Serum Angiotensin Converting Enzyme and the Obstructive Sleep Apnea Hypopnea Syndrome

Abstract

Study Objectives:

We wanted to see if the obstructive sleep apnea hypopnea syndrome (OSAHS) causes hypertension and endothelial dysfunction through activation of the angiotensin-converting enzyme (ACE).

Methods:

A cross-sectional followed by a prospective, interventional study in a sleep disordered breathing clinic in a UK Hospital. We measured baseline serum ACE activity and ACE allele frequencies in 26 consecutive (untreated) OSAHS patients, 26 consecutive Sleepy Snorers, and 26 healthy (non-sleepy) controls. The OSAHS and Sleepy Snorers had serum ACE repeated after 6 months, with the OSAHS group receiving CPAP in the interim.

Results:

There was no difference in baseline mean serum ACE among OSAHS (33 IU/L), sleepy snorers (36 IU/L), and healthy controls (32 IU/L), p = 0.63. There was no difference in serum ACE activity between OSAHS and sleepy snorers after 6 months (p = 0.9) and no change in serum ACE from baseline in either group. In particular, there was no change in ACE activity in the OSAHS group on an intention to treat basis or when limiting analysis was limited to only “good” CPAP users (n = 16, p = 0.68), despite significant improvements in their Epworth scores and blood pressure and normalization of the 4% dip-rate.

Conclusions:

Changes in serum ACE activity do not occur in OSAHS; therefore it is unlikely to be associated with the hypertension and other cardiovascular dysfunction often reported in OSAHS.

Citation:

Benjamin JA; Moller M; Ebden P; Bartle I; Lewis KE. Serum angiotensin converting enzyme and the obstructive sleep apnea hypopnea syndrome. J Clin Sleep Med 2008;4(4):325–331.

The obstructive sleep apnea hypopnea syndrome (OSAHS) is the coexistence of excessive daytime sleepiness and obstructive sleep-disordered breathing. The sleepiness is due to sleep fragmentation caused by the sleep disordered breathing (SDB), from repetitive episodes of upper airway collapse.¹ It affects up to 4% of men and 2% of women.² OSAHS is an independent risk factor for hypertension (HT),^3,4,5 and the link between blood pressure (BP) and OSAHS has been extensively reviewed.⁶ BP has been lowered by continuous positive airways pressure (CPAP) therapy in patients with OSAHS on an intention to treat basis,⁷ but its beneficial effects on BP may be limited to only those with daytime sleepiness.⁸ The exact mechanisms associating OSAHS and HT have not been fully elucidated. One explanation is that baseline hypoxia leads to sympathetic overdrive and secondary HT^9,10; although treating OSAHS with oxygen has no effect at all on BP despite improving (but not normalizing) the SDB and actually correcting mean saturations.¹¹ Sympathetic overdrive caused by repetitive desaturations and then re-oxygenations (rather than pure hypoxia) is a related theory and has been more reliably demonstrated.^9,12 An alternative and less researched mechanism for the HT seen in OSAHS may be activation of the renin angiotensin aldosterone pathway by hypoxia/ reoxygenation. The angiotensin-converting enzyme (ACE) is a ubiquitous enzyme found in serum, lung, brain, testicular, liver and splenic tissue, smooth muscle, and arterial endothelial cells. Its widespread distribution within the body suggests many of its actions are still unknown.

ACE can cause HT by at least 3 mechanisms: It catalyses the conversion of angiotensin I to angiotensin II,¹³ which is a potent vasoconstrictor. ACE helps inactivate bradykinin, a potent vasodilator, and increases smooth muscle proliferation within the intima of blood vessels.¹⁴ ACE is also involved in the formation of atherosclerotic plaque^14,15 so it is important in mediating endothelial function, which not only is related to cardiovascular pathology¹⁶ but has been shown to be abnormal in OSAHS.¹⁷ ACE inhibitor drugs and receptor antagonists are widely used to lower systemic BP and improve cardiac function.

