamers without transfection reagent and AZT 10 μM at the time of infection.

FIGURE 8.

FIGURE 8

Open in a new tab

Dose response of thioaptamer R12-2 (●) and XBY-S2 (○) treatment. Indicator U373-MAGI-CCR5 cells were transfected with various doses of thioaptamer 24 hrs prior to infection with HIV SF162, and analyzed for β-gal activity (RLU) after 48 hrs. Results are presented as % of virus production compared with untreated controls.

FIGURE 9.

FIGURE 9

Open in a new tab

Effect of thioaptamer R12-2 with increasing virus inocula. Two fold dilutions of SF162 supernatant were used to infect U373-MAGI-CCR5 cells 24 hrs after thioaptamer transfection or control condition, and infection was quantified in cell lysates after 48 hrs (RLU). Closed circles (●) represent untransfected cells, closed squares (■) represent cells transfected with R12-2, and open triangles (△) represent control AZT (10 μM).

DISCUSSION

ODNs are emerging as promising alternative therapeutic agents. However, to increase the resistance to digestion by cellular enzymes, modified ODNs have to be developed. Modifications in the phosphate backbone will significantly affect their binding to target proteins, because most of the direct contacts between DNA-binding proteins and their binding sites in DNA involved the phosphate groups (38, 39). Sulfur substitutions of the phosphoric oxygens of ODNs often lead to their enhanced binding to numerous proteins (21, 22). However, complete substitution of phosphoryl oxygens with sulfur appears to make thioaptamers too “sticky” such that they lose their ability to discriminate between target and non-target proteins. Therefore, the total number and positions of thio-substituted phosphates have to be optimized using either rational design principles or by combinatorial techniques to decrease non-specific protein binding, and to enhance only the specific favorable interactions with proteins such as RNase H. Phosphorothioate modifications show increased resistance to digestion by cellular nucleases and often have higher affinity for binding to proteins. They can also be readily synthesized in high yields and enhance favorable pharmacokinetic properties (40). Various pharmacokinetic studies in animals have shown that phosphorothioate analogs are rapidly dispersed to various tissues and cleared through the kidney within acceptable time periods (41). By using only the dATP (αS) during PCR amplification cycles, we have produced thioaptamers that have thio-substitutions only at positions 5′ to the dA residues. Combinatorial selection methods that allow screening of a large number of random sequences in nucleic acid libraries for affinity to proteins facilitate the selection of ODNs that would have the optimal number of thiophosphate substitutions. Our lead thioaptamer, R12-2, showed selective binding to the RNase H of HIV-1 RT. This thioaptamer did not bind to the E. coli RNase H, even though these two proteins are structurally similar. By using selection methods and combinatorial synthesis which incorporates selective sulfur substitution, we have selected a DNA thioaptamer that binds tightly and specifically to the RNase H domain of HIV-1 RT, inhibits the RNase H activity in-vitro and inhibits HIV-1 replication in cell cultures. The selected thioaptamer did not bind to the E.coli RNase H, structurally similar protein

Although the RNase H domain of the HIV-1 RT can be expressed and isolated as a stable protein, the isolated domain is either catalytically inactive or very weakly active. This loss of catalytic activity in the isolated domain is probably not caused by structural differences between the two forms, because the RNase H structures in isolation and in the intact RT are very similar (42, 43). The basis for the inactivity of the isolated domain is attributed mainly to the increased dynamics. Recent NMR studies on the backbone dynamics of the isolated RNase H domain indicate that the intramolecular dynamic behavior of the isolated domain is severe, resulting in the loss of catalytic activity of RNase H in isolation (44, 45). Since we have used the isolated RNase H domain in our iterative selection rounds, the selected thioaptamers are presumed to specifically bind to the RNase H domain of intact RT. However, the R12-2 is a 62-mer duplex and other regions of the duplex very likely extend into the polymerase site of the RT, as observed in various duplex DNA-RT X-ray crystal structures and models (46, 47). The R12-2 reduced the RNase H activity of RT by 50%. However, the inhibition of viral production was more dramatic (Figure 6). It is quite possible that the difference in the inhibition levels between the RNase H activity and the viral production could be the result of R12-2′s inhibition of the polymerase activity of RT. The selected thioaptamer, R12-2, inhibits the function of the RNase H in the intact HIV-1 RT. Because the structures of the RNase H domain are similar in isolation and in intact HIV-1 RT, selecting thioaptamers against the isolated domain that could inhibit the function of the intact HIV-1 RT would be a better choice than selecting aptamers against the intact HIV-1 RT. Selecting against intact HIV-1 RT does not guarantee that the selected aptamer will bind to the RNase H domain. In fact, the selected aptamer may bind to the polymerase domain rather than to the RNase H domain. Perhaps sequences selected against RNase H domain and intact HIV-1 RT could be used adjunctively. As far as we are aware, this is the first report of aptamer that was selected to target the isolated domain of RNase H.