Erdos has asked what controls levels of ACE in endothelial cells?¹³ The renin angiotensin system is often activated in parallel with sympathetic activation,¹⁸ which occurs in OSAHS, so it is plausible ACE could be activated directly by hypoxia or indirectly by increased sympathetic drive (or both). We have shown positive correlations between serum ACE and nocturnal diastolic BP in patients with OSAHS but not in overweight, sleepy controls without SDB.¹⁹ Barcelo et al found higher levels of serum ACE in patients with OSAHS compared to healthy, volunteers and suggested that the episodes of hypoxia/reoxygenation that occur in OSAHS do indeed stimulate ACE synthesis. They recommended an intervention study looking at the effects of CPAP on serum ACE to “confirm or refute” the theory that SDB activates the renin-angiotensin system.²⁰ To our knowledge, such an intervention study has not been reported.

The aims of our study were twofold:

1. To compare serum ACE activity in OSAHS patients to patients with similar symptoms and elevated ESS but without SDB (to tease out any independent effects of tiredness) and also non-sleepy controls from the same geographical region.

2. To re-measure serum ACE levels in OSAHS once any SDB is adequately treated.

METHODS

Subjects and Ethics

Following local/regional ethical approval (Ref: WM/03/104), subjects were recruited prospectively from a SDB clinic in the UK between 2004 and 2006. They were all Caucasian and aged 18 to 80 years. They were referred from both primary and secondary care with varying degrees of symptoms suggestive of OSAHS (all complained of daytime sleepiness, all had a history of snoring and/or nocturnal apneas). Exclusion criteria were: refusal to give written informed consent (n = 3), those with sleepiness from other causes including insomnia (n = 0), coexistent restless legs syndrome (clinical history and sleep study, n = 2), periodic limb movement disorder (clinical history and sleep study, n = 0), and symptoms of narcolepsy (n = 0) or circadian rhythm disorders (n = 1). We also excluded anyone prescribed ACE inhibitors (n = 12), or with diseases known to affect serum ACE activity such as granulomatous disease, liver cirrhosis, thyroid dysfunction, chronic renal failure, and/or active psychiatric disorders (n = 0).

Procedure

Demographic data

The following variables were recorded in afternoon clinic at baseline: presence of comorbidity (including HT), prescribed medication, afternoon BP, and BMI. Symptoms of daytime tiredness were noted and sleepiness was estimated by self-reported tendency to fall asleep using the Epworth Sleepiness Scale (ESS) score.

Any patient with a serum ACE level > 55 IU /L (n = 3) also had a chest x-ray, liver and thyroid function tests, and serum autoimmune profile, so that other possible (undiagnosed) causes of raised serum ACE were excluded before study entry.

Blood Pressure

This was taken midafternoon from subjects in a sitting position with an automated sphygmomanometer. (Gamma XXLLF, Heine, Germany). Arterial hypertension was defined as requiring antihypertensive medications or having a systolic blood pressure (SBP) > 140 mm Hg or a diastolic blood pressure (DBP) > 90 mm Hg.

Plasma Angiotensin-Converting Enzyme Activity

Blood samples were taken from an antecubital vein, in the sitting position between 14:00 and 16:00 (in clinic) and collected in tubes without anticoagulant. ACE activity was measured from plasma by a method based on that described by Holmquist et al,²¹ employing a Sigma Diagnostics kit (Sigma Chemical Company, Ltd, Poole, Dorset) on a Roche MODULAR P unit (Roche Diagnostics, Lewis Sussex). The upper limit of normal using this assay is 55 IU/L.

Extraction of Genomic DNA and Genotyping

Whole blood was collected in EDTA-containing tubes and genomic DNA was extracted from leucocytes according to standard protocols using QIAamp DNA blood mini kit (Qiagen, Germany). The I and D alleles were identified using polymerase chain reaction (PCR) of intron 16 of the ACE gene followed by gel-electrophoresis. The PCR was set up as follows: in a total volume of 20 μL, about 50 ng genomic DNA was added, 10 pmol of each primer (forward: 5′CTGGAGACCACTCCATCCTTTCT 3′ reverse: 5′ GATGGTGGCCATCACATTCGTCAGAT 3′), 1 x CoralLoad buffer (Qiagen) containing 1.5 mM MgCl₂, 50μM of each dNTP and finally 1U of Taq polymerase was added. The fragments were amplified for 32 cycles with denaturation at 94°C for 1 min, annealing at 59°C for 45 sec, and extension at 72°C for 1.5 min followed by a final extension of 72°C for 10 min. The amplified fragments; the I-allele of 490 base pairs and D-allele of 190 base pairs were identified by agarose (1,5%) gel-electrophoresis and EtBr-staining. A subset of 8 fragments (4 of I-allele and 4 D fragments) was purified and the DNA sequence determined to confirm the ACE identity.

Sleep Studies

All subjects from the SDB clinic complaining of daytime tiredness had a limited channel, home sleep study (Embletta, Resmed, Sydney, NSW, Australia), measuring oronasal flow, thoracoabdominal movements, finger pulse oximetry, and electrocardiogram. Patients with a 4% oxygen dip rate (DR) ≥ 10 events per hour were classified as OSAHS; traces were reviewed manually to confirm episodes were predominantly obstructive rather than central. Those with symptoms but a DR ≤ 9/hr were classified as Sleepy Snorers. The first 26 diagnosed with OSAHS were included and thereafter those with positive sleep studies were not included. Sleep studies were continued until we had enough negative results to obtain 26 Sleepy Snorers. OSAHS subjects spent a further night in hospital for CPAP autotitration, before being issued with Sullivan C6 CPAP machine (Resmed, Sydney, NSW, Australia). OSAHS patients were all CPAP naïve and were then advised to use their machine as much as possible while asleep. Further equipment (humidifiers, masks, and new headgear) was issued at the discretion of our chief sleep technician. Home oximetry and clinical review after 1 month of CPAP treatment confirmed a residual 4% DR <3/h while on CPAP. A clinical review the day after this oximetry confirmed that symptoms (including ESS) had also improved, and that they were tolerating CPAP.

Healthy, non-sleepy controls were selected from hospital staff from the same geographical population. In order to try to match from the same gene pool, we did not recruit non-Caucasian staff or those born outside a 100-mile radius of the hospital (nearly all patients were born locally). Other exclusion criteria for the healthy controls were refusal to take part (n = 9), self-reported excessive daytime sleepiness or ESS > 9 (n = 1), any medical condition known to affect serum ACE (n = 0), known hypertension or daytime BP > 140/80 (n = 1), and anyone prescribed ACE inhibitors (n = 0).

Both OSAHS patients and Sleepy Snorers had repeat daytime BP recording, ESS, and serum ACE 6 months after their initial assessment. OSAHS patients had their average nightly CPAP use estimated from inbuilt clock timers that recorded on-time.

The referring physicians were notified of the study and asked that no patient be commenced on ACE inhibitors during the study. This was verified at interview and drug prescription lists at 6 months.

Figure 1 illustrates the Patient Flow Chart.

Figure 1.

Patient Flow Chart

Statistical Analysis

In a pilot study, 10 patients with OSAHS had mean ± SD ACE activity of 41 ± 11 IU/L. Our laboratory assays quoted a population mean of 30 ± 11 IU/Ls. Assuming a normal distribution of serum ACE activity in both groups, that Sleepy Snorers would be similar to the population mean and our laboratory's internal performance, we calculated we would need 22 subjects in each group to show a statistically significant difference in mean serum ACE, with a power 0.8, α error 0.05 and β error 0.1. To account for losses to follow-up, we wanted to recruit 26 patients per group.

We used SPSS (Chicago, Illinois) version 13.0. Results are presented as means ± SD. Following tests for normality, continuous variables were compared between the 3 groups at baseline using one-way analysis of variance (ANOVA) incorporating the Bonferroni calculation or Kruskal-Wallis test. Categorical variables (proportions) were compared using chi-square, incorporating the Fisher exact test. Where data was only available in the OSAHS and Sleepy Snorers group, they were compared using non-paired t-tests, Mann-Whitney, and chi-square as appropriate.

Within group changes, over time, were assessed using Wilcoxon rank, initially on an intention-to-treat basis, but also in a post hoc subgroup analysis only in those with ≥ 4-h mean CPAP on-time per night. Correlations were explored using the Spearman or Pearson tests. Genotype distributions were compared by the Chi-squared test and ANOVA was used to test for genetic associations. Throughout, a p-value < 0.05 was considered statistically significant.

RESULTS

OSAHS and Sleepy Snorers had similar ages (95% confidence interval for difference, −5.5 to 5.0 years, p = 0.92), but the healthy controls were significantly younger. OSAHS and Sleepy Snorers were matched for baseline ESS (Z = −0.96, p = 0.34), but the healthy controls had lower ESS. The OSAHS and Sleepy Snorers had a similar number of males and had statistically similar daytime BP. As expected, the OSAHS group was heavier and had a higher 4% DR than the Sleepy Snorers.