The R12-2 exhibited significant, dose-dependent inhibition of HIV-1 infection. The AP-1 specific thioaptamer XBY-S2 also showed modest inhibition of infection at higher aptamer concentrations (> 0.5 μg/ml). The XBY-S2 thioaptamer was found to bind AP-1 proteins from a macrophage like cell line, and inhibits the binding of AP-1 transcription factor to DNA. (D. G. Gorenstein, personal communication). An AP-1 binding site is shown to be present in the promotor region of the HIV-1 LTR (25). The modest inhibition of HIV-1 infection by XBY-S2 might be due to its ability to bind to AP-1. Inhibition by R12-2 was seen across a broad range of HIV inocula, and it was comparable to AZT treatment at low m.o.i. The inhibition at high m.o.i is noteworthy, since transfection efficiency (“uptake”) of the virus or thioaptamer in some experiments was only 80%. Thus, the thioaptamer activity may be underestimated when compared with the activity of drugs, such as AZT, which are taken up by essentially every viable cell in the culture.

As the HIV epidemic continues to mature through treatment error and emerging resistance to the initial classes of antiretroviral drugs, which include the HIV-1 RT inhibitors, there will be a need to develop treatments directed to new targets. The various inhibitors of HIV entry, targeting attachment, co-receptor binding and fusion will have a substantial impact on the ability to suppress viremia as they are developed for clinical use by extending treatment options, but, additional new classes of drug will inevitably be needed. Combinatorial selection of thioaptamers that bind to novel targets may allow development of therapeutic agents directed to diverse viral functions.

ACKNOWLEDGEMENT

We thank Dr. R. Hodge and the NIEHS synthetic core facility at the UTMB for the chemical synthesis of DNAs, Dr. X. Yang for providing the XBY-S2 sample and Drs. N. Herzog, D. Kallick, and D. Volk for helpful discussions.

Footnotes

†

This work was supported by grants from the NIAID / National Institute of Health (U01-A1054827 and A127744 to D. G. G and R21 AI058194-01A2 to M. R. F.), and the Welch Foundation (H-1296, to D.G.G.).

1
The abbreviations used are:
EMSA
electrophoretic mobility shift assay
HAART
highly active anti-retroviral therapy
HIV-1
human immunodeficiency virus type 1
HSQC
heteronuclear single quantum coherence
m.o.i.
multiplicity of infection
NMR
nuclear magnetic resonance
NOESY
nuclear Overhauser enhancement spectroscopy
ODN
oligonucleotide agents
RNase
ribonuclease
RT
reverse transcriptase