There was no difference between groups in baseline serum ACE activity.

In the 52 subjects with sleep studies, the overall correlation between 4% DR and baseline serum ACE activity was Rho = −0.114, p = 0.42. The correlation between 4% DR and systolic BP was Rho = 0.297, p = 0.03 and between 4% DR and diastolic BP was Rho = 0.106, p = 0.46.

Angiotensin-Converting Enzyme Activity

Figure 2 shows serum ACE in the OSAHS Group and Sleepy Snorers at baseline and after 6 months.

Figure 2.

Serum ACE in the OSAHS Group and Sleepy Snorers at baseline and after 6 months.

There was no significant change in serum ACE from baseline within both groups (p = 0.86 and p = 0.56) and no difference between the OSAHS and Sleepy Snorers at 6 months (95% CI for difference −14.0 to 12.2 IU/L, p = 0.86).

Three OSAHS patients did not reattend at 6 months; 6 more re-attended but had stopped using their machines at various times before the assessment and we could not get reliable usage data. One patient did not bring his machine (despite attending for repeat serum ACE and claiming he still used it), so we could not validate his CPAP on-time. Therefore, 16 OSAHS patients had reliable readings with good nightly CPAP use over 6 months, on average, 6.3 h/night. These 16 patients included 12 males, mean age = 47.8 ± 10.0 years, mean BMI = 39.9 ± 8.5 kg/m², mean ESS = 15.4 ± 5.7 and mean 4% DR = 47.5 ± 28.0. They were not statistically different in baseline demographics to the poor CPAP users (p > 0.13 throughout). Limiting analysis to these 16 “good users,” there was still no change in their serum ACE activity at 6 months from baseline, despite normalization of the 4% DR (confirmed by oximetry at 1 month) and statistically significant improvements in daytime diastolic blood pressure and ESS and a trend towards a significant fall in daytime systolic blood pressure over the same CPAP treatment period (see Table 2).

Table 2.

Mean Changes in Serum ACE, Epworth Score, and Daytime Blood Pressure in Those with OSAHS and at Least 4 Hours CPAP Use Per Night

Variable	Baseline	6 Months	p-Value
Serum ACE (IU/L)	36.3 ± 17.9	39.9 ± 26.0	0.68
Epworth score	15.9 ± 5.6	6.7 ± 5.8	0.002
Systolic blood pressure (mm Hg)	142 ± 26	133 ± 23	0.096
Diastolic blood pressure (mm Hg)	86 ± 9	76 ± 9	0.001

Genotype Distribution and Allele Frequency

The 3 groups had similar proportions of each ACE allele and no genetic associations were revealed between the allele frequencies/genotypes and the groups (see Table 1). The overall population (all cases + controls) was in Hardy-Weinberg equilibrium for the I/D variant of the ACE gene (chi-square test, p = 0.80). There was an interaction with the Insertion and Deletion alleles with the highest ACE levels in the DD genotype (p = 0.0002), the effect was clearly additive (details omitted).

Table 1.

Physical and Genetic Characteristics of the Three Groups at Baseline

Variable	OSAHS n = 26	Sleepy Controls n = 26	Healthy (non-sleepy) Controls n = 26	p - value
Male	21	16	14	0.11
Hypertensive	12	9	-	0.57
Age (years)	47.5 ± 11.2	47.8 ± 7.3	40.1 ± 12.0	0.03
BMI (kg/m2)	38.4 ± 8.0	32.3 ± 5.2	-	0.002
Epworth Score	14.7 ± 5.8	13.4 ± 5.5	3.1 ± 2.3	<0.001
4% Dip Rate (events/hr)	42.2 ± 26.4	4.8 ± 3.3	-	<0.001
Systolic blood pressure (mm Hg)	139.6 ± 23.8	129.8 ± 11.7	-	0.09
Diastolic blood pressure (mm Hg)	82.6 ± 12.3	82.2 ± 11.4	-	0.68
Serum ACE (I/U)	32.9 ± 15.6	36.2 ± 19.0	32.1 ± 13.2	0.63
Genotype distribution (%)
Genotype II	24.0	11.5	26.9
Genotype ID	32.0	61.5	42.3	0.25
Genotype DD	44.0	26.9	30.8
Allele freq (%)
Allele I	40	42.3	48.1	0.71
Allele D	60	57.7	51.9

DISCUSSION

This is the first study to report no difference in serum ACE activity (or frequency of ACE gene polymorphisms) between OSAHS subjects, and snorers matched for sleepiness as well as healthy non-sleepy controls from the same geographical area.

Furthermore, this is the first study that repeated serum ACE activity in OSAHS patients after treatment with CPAP and found no difference despite statistically significant and likely clinically important improvements in BP, sleepiness and 4% DR. This was both on an intention-to-treat basis and when limiting analysis to only good CPAP users. Finally, we found no difference between OSAHS and Sleepy Snorers after 6 months of treatment in the former. These findings suggest that serum ACE activity is not an important marker or a likely driver for the cardiovascular dysfunction seen in OSAHS.

Barcelo's was the only other study measuring serum ACE activity in subjects with SDB. In contrast to us, they found higher plasma ACE activity in untreated OSAHS patients compared to controls but like us, they also found no difference in the frequency distribution of the ACE alleles between OSAHS and non-OSAHS groups. Their study differs in several ways: it only included patients with severe OSAHS (mean AHI = 54.5/h) and compared them with healthy (non-obese) controls matched for age and sex. They did not use symptomatic controls and therefore could not tease out any independent effects of excessive sleepiness per se as opposed to SDB. Barcelo's subjects were recruited from a Spanish sleep unit, but we do not know their ethnicity, and OSAHS was only excluded clinically in their control group (i.e., not with negative sleep studies). They did not explain why they measured serum ACE only in 46 from 63 recruited subjects, and so may be prone to some sort of selection bias. Most importantly, they did not repeat ACE levels after treatment of OSAHS.²⁰ We wanted to control for the effects of sleepiness on serum ACE, as it is the presence of sleepiness combined with SDB that seems important in affecting cardiac dysfunction in OSAHS^11,22 and particularly the BP response to CPAP.⁸ Our sleepy snorers had other causes of sleepiness excluded on clinical history, examination. and limited channel sleep studies, but we did not do polysomnography to look for abnormities in sleep architecture. Our cut-off for OSAHS of a 4% DR of 10/h meant that we could have included some patients with upper airways resistance syndrome in the sleepy snorers group (e.g., with a 4% DR 8 to 9/h), especially given the night-to-night variation in sleep studies. However, the benefits of CPAP in this group are still being evaluated and our cut-off of 10 events per hour is similar to most others.

Several cardiovascular disorders have been linked to the presence of an insertion (I) deletion (D) polymorphism of the ACE gene,^23–28 and these genes do contribute to serum activity.^27,29 The frequency of these ACE polymorphisms therefore need to be accounted for as potential confounders in any study of serum ACE activity and cardiovascular dysfunction. We found no differences in the frequencies of the Insertion and Deletion polymorphisms for the ACE gene between OSAHS, sleepy snorers, or a healthy non-sleepy (working) population, from the same geographical region. Most related studies have concentrated on these genetic polymorphisms in OSAHS rather than serum ACE activity. The relationship is complex; Lin et al found the association of the Deletion (D) allele with HT was most pronounced in subjects with mild to moderate degrees of sleep apnea (AHI 5 to 30/h) and but not in severe sleep apnea (AHI >30/h).³⁰ This group did not measure serum ACE activity. In another large (retrospective) cohort, (Cleveland Family Study), Patel found no association between ACE genotype and OSAHS; but after controlling for age, sex, race, and obesity, they found that the D allele may actually protect against HT in the setting of (especially severe) OSAHS.³¹ Only one study reported a difference in frequencies of the ACE polymorphisms between OSAHS and healthy controls, with the Insertion-I allele being more frequent in OSAHS. This study was in a different ethnic population (Chinese). Additional issues were their liberal definition of hypopnea (including the need for either a 4% oxygen desaturation or an arousal) and a small sample size (n = 34) for a study using genetic distributions as a primary outcome.³² Our findings of no differences in genetic frequencies concur with most others^30,31 but we do not have enough numbers to meaningfully stratify by HT category or severity of OSAHS to see if the D allele is protective at higher levels of SDB. We measured allele frequency only to account for it as a known confounder on serum ACE activity, and groups were matched.