REFERENCES

  • 1.Schatz O, Mous J, Le Grice SFJ. HIV-1 RT-associated ribonuclease H displays both endonuclease and 3′----5′ exonuclease activity. EMBO J. 1990;9:1171–1176. doi: 10.1002/j.1460-2075.1990.tb08224.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Palella FJ, Jr, Delaney KM, Moorman AC, Loveless MO, Fuhrer J, Satten GA, Aschman DJ, Holmberg SD, HIV Outpatient Study Investigators Declining morbidity and mortality among patients with advanced human immunodeficiency virus infection. N. Engl. J. Med. 1998;338:853–860. doi: 10.1056/NEJM199803263381301. [DOI] [PubMed] [Google Scholar]
  • 3.Yeni PG, Hammer SM, Hirsch MS, Saag MS, Schechter M, Carpenter CC, Fisch,l MA, Gatell JM, Gazzard BG, Jacobsen DM, Katzenstein DA, Montaner JS, Richman DD, Schooley RT, Thompson MA, Vella S, Volberding PA. Treatment for adult HIV infection: 2004 recommendations of the International AIDS Society-USA Panel. J. A .M. A. 2004;292:251–265. doi: 10.1001/jama.292.2.251. [DOI] [PubMed] [Google Scholar]
  • 4.Hirsch MS, Brun-Vezinet F, Clotet B, Conway B, Kuritzkes DR, D’Aquila RT, Demeter LM, Hammer SM, Johnson VA, Loveday C, Mellors JW, Jacobsen DM, Richman DD. Antiretroviral drug resistance testing in adults infected with human immunodeficiency virus type 1: 2003 recommendations of an International AIDS Society-USA Panel. Clinical Infectious Diseases. 2003;37:113–128. doi: 10.1086/375597. [DOI] [PubMed] [Google Scholar]
  • 5.Ferguson MR, Rojo DR, von Lindern JJ, O’Brien WA. HIV-1 replication cycle. Clin. Lab. Med. 2002;3:611–635. doi: 10.1016/s0272-2712(02)00015-x. [DOI] [PubMed] [Google Scholar]
  • 6.Majumdar C, Stein CA, Cohen JS, Broder S, Wilson SH. Stepwise mechanism of HIV reverse transcriptase: primer function of phosphorothioate oligodeoxynucleotide. Biochemistry. 1989;28:1340–1346. doi: 10.1021/bi00429a060. [DOI] [PubMed] [Google Scholar]
  • 7.Tuerk C, MacDougal S, Gold L. RNA pseudoknots that inhibit human immunodeficiency virus type 1 reverse transcriptase. Proc. Natl. Acad. Sci U.S.A. 1992;89:6988–6992. doi: 10.1073/pnas.89.15.6988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Stein CA, Cheng YC. Antisense oligonucleotides as therapeutic agents-is the bullet really magical? Science. 1993;261:1004–1012. doi: 10.1126/science.8351515. [DOI] [PubMed] [Google Scholar]
  • 9.Morgan RA, Walker R. Gene therapy for AIDS using retroviral mediated gene transfer to deliver HIV-1 antisense TAR and transdominant Rev protein genes to syngeneic lymphocytes in HIV-1 infected identical twins. Hum. Gene Ther. 1996;7:1281–1306. doi: 10.1089/hum.1996.7.10-1281. [DOI] [PubMed] [Google Scholar]
  • 10.Ellington AD, Szosytak JW. In vitro selection of RNA molecules that bind specific ligands. Nature. 1990;346:818–822. doi: 10.1038/346818a0. [DOI] [PubMed] [Google Scholar]
  • 11.Gold L, Polisky B, Uhlenbeck OC, Yarus M. Diversity of oligonucleotide functions. Annu. Rev. Biochem. 1995;64:763–797. doi: 10.1146/annurev.bi.64.070195.003555. [DOI] [PubMed] [Google Scholar]
  • 12.King DJ, Bassett SE, Li X, Fennewald SA, Herzog NK, Luxon BA, Shope R, Gorenstein DG. Combinatorial selection and binding of phosphorothioate aptamers targeting human NF-kappa B RelA(p65) and p50. Biochemistry. 2002;41:9696–9706. doi: 10.1021/bi020220k. [DOI] [PubMed] [Google Scholar]
  • 13.Agarwal S. Antisense oligonucleotides: possible approaches for the chemotherapy of AIDS. In: Wickstrom E, editor. Prospects for antisense nucleic acid therapy of cancer and AIDS. Liss; New York, N.Y: 1991. pp. 143–159. [Google Scholar]
  • 14.Schneider DJ, Feigon J, Hostomsky Z, Gold L. High-affinity ssDNA inhibitors of the reverse transcriptase of type 1 human immunodeficiency virus. Biochemistry. 1995;34:9599–9610. doi: 10.1021/bi00029a037. [DOI] [PubMed] [Google Scholar]
  • 15.Nickens DG, Patterson JT, Burke DH. Inhibition of HIV-1 reverse transcriptase by RNA aptamers in Escherichia coli. RNA. 2003;9:1029–1033. doi: 10.1261/rna.5550103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Andreola ML, Pileur F, Calmels C, Ventura M, Tarrago-Litvak L, Toulme JJ, Litvak S. DNA aptamers selected against the HIV-1 RNase H display in vitro antiviral activity. Biochemistry. 2001;40:10087–10094. doi: 10.1021/bi0108599. [DOI] [PubMed] [Google Scholar]
  • 17.Pileur F, Andreola ML, Dausse E, Michel J, Moreau S, Yamada H, Gaidamakov SA, Crouch RJ, Toulme JJ, Cazenave C. Selective inhibitory DNA aptamers of the human RNase H1. Nucleic Acids Res. 2003;31:5776–5788. doi: 10.1093/nar/gkg748. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.de Solutrait VR, Lozach P, Altmeyer R, Tarrago-Litvak L, Litvak S, Andreola ML. DNA aptamers derived from HIV-1 RNase H inhibitors are strong anti-integrase agents. J. Mol. Biol. 2002;324:195–203. doi: 10.1016/s0022-2836(02)01064-1. [DOI] [PubMed] [Google Scholar]
  • 19.Paoletti AC, Shubsda MF, Hudson BS, Borer PN. Affinities of the nucleocapsid protein for variants of SL3 RNA in HIV-1. Biochemistry. 2002;41:15423–15428. doi: 10.1021/bi026307n. [DOI] [PubMed] [Google Scholar]
  • 20.Shubsda MF, Paoletti AC, Hudson BS, Borer PN. Affinities of packaging domain loops in HIV-1 RNA for the nucleocapsid protein. Biochemistry. 2002;4:5276–5282. doi: 10.1021/bi016045+. [DOI] [PubMed] [Google Scholar]
  • 21.Milligan JF, Uhlenbeck OC. Determination of RNA-protein contacts using thiophosphate substitutions. Biochemistry. 1989;28:2849–2855. doi: 10.1021/bi00433a016. [DOI] [PubMed] [Google Scholar]
  • 22.Marshall WS, Caruthers MH. Phosphorodithioate DNA as a potential therapeutic drug. Science. 1993;259:1564–1570. doi: 10.1126/science.7681216. [DOI] [PubMed] [Google Scholar]
  • 23.Becerra SP, Clore GM, Gronenborn AM, Karlstrom AR, Stahl SJ, Wilson SH, Wingfield PT. Purification and characterization of the RNase H domain of HIV-1 reverse transcriptase expressed in recombinant Escherichia coli. FEBS Letters. 1990;270:76–80. doi: 10.1016/0014-5793(90)81238-j. [DOI] [PubMed] [Google Scholar]
  • 24.Henke W, Herdel K, Jung K, Schnorr D, Loening SA. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 1997;25:3957–3958. doi: 10.1093/nar/25.19.3957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Liou HC, Baltimore D. Regulation of the NF-αB/rel Transcription Factor and I αB Inhibitor System. Curr.Opin.Cell Biol. 1993;5:477–487. doi: 10.1016/0955-0674(93)90014-h. [DOI] [PubMed] [Google Scholar]
  • 26.Nabel G, Baltimore D. An inducible transcription factor activates expression of human immunodeficiency virus T cells. Nature. 1987;326:711–713. doi: 10.1038/326711a0. [DOI] [PubMed] [Google Scholar]
  • 27.Yang X, Gorenstein DG. Progress in thioaptamer development. Current Drug Targets. 2004;5:705–715. doi: 10.2174/1389450043345074. [DOI] [PubMed] [Google Scholar]
  • 28.Amarasinghe GK, De Guzman RN, Turner RB, Chancellor KJ, Wu ZR, Summers MF. NMR structure of the HIV-1 nucleocapsid protein bound to stem-loop SL2 of the psi-RNA packaging signal. Implications for genome recognition. J. Mol. Biol. 2000;301:491–511. doi: 10.1006/jmbi.2000.3979. [DOI] [PubMed] [Google Scholar]
  • 29.Bax A, Pochapsky SS. Optimized recording of heteronuclear multidimensional NMR spectra using pulsed field gradients. J. Magn. Reson. 1992;99:638–643. [Google Scholar]
  • 30.Eckstein F, Thomson JB. Phosphate analogs for study of DNA polymerases. Methods Enzymology. 1995;262:189–202. doi: 10.1016/0076-6879(95)62018-4. [DOI] [PubMed] [Google Scholar]
  • 31.Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Williamson JR, Raguraman MK, Cech TR. Monovalent cation-induced structure of telomeric DNA: the G-quartet model. Cell. 1989;59:871–880. doi: 10.1016/0092-8674(89)90610-7. [DOI] [PubMed] [Google Scholar]
  • 33.Smith FW, Feigon J. Quadruplex structure of Oxytricha telomeric DNA oligonucleotides. Nature. 1992;356:164–168. doi: 10.1038/356164a0. [DOI] [PubMed] [Google Scholar]