Like others,³³ we found higher plasma ACE activity in subjects with the ACE D allele (details omitted) suggesting the same genetic mechanisms determining serum ACE activity in normals are applicable also in OSAHS and sleepy snorers. The ACE–D has also been directly associated with the presence of hypertension,³⁴ so it was important that the groups were matched for this. Lin postulated that the D allele interacted with mild-moderate SDB to cause HT, but the D allele had no effect on HT when the AHI was > 30/h, possibly because other factors such as sympathetic overdrive come in to play with severe SDB.³⁰

Our study has some weaknesses. Our total sample size precludes a subgroup analysis according to the severity of SDB; but like the only other study measuring ACE activity,²⁰ we found no correlation between ACE and the 4% DR, suggesting it is not activated in a linear fashion by increasing frequency of apneas/ hypopneas. Our serum ACE was measured in the afternoon; ACE activity may be higher immediately after a night of SDB, with the biggest (relative) falls occurring only immediately after treatment with CPAP, before rising again during the day due to other factors. To minimize any confounding effects of circulating cortisol on BP, serum ACE was always measured at the same time of day. Although the biggest improvements in BP occur overnight with treatment,⁷ CPAP has been shown to improve daytime BP and daytime endothelial function.^7,8,11,12 Indeed, we saw improvements in daytime BP in our OSAHS, and if serum ACE was indeed an important determinant of BP in OSAHS, any corresponding change in ACE should also be detectable in during the day. Pitt found that brain ACE activity in anesthetized dogs did not change during controlled periods of hypoxia or hypercapnia,³⁵ but it is conceivable that changes occur in endothelial ACE along with endothelial function and not serum ACE. Endothelial ACE is not easily measured.¹³ It is possible that serum ACE in OSAHS may change with longer than 6 months of CPAP use but the similar levels at baseline, lack of correlation between ACE and 4% DR and clear improvements in ESS and BP within 6 months of starting CPAP suggest this period of treatment is sufficient.

Ideally, all our groups would be case matched for variables known to affect BP. The OSAHS patients were heavier than sleepy snorers and healthy controls, but like Barcelo,²⁰ we found no relationship between BMI and baseline serum ACE (rho = 0.057, p = 0.69); thus BMI is unlikely to be an important confounder on ACE. Our OSAHS group tended to have more males, and males have been reported to have higher ACE activity levels than females in other populations,³⁶ but the difference in proportions who were male was not statistically significant. Moreover, there were no gender differences in serum ACE activity (95% CI for difference−8.6 to 6.6 IU/L) in our population. Our “healthy normals” did not report tiredness or other symptoms of OSAHS, but they did not undergo sleep studies. They also did not have BMIs recorded or BP monitoring because we wanted to minimize the time of their involvement (they were recruited at their workplace and always during their working hours). Also, we did not want to reduce their participation by screening for a recognized illness (HT). Despite these measures, we had a significant number of refusals (9 of 35). We were most interested in checking that our local (non-sleepy subjects) population level of serum ACE activity and I/D allele frequency was comparable to others. In future studies, BP and sleep studies of healthy controls should be recorded.

In summary, we have shown that levels of serum ACE activity in OSAHS patients are no different from Sleepy Snorers or non-sleepy healthy controls. Moreover, this is the only reported study to date to show that serum ACE in OSAHS does not change despite resolution of symptoms and SDB of OSAHS with CPAP. If the recurrent episodes of hypoxia/ reoxygenation that occur during each apnea do indeed stimulate the synthesis of ACE in endothelial cells, then there is no corresponding change in serum ACE activity. If the Insertion and Deletion ACE alleles interact with SDB to cause HT, then they do so by mechanisms other than by changing serum ACE activity. Our study suggests that the cardiovascular morbidity seen in OSAHS is not driven by or manifested by serum ACE activity.

ABBREVIATIONS

OSAHS

Obstructive sleep apnea hypopnea syndrome

CPAP

Continuous positive airway pressure

DR

dip rate

UK

United Kingdom

SDB

Sleep disordered breathing

BMI

Body mass index

ACE

Angiotensin-converting enzyme

BP

Blood pressure

HT

Hypertension