  • 34.Bianchi A, de Lange T. Ku binds telomeric DNA in vitro. J. Biol. Chem. 1999;274:21223–21227. doi: 10.1074/jbc.274.30.21223. [DOI] [PubMed] [Google Scholar]
  • 35.Phan AT, Kuryavyi V, Ma JB, Faure A, Andreola ML, Patel DJ. An interlocked dimeric parallel-stranded DNA quadruplex: a potent inhibitor of HIV-1 integrase. Proc. Natl. Acad. Sci. U.S.A. 2005;102:634–639. doi: 10.1073/pnas.0406278102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Evans DB, Brawn K, Deibel MR, Jr., Tarpley WG, Sharma SK. A recombinant ribonuclease H domain of HIV-1 reverse transcriptase that is enzymatically active. J. Biol. Chem. 1991;266:20583–20585. [PubMed] [Google Scholar]
  • 37.Hostomsky Z, Hostomska Z, Hudson GO, Moomaw EW, Nodes BR. Reconstitution in vitro of RNase H activity by using purified N-terminal and C-terminal domains of human immunodeficiency virus type 1 reverse transcriptase. Proc. Natl. Acad. Sci. U.S.A. 1991;88:1148–1152. doi: 10.1073/pnas.88.4.1148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Botuyan MV, Keire DA, Kroen C, Gorenstein DG. 31P nuclear magnetic resonance spectra and dissociation constants of lac repressor headpiece·duplex operator complexes: the importance of phosphate backbone flexibility in protein·DNA recognition. Biochemistry. 1993;32:6863–6874. doi: 10.1021/bi00078a009. [DOI] [PubMed] [Google Scholar]
  • 39.Cho Y, Zhu FC, Luxon BA, Gorenstein DG. 2D 1H and 31P NMR spectra and distorted A-DNA-like duplex structure of a phosphorodithioate oligonucleotide. J. Biomol. Struct. Dyn. 1993;11:685–702. doi: 10.1080/07391102.1993.10508023. [DOI] [PubMed] [Google Scholar]
  • 40.Tonkinson JL, Guvakova M, Khaled Z, Lee J, Yakubov L, Marshall WS, Caruthers MH, Stein CA. Cellular pharmacology and protein binding of phosphoromono-thioate and phosphorodithioate oligodeoxynucleotides: a comparative study. Antisense Res. Dev. 1994;4:269–278. doi: 10.1089/ard.1994.4.269. [DOI] [PubMed] [Google Scholar]
  • 41.Gallo M, Montserrat JM, Iribarren AM. Design and applications of modified oligonucleotides. Braz. J. Med. Biol Res. 2003;36:143–151. doi: 10.1590/s0100-879x2003000200001. [DOI] [PubMed] [Google Scholar]
  • 42.Davies JF, Hostomska Z, Hostomsky Z, Jordan SR, Matthews DA. Crystal structure of the ribonuclease H domain of HIV-1 reverse transcriptase. Science. 1991;252:88–95. doi: 10.1126/science.1707186. [DOI] [PubMed] [Google Scholar]
  • 43.Chattopadhyay D, Finzel BC, Munson SH, Evans DB, Sharma SK, Strakalaitis NA, Brunner DP, Eckenrode FM, Dauter Z, Betzel C, Einspahr HM. Crystallographic analyses of an active HIV-1 ribonuclease H domain show structural features that distinguish it from the inactive form. Acta Crystallogr. Sect. 1993;49:423–427. doi: 10.1107/S0907444993002409. [DOI] [PubMed] [Google Scholar]
  • 44.Pari K, Mueller GA, DeRose EF, Kirby TW, London RE. Solution structure of the RNase H domain of the HIV-1 reverse transcriptase in the presence of magnesium. Biochemistry. 2003;42:639–650. doi: 10.1021/bi0204894. [DOI] [PubMed] [Google Scholar]
  • 45.Mueller GA, Pari K, DeRose EF, Kirby TW, London RE. Backbone dynamics of the RNase H domain of HIV-1 reverse transcriptase. Biochemistry. 2004;43:9332–9342. doi: 10.1021/bi049555n. [DOI] [PubMed] [Google Scholar]
  • 46.Jacobo-Molina A, Ding J, Nanni RG, Clark AD, Lu X, Tantillo C, Williams RL, Kamer G, Ferris AL, Clark P, Hizi A, Hughes SH, Arnold E. Crystal structure of human immunodeficiency virus type 1 reverse transcriptase complexed with double-stranded DNA at 3.0 Å resolution shows bent DNA. Proc. Natl. Acad. Sci. U.S.A. 1993;90:6320–6324. doi: 10.1073/pnas.90.13.6320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Bebenek K, Berad WA, Darden TA, Prasad R, Luxon BA, Gorenstein DG, Wilson SM, Kunkel TA. A minor groove binding track in reverse transcriptase. Nat. Str. Biol. 1997;4:194–197. doi: 10.1038/nsb0397-194. [DOI] [PubMed] [Google Scholar]

RESOURCES